Image Library
Entries with manually generated images from the JenaLib are marked in bold.
Clicking on the hetero component identifier generates an image. The structural information is taken from the first listed PDB/NDB entry. In addition, all hetero components can be visualized interactively (RasMol/Chime/VRML) on the JenaLib atlas pages.

From the Database of Hetero Components

14706 entries selected from PDBlist WHERE class LIKE 'prot-nuc' 

   

Code	Class Resolution	Description

004    (2S)-AMINO(PHENYL)ETHANOIC ACID

Code	Class Resolution	Description
1sm1	prot-nuc 3.42	(2S)-AMINO(PHENYL)ETHANOIC ACID C8 H9 N O2	COMPLEX OF THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADI WITH QUINUPRISTIN AND DALFOPRISTIN 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L36, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L27, GENERAL STRESS PROTEIN CTC, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L19, 50S RIBOSOMAL PROTEIN L18, 50S RIBOSOMAL PROTEIN L33, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L17, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L9, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L31, 50S RIBOSOMAL PROTEIN L16, QUINUPRISTIN, 50S RIBOSOMAL PROTEIN L32, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L13 RIBOSOME/ANTIBIOTIC RIBOSOME-ANTIBIOTIC COMPLEX, QUINUPRISTIN, DALFOPRISTIN, STREPTOGRAMINS, SYNERCID, RIBOSOME, 50S RIBOSOMAL SUBUNIT, ANTIBIOTIC COMPLEX
1yit	prot-nuc 2.80	(2S)-AMINO(PHENYL)ETHANOIC ACID C8 H9 N O2	CRYSTAL STRUCTURE OF VIRGINIAMYCIN M AND S BOUND TO THE 50S SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L37AE, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L24P, VIRGINIAMYCIN S1, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L29P RIBOSOME/ANTIBIOTIC VIRGINIAMYCIN M, VIRGINIAMYCIN S, PEPTIDYL TRANSFERASE, RIBO STREPTOGRAMIN, RIBOSOME-ANTIBIOTIC COMPLEX, ANTIBIOTIC, CYCLOHEXADEPSIPEPTIDE
1yjw	prot-nuc 2.90	(2S)-AMINO(PHENYL)ETHANOIC ACID C8 H9 N O2	CRYSTAL STRUCTURE OF QUINUPRISTIN BOUND TO THE G2099A MUTANT RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24P, QUINUPRISTIN, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L39E RIBOSOME/ANTIBIOTIC QUINUPRISTIN, DALFOPRISTIN, STREPTOGRAMIN, ANTIBIOTIC, MUTAT SUBUNITS, RIBOSOME, RIBOSOME-ANTIBIOTIC COMPLEX

02I    (6S,7S,8S,10R)-4-AMINO-8-HYDROXY-7,8,9,10-TETRAHYDRO- 6H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
4x67	prot-nuc 4.10	(6S,7S,8S,10R)-4-AMINO-8-HYDROXY-7,8,9,10-TETRAHYDRO- 6H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O6 P	CRYSTAL STRUCTURE OF ELONGATING YEAST RNA POLYMERASE II STAL OXIDATIVE CYCLOPURINE DNA LESIONS. DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: F, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: LRNA_9 MER, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB2, TEMPLATE DNA _29 MER, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB11, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB3, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: J, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB1, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: E, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: HDNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB9 TRANSCRIPTION/DNA POL II ELONGATION COMPLEX OXIDATIVE CYCLOPURINE DNA LESIONS, TRANSCRIPTION-DNA COMPLEX
4x6a	prot-nuc 3.96	(6S,7S,8S,10R)-4-AMINO-8-HYDROXY-7,8,9,10-TETRAHYDRO- 6H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O6 P	CRYSTAL STRUCTURE OF YEAST RNA POLYMERASE II ENCOUNTERING OX CYCLOPURINE DNA LESIONS DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: J, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: E, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB1, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: HDNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB9, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: F, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: LRNA_9 MER, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB11, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB2, TEMPLATE DNA _29 MER, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB3 TRANSCRIPTION/DNA POL II ELONGATION COMPLEX OXIDATIVE CYCLOPURINE DNA LESIONS, TRANSCRIPTION-DNA COMPLEX

08Q    5'-O-{(S)-HYDROXY[(2-SULFANYLETHYL) AMINO]PHOSPHORYL}THYMIDINE

Code	Class Resolution	Description
3u6c	prot-nuc 1.80	5'-O-{(S)-HYDROXY[(2-SULFANYLETHYL) AMINO]PHOSPHORYL}THYMIDINE C12 H20 N3 O7 P S	MUTM SET 1 APGO FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE, DNA (5'-D(*GP*GP*TP*AP*GP*AP*TP*CP*CP*TP*GP*AP*C) CHAIN: B, DNA (5'-D(P*CP*AP*(8OG)P*GP*AP*(TX)P*CP*TP*AP*C)- CHAIN: C HYDROLASE/DNA DNA GLYCOSYLASE, DNA REPAIR, SEQUENCE CONTEXT, LESION RECOGN DISULFIDE CROSSLINKING, HYDROLASE-DNA COMPLEX
3u6d	prot-nuc 1.87	5'-O-{(S)-HYDROXY[(2-SULFANYLETHYL) AMINO]PHOSPHORYL}THYMIDINE C12 H20 N3 O7 P S	MUTM SET 1 GPGO FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE, DNA (5'-D(*A*GP*GP*TP*AP*GP*AP*TP*CP*CP*CP*GP*AP* 3'), DNA (5'-D(*TP*GP*CP*GP*TP*CP*GP*(8OG)P*GP*AP*(TX) P*CP*TP*AP*CP*C)-3') HYDROLASE/DNA DNA GLYCOSYLASE, DNA REPAIR, LESION RECOGNITION, SEQUENCE CO DISULFIDE CROSSLINKING, HYDROLASE-DNA COMPLEX
3u6e	prot-nuc 1.70	5'-O-{(S)-HYDROXY[(2-SULFANYLETHYL) AMINO]PHOSPHORYL}THYMIDINE C12 H20 N3 O7 P S	MUTM SET 1 TPGO FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE, DNA (5'-D(*TP*GP*CP*GP*TP*CP*TP*(8OG)P*GP*AP*(08Q P*CP*TP*AP*CP*C)-3'), DNA (5'-D(*A*GP*GP*TP*AP*GP*AP*TP*CP*CP*AP*GP*AP* 3') HYDROLASE/DNA DNA GLYCOSYLASE, DNA REPAIR, SEQUENCE CONTEXT, LESION RECOGN DISULFIDE CROSSLINKING, HYDROLASE-DNA COMPLEX
3u6o	prot-nuc 1.90	5'-O-{(S)-HYDROXY[(2-SULFANYLETHYL) AMINO]PHOSPHORYL}THYMIDINE C12 H20 N3 O7 P S	MUTM SET 1 APG DNA (5'-D(*TP*GP*CP*GP*TP*CP*AP*GP*GP*AP*(08Q) P*CP*TP*AP*CP*C)-3'), DNA (5'-D(*A*GP*GP*TP*AP*GP*AP*TP*CP*CP*TP*GP*AP* 3'), FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE HYDROLASE/DNA DNA GLYCOSYLASE, DNA REPAIR, SEQUENCE CONTEXT, LESION RECOGN DISULFIDE CROSSLINKING, HYDROLASE-DNA COMPLEX
3u6p	prot-nuc 1.60	5'-O-{(S)-HYDROXY[(2-SULFANYLETHYL) AMINO]PHOSPHORYL}THYMIDINE C12 H20 N3 O7 P S	MUTM SET 1 GPG FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE, DNA (5'-D(*A*GP*GP*TP*AP*GP*AP*TP*CP*CP*CP*GP*AP* 3'), DNA (5'-D(*TP*GP*CP*GP*TP*CP*GP*GP*GP*AP*(08Q) P*CP*TP*AP*CP*C)-3') HYDROLASE/DNA DNA GLYCOSYLASE, DNA REPAIR, SEQUENCE CONTEXT, LESION RECOGN DISULFIDE CROSSLINKING, HYDROLASE-DNA COMPLEX
3u6s	prot-nuc 1.77	5'-O-{(S)-HYDROXY[(2-SULFANYLETHYL) AMINO]PHOSPHORYL}THYMIDINE C12 H20 N3 O7 P S	MUTM SET 1 TPG DNA (5'-D(*TP*GP*CP*GP*TP*CP*TP*GP*GP*AP*(08Q) P*CP*TP*AP*CP*C)-3'), DNA (5'-D(*A*GP*GP*TP*AP*GP*AP*TP*CP*CP*AP*GP*AP* 3'), FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE HYDROLASE/DNA DNA GLYCOSYLASE, DNA REPAIR, SEQUENCE CONTEXT, LESION RECOGN DISULFIDE CROSSLINKING, HYDROLASE-DNA COMPLEX

08T    [[[(2R,3S,4R,5R)-5-(6-AMINOPURIN-9-YL)-3,4- BIS(OXIDANYL)OXOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL]OXY-OXIDANYL-PHOSPHORYL]OXY- TRIS(FLUORANYL)BERYLLIUM

Code	Class Resolution	Description
3u5z	prot-nuc 3.50	[[[(2R,3S,4R,5R)-5-(6-AMINOPURIN-9-YL)-3,4- BIS(OXIDANYL)OXOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL]OXY-OXIDANYL-PHOSPHORYL]OXY- TRIS(FLUORANYL)BERYLLIUM 6(C10 H14 BE F3 N5 O10 P2)	STRUCTURE OF T4 BACTERIOPHAGE CLAMP LOADER BOUND TO THE T4 C PRIMER-TEMPLATE DNA, AND ATP ANALOG DNA POLYMERASE ACCESSORY PROTEIN 62, DNA POLYMERASE PROCESSIVITY COMPONENT, PRIMER DNA STRAND, DNA POLYMERASE ACCESSORY PROTEIN 44, TEMPLATE DNA STRAND DNA BINDING PROTEIN/DNA AAA+, ATP HYDROLASE, CLAMP LOADER, SLIDING CLAMP, DNA BINDIN PROTEIN-DNA COMPLEX
3u60	prot-nuc 3.34	[[[(2R,3S,4R,5R)-5-(6-AMINOPURIN-9-YL)-3,4- BIS(OXIDANYL)OXOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL]OXY-OXIDANYL-PHOSPHORYL]OXY- TRIS(FLUORANYL)BERYLLIUM 3(C10 H14 BE F3 N5 O10 P2)	STRUCTURE OF T4 BACTERIOPHAGE CLAMP LOADER BOUND TO OPEN CLA AND ATP ANALOG DNA POLYMERASE ACCESSORY PROTEIN 44, DNA POLYMERASE ACCESSORY PROTEIN 62, DNA POLYMERASE PROCESSIVITY COMPONENT, PRIMER DNA STRAND, TEMPLATE DNA STRAND DNA BINDING PROTEIN/DNA AAA+, ATP HYDROLASE, SLIDING CLAMP, DNA BINDING PROTEIN-DNA
3u61	prot-nuc 3.20	[[[(2R,3S,4R,5R)-5-(6-AMINOPURIN-9-YL)-3,4- BIS(OXIDANYL)OXOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL]OXY-OXIDANYL-PHOSPHORYL]OXY- TRIS(FLUORANYL)BERYLLIUM 2(C10 H14 BE F3 N5 O10 P2)	STRUCTURE OF T4 BACTERIOPHAGE CLAMP LOADER BOUND TO CLOSED C AND ATP ANALOG AND ADP DNA POLYMERASE ACCESSORY PROTEIN 44, TEMPLATE DNA STRAND, PRIMER DNA STRAND, DNA POLYMERASE ACCESSORY PROTEIN 62, DNA POLYMERASE PROCESSIVITY COMPONENT DNA BINDING PROTEIN/DNA AAA+, ATP HYDROLASE, CLAMP LOADER, SLIDING CLAMP, PRIMER-TEM DNA, DNA BINDING PROTEIN-DNA COMPLEX

0AD    2'-DEOXY-N-PROPYLGUANOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2kv6	prot-nuc NMR    	2'-DEOXY-N-PROPYLGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) C13 H20 N5 O7 P	TETRAPEPTIDE KWKK CONJUGATED TO OLIGONUCLEOTIDE DUPLEX BY A TRIMETHYLENE TETHER KWKK TETRAPEPTIDE, 5'-D(*GP*GP*AP*CP*TP*CP*GP*CP*TP*AP*GP*C)-3', 5'-D(*GP*CP*TP*AP*GP*CP*GP*AP*GP*TP*CP*C)-3' DNA BINDING PROTEIN/DNA DNA-PEPTIDE CONJUGATE, TRIMETHYLENE, ACROLEIN-DG ADDUCT, DNA COMPLEX, DNA BINDING PROTEIN-DNA COMPLEX

0G4    [[[[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL]OXY-OXIDANYL-PHOSPHORYL]AMINO]PHOSPHONIC ACID

Code	Class Resolution	Description
4qw9	prot-nuc 2.40	[[[[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL]OXY-OXIDANYL-PHOSPHORYL]AMINO]PHOSPHONIC ACID C8 H14 F N4 O11 P3 S	TERNARY CRYSTAL STRUCTURES OF A Y-FAMILY DNA POLYMERASE DPO4 SULFOLOBUS SOLFATARICUS IN COMPLEX WITH DNA AND (-)FTC-PPNP DNA POLYMERASE IV: DPO4, DNA (5'- D(P*CP*AP*GP*GP*AP*GP*TP*CP*CP*TP*GP*TP*AP*GP*CP*C)-3'), DNA (5'-D(P*GP*GP*CP*TP*AP*CP*AP*GP*GP*AP*CP*TP*C CHAIN: C TRANSFERASE/DNA Y-FAMILY DNA POLYMERASE, TRANSFERASE-DNA COMPLEX, DPO4, POLY

0G6    D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE

Code	Class Resolution	Description
1hao	prot-nuc 2.80	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	COMPLEX OF HUMAN ALPHA-THROMBIN WITH A 15MER OLIGONUCLEOTIDE GGTTGGTGTGGTTGG (BASED ON NMR MODEL OF DNA) DNA 5'-D(*GP*GP*TP*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP* CHAIN: D, ALPHA-THROMBIN HEAVY CHAIN: RESIDUES 364-622, ALPHA-THROMBIN LIGHT CHAIN: RESIDUES 328-363 HYDROLASE/HYDROLASE INHIBITOR/DNA COAGULATION, QUADRUPLE HELIX, HYDROLASE-HYDROLASE INHIBITOR- COMPLEX
1hap	prot-nuc 2.80	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	COMPLEX OF HUMAN ALPHA-THROMBIN WITH A 15MER OLIGONUCLEOTIDE GGTTGGTGTGGTTGG (BASED ON X-RAY MODEL OF DNA) 5'-D(*GP*GP*TP*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP*GP*G CHAIN: D, THROMBIN HEAVY CHAIN: RESIDUES 364-622, THROMBIN LIGHT CHAIN: RESIDUES 328-363 HYDROLASE/HYDROLASE INHIBITOR/DNA COAGULATION, QUADRUPLE HELIX, HYDROLASE-HYDROLASE INHIBITOR- COMPLEX
3dd2	prot-nuc 1.90	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	CRYSTAL STRUCTURE OF AN RNA APTAMER BOUND TO HUMAN THROMBIN THROMBIN LIGHT CHAIN, THROMBIN HEAVY CHAIN, RNA (26-MER) HYDROLASE/HYDROLASE INHIBITOR/RNA THROMBIN, APTAMER, RNA, DNA, HEPARIN, EXOSITE, PROTEASE, SER PROTEASE, HYDROLASE-HYDROLASE INHIBITOR-RNA COMPLEX
3qlp	prot-nuc 2.14	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN ALPHA THROMBIN MODIFIED THROMBIN BINDING APTAMER (MTBA) THROMBIN HEAVY CHAIN, THROMBIN LIGHT CHAIN, MODIFIED THROMBIN BINDING DNA APTAMER HYDROLASE/HYDROLASE INHIBITOR/DNA PROTEIN-DNA COMPLEX, SERINE PROTEASE, BLOOD COAGULATION, APT SERINE PROTEASE FOLD, HYDROLASE-HYDROLASE INHIBITOR-DNA COM
4dih	prot-nuc 1.80	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN ALPHA THROMBIN THROMBIN BINDING APTAMER IN THE PRESENCE OF SODIUM IONS PROTHROMBIN: HEAVY CHAIN FRAGMENT (UNP RESIDUES 364-622), THROMBIN BINDING APTAMER, PROTHROMBIN: LIGHT CHAIN FRAGMENT (UNP RESIDUES 328-363) HYDROLASE/HYDROLASE INHIBITOR/DNA PROTEIN-DNA COMPLEX, SERINE PROTEASE, BLOOD COAGULATION, APT HYDROLASE-HYDROLASE INHIBITOR-DNA COMPLEX, SERINE PROTEASE APTAMER, BLOOD, G-QUADRUPLEX
4dii	prot-nuc 2.05	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN ALPHA THROMBIN THROMBIN BINDING APTAMER IN THE PRESENCE OF POTASSIUM IONS PROTHROMBIN: LIGHT CHAIN (UNP RESIDUES 328-363), PROTHROMBIN: HEAVY CHAIN (UNP RESIDUES 364-622), THROMBIN BINDING APTAMER HYDROLASE/HYDROLASE INHIBITOR/DNA PROTEIN-DNA COMPLEX, SERINE PROTEASE, BLOOD COAGULATION, APT HYDROLASE-HYDROLASE INHIBITOR-DNA COMPLEX, SERINE PROTEASE APTAMER, BLOOD, G-QUADRUPLEX
4i7y	prot-nuc 2.40	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	CRYSTAL STRUCTURE OF HUMAN ALPHA THROMBIN IN COMPLEX WITH A APTAMER BOUND TO EXOSITE II PROTHROMBIN: HEAVY CHAIN (UNP RESIDUES 364-622), DNA (27-MER), PROTHROMBIN: LIGHT CHAIN (UNP RESIDUES 328-363) HYDROLASE/HYDROLASE INHIBITOR/DNA PROTEIN-DNA COMPLEX, SERINE PROTEASE, BLOOD COAGULATION, APT HYDROLASE-HYDROLASE INHIBITOR-DNA COMPLEX, SERINE PROTEASE APTAMER, BLOOD, G-QUADRUPLEX, DUPLEX-QUADRUPLEX JUNCTION
4lz1	prot-nuc 1.65	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN THROMBIN AND TH DELETION MUTANT LACKING THYMINE 12 NUCLEOBASE THROMBIN BINDING APTAMER, THROMBIN HEAVY CHAIN, THROMBIN LIGHT CHAIN HYDROLASE/HYDROLASE INHIBITOR/DNA PROTEIN-DNA COMPLEX, BLOOD COAGULATION, APTAMER, INHIBITOR-D COMPLEX, DNA APTAMER, G-QUADRUPLEX, SERINE PROTEASE, HYDROL ABASIC FURAN, DNA THYMINE NUCLEOBASE DELETION, BLOOD, HYDRO COMPLEX, HYDROLASE-HYDROLASE INHIBITOR-DNA COMPLEX
4lz4	prot-nuc 2.56	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE 2(C21 H34 CL N6 O3 1+)	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN THROMBIN AND TH DELETION MUTANT LACKING THYMINE 3 NUCLEOBASE THROMBIN HEAVY CHAIN, THROMBIN BINDING APTAMER (TBA), THROMBIN LIGHT CHAIN HYDROLASE/HYDROLASE INHIBITOR/DNA PROTEIN-DNA COMPLEX, DNA APTAMER, G-QUADRUPLEX, TBA DELETION SERINE PROTEASE, HYDROLASE, BLOOD COAGULATION, BLOOD, HYDRO COMPLEX, HYDROLASE-HYDROLASE INHIBITOR-DNA COMPLEX
5cmx	prot-nuc 2.98	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN ALPHA THROMBIN DUPLEX/QUADRUPLEX 31-MER DNA APTAMER ALPHA THROMBIN-LIGHT CHAIN, THROMBIN HEAVY CHAIN, RE31 HYDROLASE DNA APTAMER, DUPLEX/G-QUADRUPLEX FOLD, THROMBIN, EXOSITE I,
5do4	prot-nuc 1.86	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	THROMBIN-RNA APTAMER COMPLEX RNA (25-MER), THROMBIN HEAVY CHAIN, THROMBIN LIGHT CHAIN HYDROLASE/RNA THROMBIN-RNA APTAMER, PHOSPHORODITHIOATE RNA, PS2-RNA, PS2 L HYDROLASE-RNA COMPLEX
5ew1	prot-nuc 2.95	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	HUMAN THROMBIN SANDWICHED BETWEEN TWO DNA APTAMERS: HD22 AND DELTAT3 HD22 (27MER), THROMBIN HEAVY CHAIN, THROMBIN LIGHT CHAIN, HD1-DELTAT3 PROTEIN/DNA PROTEIN-DNA COMPLEX, BLOOD COAGULATION, DNA APTAMER, DNA-INH G-QUADRUPLEX, DUPLEX-QUADRUPLEX JUNCTION, SERINE PROTEASE, HYDROLASE, ABASIC FURAN, HYDROLASE-DNA COMPLEX
5ew2	prot-nuc 3.59	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	HUMAN THROMBIN SANDWICHED BETWEEN TWO DNA APTAMERS: HD22 AND DELTAT12 THROMBIN HEAVY CHAIN, HD22 (27MER), HD1-DELTAT12, THROMBIN LIGHT CHAIN PROTEIN/DNA PROTEIN-DNA COMPLEX, BLOOD COAGULATION, DNA APTAMER, DNA-INH G-QUADRUPLEX, DUPLEX-QUADRUPLEX JUNCTION, SERINE PROTEASE, HYDROLASE, ABASIC FURAN, HYDROLASE-DNA COMPLEX
5luw	prot-nuc 1.69	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN ALPHA-THROMBIN MODIFIED 15-MER DNA APTAMER CONTAINING 5-(3-(2-(1H-INDOL-3- ACETAMIDE-N-YL)-1-PROPEN-1-YL)-2'-DEOXYURIDINE RESIDUE GA63A - TBA MODIFIED APTAMER, PROTHROMBIN, PROTHROMBIN HYDROLASE/DNA ALPHA THROMBIN, APTAMER, THROMBIN-MTBA, COMPLEX, HYDROLASE-D COMPLEX
5luy	prot-nuc 2.24	D-PHENYLALANYL-N-[(2S,3S)-6-{[AMINO(IMINIO) METHYL]AMINO}-1-CHLORO-2-HYDROXYHEXAN-3-YL]-L- PROLINAMIDE C21 H34 CL N6 O3 1+	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN ALPHA-THROMBIN MODIFIED 15-MER DNA APTAMER CONTAINING 5-(3-(ACETAMIDE-N-YL PROPEN-1-YL)-2'-DEOXYURIDINE RESIDUE PROTHROMBIN, PROTHROMBIN, GA68B2 - MODIFIED HUMAN THROMBIN BINDING APTAMER HYDROLASE/DNA ALPHA THROMBIN, APTAMER, THROMBIN-MTBA, COMPLEX, HYDROLASE-D COMPLEX

0G7    D-PHENYLALANYL-N-[(3S)-6-CARBAMIMIDAMIDO-1-CHLORO-2- OXOHEXAN-3-YL]-L-PROLINAMIDE

Code	Class Resolution	Description
1hut	prot-nuc 2.90	D-PHENYLALANYL-N-[(3S)-6-CARBAMIMIDAMIDO-1-CHLORO-2- OXOHEXAN-3-YL]-L-PROLINAMIDE C21 H31 CL N6 O3	THE STRUCTURE OF ALPHA-THROMBIN INHIBITED BY A 15-MER SINGLE DNA APTAMER DNA 5'-D(*GP*GP*TP*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP* CHAIN: D, ALPHA-THROMBIN HEAVY CHAIN: RESIDUES 364-622, ALPHA-THROMBIN LIGHT CHAIN: RESIDUES 328-363 HYDROLASE/HYDROLASE INHIBITOR/DNA THROMBIN, BLOOD CLOTTING, HYDROLASE-HYDROLASE INHIBITOR-DNA

0G8    [(2R,5S)-5-(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)-1,3- OXATHIOLAN-2-YL]METHYL TRIHYDROGEN DIPHOSPHATE

Code	Class Resolution	Description
4qwa	prot-nuc 2.20	[(2R,5S)-5-(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)-1,3- OXATHIOLAN-2-YL]METHYL TRIHYDROGEN DIPHOSPHATE C8 H13 N3 O9 P2 S	TERNARY CRYSTAL STRUCTURES OF A Y-FAMILY DNA POLYMERASE DPO4 SULFOLOBUS SOLFATARICUS IN COMPLEX WITH DNA AND (-)3TC-DP DNA (5'- D(P*CP*AP*GP*GP*AP*GP*TP*CP*CP*TP*GP*TP*AP*GP*CP*C)-3'), DNA (5'-D(P*GP*GP*CP*TP*AP*CP*AP*GP*GP*AP*CP*TP*C CHAIN: C, DNA POLYMERASE IV: DPO4 TRANSFERASE/DNA Y-FAMILY DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

0KL    5-(5-AMINOPENT-1-YN-1-YL)-2'-DEOXYURIDINE 5'- (TETRAHYDROGEN TRIPHOSPHATE)

Code	Class Resolution	Description
4dfj	prot-nuc 1.90	5-(5-AMINOPENT-1-YN-1-YL)-2'-DEOXYURIDINE 5'- (TETRAHYDROGEN TRIPHOSPHATE) C14 H22 N3 O14 P3	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQUATICUS IN A CLOSED TERNARY COMPLEX WITH 5-(AMINO DTTP DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, 5'-D(GACCACGGCGC DOC)-3': DNA PRIMER, 5'-D(AAAAGGCGCCGTGGTC)-3': DNA TEMPLATE TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

0KX    2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE

Code	Class Resolution	Description
4dl2	prot-nuc 2.15	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	HUMAN DNA POLYMERASE ETA INSERTING DCMPNPP OPPOSITE CG TEMPL DNA POLYMERASE ETA: UNP RESIDUES 1-432, DNA (5'-D(*TP*AP*GP*TP*GP*TP*GP*AP*G)-3'), DNA (5'-D(*AP*CP*GP*GP*CP*TP*CP*AP*CP*AP*CP*T)-3' CHAIN: T TRANSFERASE/DNA/INHIBITOR CISPLATIN, CHEMORESISTENCE, TRANSLESION SYNTHESIS, HUMAN DNA POLYMERSE ETA, KINETICS, MOLECULAR SPLINT, INHIBITION, DNA DISTORSION, SECOND TLS POLYMERASE, NUCLEOTIDYL TRANSFER REA PCNA, TRANSFERASE-DNA-INHIBITOR COMPLEX
4dl3	prot-nuc 2.10	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	HUMAN DNA POLYMERASE ETA INSERTING DCMPNPP OPPOSITE GG TEMPL (GG0B). DNA (5'-D(*TP*AP*CP*GP*GP*TP*CP*AP*CP*AP*CP*T)-3' CHAIN: T, DNA (5'-D(*TP*AP*GP*TP*GP*TP*GP*AP*C)-3'), DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA/INHIBITOR CISPLATIN, CHEMORESISTENCE, TRANSLESION SYNTHESIS, HUMAN DNA POLYMERSE ETA, KINETICS, MOLECULAR SPLINT, INHIBITION, DNA DISTORSION, SECOND TLS POLYMERASE, NUCLEOTIDYL TRANSFER REA PCNA, NUCLEUS, TRANSFERASE-DNA-INHIBITOR COMPLEX
4dl4	prot-nuc 2.00	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	HUMAN DNA POLYMERASE ETA INSERTING DCMPNPP OPPOSITE THE 3'G CISPLATIN CROSSLINKED GS (PT-GG1). DNA (5'-D(P*GP*GP*CP*TP*CP*AP*CP*AP*CP*T)-3'), DNA (5'-D(*TP*AP*GP*TP*GP*TP*GP*AP*G)-3'), DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA/INHIBITOR CISPLATIN, CHEMORESISTENCE, TRANSLESION SYNTHESIS, HUMAN DNA POLYMERSE ETA, KINETICS, MOLECULAR SPLINT, INHIBITION, DNA DISTORSION, SECOND TLS POLYMERASE, NUCLEOTIDYL TRANSFER REA PCNA, TRANSFERASE-DNA-INHIBITOR COMPLEX
4dl5	prot-nuc 2.92	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	HUMAN DNA POLYMERASE ETA INSERTING DCMPNPP OPPOSITE THE 5'G CISPLATIN CROSSLINKED GS (PT-GG2). DNA (5'-D(P*TP*AP*GP*TP*GP*TP*GP*AP*C)-3'), DNA (5'-D(*TP*AP*CP*GP*GP*TP*CP*AP*CP*AP*CP*T)-3' CHAIN: T, DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA/INHIBITOR CISPLATIN, CHEMORESISTENCE, TRANSLESION SYNTHESIS, HUMAN DNA POLYMERSE ETA, KINETICS, MOLECULAR SPLINT, INHIBITION, DNA DISTORSION, SECOND TLS POLYMERASE, NUCLEOTIDYL TRANSFER REA PCNA, TRANSFERASE-DNA-INHIBITOR COMPLEX
4irc	prot-nuc 2.67	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE 2(C9 H17 N4 O12 P3)	POLYMERASE-DNA COMPLEX DNA (5'- D(*CP*TP*AP*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3'), DNA (5'-D(*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP CHAIN: H, DNA POLYMERASE IV, DNA (5'- D(*TP*CP*TP*GP*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3' CHAIN: G, B TRANSFERASE/DNA DNA POLYMERASE, Y-FAMILY, TRANSFERASE-DNA COMPLEX
4mfc	prot-nuc 2.13	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH O6MG I TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP UP PRIMER, TEMPLATE, DN PRIMER, DNA POLYMERASE BETA TRANSFERASE/DNA DNA POLYMERASE X FAMILY, DNA SYNTHESIS, TRANSFERASE-DNA COMP
4nlk	prot-nuc 2.49	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH 8BRG I TEMPLATE BASE-PAIRED WITH INCOMING NON-HYDROLYZABLE CTP 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*(BGM)P*TP*CP*GP*CP*AP*TP*CP* 3', DNA POLYMERASE BETA TRANSFERASE, LYASE/DNA DNA BINDING, HELIX-TURN-HELIX MOTIF, POLYMERASE FOLD, NUCLEO TRANSFERASE, NUCLEUS, TRANSFERASE, LYASE-DNA COMPLEX
4ny8	prot-nuc 2.25	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	DNA POLYMERASE BETA WITH O6MG IN THE TEMPLATE BASE OPPOSITE INCOMING NON-HYDROLYZABLE CTP WITH MANGANESE IN THE ACTIVE DNA POLYMERASE BETA: UNP RESIDUES 10-335, 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*(6OG)P*TP*CP*GP*CP*AP*TP*CP* 3', 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3' TRANSFERASE, LYASE/DNA DNA BINDING, DNA POLYMERASE FOLD, NUCLEOTIDYL TRANSFER, NUCL TRANSFERASE, LYASE-DNA COMPLEX
4o3n	prot-nuc 1.58	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA IN TERNARY COM NATIVE DNA AND INCOMING NUCLEOTIDE (DCP) DNA (5'-D(*CP*AP*TP*GP*AP*TP*GP*AP*CP*GP*CP*T)-3' CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA POLYMERASE ETA TRANSFERASE/DNA CATALYTIC DOMAIN, DNA, DNA DAMAGE, DNA-DIRECTED DNA POLYMERA CYTOSINE TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SY (TLS), DNA BINDING, TRANSFERASE-DNA COMPLEX
4o3p	prot-nuc 1.72	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	CRYSTAL STRUCTURE OF HUMAN POLYMERASE ETA INSERTING DCTP OPP 8-OXOG CONTAINING DNA TEMPLATE DNA (5'-D(*CP*AP*TP*(8OG)P*AP*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA POLYMERASE ETA TRANSFERASE/DNA CATALYTIC DOMAIN, DNA, DNA DAMAGE, DNA-DIRECTED DNA POLYMERA CYTOSINE TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SY (TLS), DNA BINDING, 8-OXOG LESION BYPASS, TRANSFERASE-DNA C
4o3r	prot-nuc 1.62	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	CRYSTAL STRUCTURE OF HUMAN POLYMERASE ETA EXTENDING AN 8-OXO LESION: POST INSERTION OF 8-OXOG-DA PAIR DNA (5'-D(*CP*AP*TP*GP*(8OG)P*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*A)-3'), DNA POLYMERASE ETA TRANSFERASE/DNA CATALYTIC DOMAIN, DNA, DNA DAMAGE, DNA-DIRECTED DNA POLYMERA CYTOSINE TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SY (TLS), DNA BINDING, 8-OXOG LESION BYPASS, TRANSFERASE-DNA C
4o3s	prot-nuc 1.72	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	CRYSTAL STRUCTURE OF HUMAN POLYMERASE ETA EXTENDING AN 8-OXO LESION: POST INSERTION OF 8-OXOG-DC PAIR DNA POLYMERASE ETA, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*C)-3'), DNA (5'-D(*CP*AP*TP*GP*(8OG)P*TP*GP*AP*CP*GP*CP*T CHAIN: T TRANSFERASE/DNA CATALYTIC DOMAIN, DNA, DNA DAMAGE, DNA-DIRECTED DNA POLYMERA CYTOSINE TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SY (TLS), DNA BINDING, 8-OXOG LESION BYPASS, TRANSFERASE-DNA C
4o5k	prot-nuc 2.06	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	STRUCTURE OF HUMAN DNA POLYMERASE COMPLEXED WITH N7MG IN THE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP DNA (5'-D(*CP*CP*GP*AP*CP*(FMG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'): TEMPLATE DNA, DNA POLYMERASE BETA: DOWN PRIMER DNA, DNA (5'-D(P*GP*TP*CP*GP*G)-3'): DN PRIMER DNA, DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'): UP PRIMER DNA TRANSFERASE, LYASE/DNA DNA BINDING, POLYMERASE FOLD, NUCLEOTIDYL TRANSFER, DNA, NUC TRANSFERASE, LYASE-DNA COMPLEX
4pha	prot-nuc 2.52	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH A IN T TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP DNA (5'-D(*CP*CP*GP*AP*CP*AP*TP*CP*GP*CP*AP*TP*CP 3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA POLYMERASE BETA TRANSFERASE,LYASE/DNA HUMAN DNA POLYMERASE BETA
4phd	prot-nuc 2.21	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH A IN T TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP AND DNA (5'-D(*CP*CP*GP*AP*CP*AP*TP*CP*GP*CP*AP*TP*CP 3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA POLYMERASE BETA TRANSFERASE,LYASE/DNA HUMAN DNA POLYMERASE BETA
4q43	prot-nuc 2.45	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE 2(C9 H17 N4 O12 P3)	POLYMERASE-DAMAGED DNA COMPLEX DNA (5'-D(*TP*CP*TP*(RDG) P*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3'), DNA (5'- D(*T*CP*TP*AP*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3') CHAIN: C, H, DNA POLYMERASE IV TRANSFERASE/DNA POLYMERASE, DNA POLYMERASE, TRANSLESION SYNTHESIS, TRANSFERA COMPLEX
4q8e	prot-nuc 1.55	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	HUMAN DNA POLYMERASE ETA INSERTING DCMPNPP OPPOSITE A PHENAN ADDUCTED G 5'-D(*CP*AP*TP*GP*CP*TP*CP*AP*CP*AP*CP*T)-3', 5'-D(*AP*GP*TP*GP*TP*GP*AP*G)-3', DNA POLYMERASE ETA TRANSFERASE/DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4ru9	prot-nuc 2.65	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DCMP OPPOSITE A MEFAPY-DG ADDUCTED DNA TEMPLATE NUCLEIC ACIDS PRIMAR: AGCGTCAT, NUCLEIC ACIDS TEMPLATE: CAT(MF7)ATGACGCT, DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA DNA DAMAGE, DNA-DIRECTED DNA POLYMERASE, CYTIDINE TRIPHOSPHA FAMILY POLYMERASE, TRANS-LESION SYNTHESIS (TLS), DNA BINDIN MEFAPY-DG LESION BYPASS, 2,6-DIAMINO-4-HYDROXY-N(5)-(METHYL FORMAMIDOPYRIMIDINE (MEFAPY-DG) LESION, TRANSFERASE-DNA COM
4tuq	prot-nuc 2.37	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	HUMAN DNA POLYMERASE BETA INSERTING DCMPNPP OPPOSITE GG TEMP (GG0B). DNA (5'-D(*CP*CP*CP*AP*CP*GP*GP*CP*CP*CP*AP*TP*CP 3'), DNA (5'-D(*GP*GP*TP*GP*AP*TP*GP*GP*GP*C)-3'), DNA (5'-D(P*GP*TP*GP*GP*G)-3'), DNA POLYMERASE BETA TRANSFERASE,LYASE/DNA DNA POLYMERASE, TRANSFERASE, LYASE-DNA COMPLEX
4tur	prot-nuc 2.17	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	HUMAN DNA POLYMERASE BETA INSERTING DCMPNPP OPPOSITE THE 5'G CISPLATIN CROSSLINKED GS (PT-GG2) DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*GP*GP*G)-3'), DNA (5'-D(*GP*GP*TP*GP*AP*TP*GP*GP*GP*C)-3'), DNA (5'-D(*CP*CP*CP*AP*CP*GP*GP*CP*CP*CP*AP*TP*CP 3') TRANSFERASE,LYASE/DNA DNA POLYMERASE, TRANSFERASE, LYASE-DNA COMPLEX
4tus	prot-nuc 2.42	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	HUMAN DNA POLYMERASE BETA INSERTING DCMPNPP OPPOSITE THE 5'G CISPLATIN CROSSLINKED GS (PT-GG2) WITH MANGANESE IN THE ACT DNA (5'-D(P*GP*TP*GP*GP*G)-3'), DNA POLYMERASE BETA, DNA (5'-D(P*GP*GP*TP*GP*AP*TP*GP*GP*GP*C)-3'), DNA (5'-D(*CP*CP*CP*AP*CP*GP*GP*CP*CP*CP*AP*TP*CP 3') TRANSFERASE,LYASE/DNA DNA POLYMERASE, TRANSFERASE, LYASE-DNA COMPLEX
4u7c	prot-nuc 2.80	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE 2(C9 H17 N4 O12 P3)	STRUCTURE OF DNA POLYMERASE KAPPA IN COMPLEX WITH BENZOPYREN DNA DNA POLYMERASE KAPPA: UNP RESIDUES 27-518, DNA (5'-D(*P*AP*TP*GP*(VKJ)P*CP*TP*GP*AP*TP*CP*CP 3'), DNA (5'-D(P*GP*CP*GP*GP*AP*TP*CP*AP*G)-3') TRANSFERASE/DNA BENZO[A]PYRENE-N2-GUANINE, DNA REPLICATION, DNA DAMAGE TOLER POLYMERASE KAPPA, ENVIRONMENT POLLUTION, TRANSFERASE-DNA CO
4ymn	prot-nuc 2.59	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH N7BG I TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP DNA 10-MER (UP-PRIMER), DNA 16-MER (TEMPLATE), DNA 5-MER (DN-PRIMER), DNA POLYMERASE BETA TRANSFERASE/DNA HUMAN DNA POLYMERASE BETA, TRANSFERASE-DNA COMPLEX
4ymo	prot-nuc 2.15	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH N7BG I TEMPLATE OPPOSITE TO INCOMING NON-HYDROLYZABLE CTP WITH MAN THE ACTIVE SITE DNA 10-MER (UP-PRIMER), DNA 16-MER (TEMPLATE), DNA POLYMERASE BETA, DNA 5-MER (DN-PRIMER) TRANSFERASE/DNA HUMAN DNA POLYMERASE BETA, TRANSFERASE-DNA COMPLEX
4z6c	prot-nuc 2.68	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA 279NA MUTANT COMPLEXE IN THE TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*GP*TP*CP*GP*CP*AP*TP*CP 3'), DNA POLYMERASE BETA TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
5eoz	prot-nuc 2.09	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	MUTAGENICITY OF 7-BENZYL GUANINE LESION AND REPLICATION BY H POLYMERASE BETA DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*(GFL) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') TRANSFERASE/DNA HUMAN DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
5f9n	prot-nuc 2.23	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DCMP A DNA TEMPLATE CONTAINING 1,N2-ETHENODEOXYGUANOSINE LESION DNA POLYMERASE ETA: UNP RESIDUES 1-432, DNA (5'-D(*CP*AP*TP*(GNE)P*AP*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3') TRANSFERASE/DNA DNA POLYMERASE, DNA ENZYME, DNA DAMAGE, TRANSLESION DNA SYNT ETHENO DNA ADDUCTS, TRANSFERASE-DNA COMPLEX, 1, N2- ETHENODEOXYGUANOSINE, LESION BYPASS
5kt2	prot-nuc 2.49	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	TERANRY COMPLEX OF HUMAN DNA POLYMERASE IOTA(26-445) INSERTI OPPOSITE TEMPLATE G IN THE PRESENCE OF MG2+ DNA (5'-D(P*AP*GP*GP*AP*CP*CP*C)-3'), DNA POLYMERASE IOTA: UNP RESIDUES 26-445, DNA (5'-D(*CP*TP*GP*GP*GP*GP*TP*CP*CP*T)-3') TRANSFERASE DNA POLYMERASE, POLI, MAGNESIUM, TRANSFERASE
5kt3	prot-nuc 2.64	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	TERANRY COMPLEX OF HUMAN DNA POLYMERASE IOTA(26-445) INSERTI OPPOSITE TEMPLATE G IN THE PRESENCE OF MN2+ DNA POLYMERASE IOTA: UNP RESIDUES 26-445, DNA (5'-D(P*AP*GP*GP*AP*CP*CP*C)-3'), DNA (5'-D(*CP*TP*GP*GP*GP*GP*TP*CP*CP*T)-3') TRANSFERASE DNA POLYMERASE, POLI, MANGANESE, TRANSFERASE
5kt4	prot-nuc 2.78	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	TERANRY COMPLEX OF HUMAN DNA POLYMERASE IOTA R96G INSERTING OPPOSITE TEMPLATE G IN THE PRESENCE OF MG2+ DNA POLYMERASE IOTA: UNP RESIDUES 1-445, DNA (5'-D(P*AP*GP*GP*AP*CP*CP*C)-3'), DNA (5'-D(*CP*TP*GP*GP*GP*GP*TP*CP*CP*T)-3') TRANSFERASE DNA POLYMERASE, POLI, R96G, MAGNESIUM, TRANSFERASE
5kt5	prot-nuc 2.80	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	TERANRY COMPLEX OF HUMAN DNA POLYMERASE IOTA R96G INSERTING OPPOSITE TEMPLATE G IN THE PRESENCE OF MN2+ DNA (5'-D(*CP*TP*GP*GP*GP*GP*TP*CP*CP*T)-3'), DNA (5'-D(P*AP*GP*GP*AP*CP*CP*C)-3'), DNA POLYMERASE IOTA: UNP RESIDUES 1-445 TRANSFERASE DNA POLYMERASE, POLI, R96G, MANGANESE, TRANSFERASE
5kt6	prot-nuc 3.54	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	TERANRY COMPLEX OF HUMAN DNA POLYMERASE IOTA(1-445) INSERTIN OPPOSITE TEMPLATE G IN THE PRESENCE OF MG2+ DNA POLYMERASE IOTA: UNP RESIDUES 1-445, DNA (5'-D(P*AP*GP*GP*AP*CP*CP*C)-3'), DNA (5'-D(P*TP*GP*GP*GP*GP*TP*CP*CP*T)-3') TRANSFERASE DNA POLYMERASE, POLI, MAGNESIUM, TRANSFERASE
5kt7	prot-nuc 3.15	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	TERANRY COMPLEX OF HUMAN DNA POLYMERASE IOTA(1-445) INSERTIN OPPOSITE TEMPLATE G IN THE PRESENCE OF MN2+ DNA POLYMERASE IOTA, DNA (5'-D(P*AP*GP*GP*AP*CP*CP*C)-3'), DNA (5'-D(P*TP*GP*GP*GP*GP*TP*CP*CP*T)-3') TRANSFERASE DNA POLYMERASE, POLI, MANGANESE, TRANSFERASE
5l1k	prot-nuc 1.82	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	POSTINSERTION COMPLEX OF HUMAN DNA POLYMERASE ETA BYPASSING METHYL-2'-DEOXYGUANOSINE : DC SITE DNA POLYMERASE ETA, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*C)-3'), DNA (5'-D(*CP*AP*TP*GP*(6OG)P*TP*GP*AP*CP*GP*CP*T CHAIN: T TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA POLYMERASE, LESION BYPASS, METHYL-2'-DEOXYGUANOSINE, Y-FAMILY POLYMERASE, TRANSLESION SYNTHESIS (TLS), DNA BINDING PROTEIN., TRANSFERASE-DNA COMP
5l1l	prot-nuc 1.62	2'-DEOXY-5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]CYTIDINE C9 H17 N4 O12 P3	POSTINSERTION COMPLEX OF HUMAN DNA POLYMERASE ETA BYPASSING METHYL-2'-DEOXYGUANOSINE : DT SITE DNA POLYMERASE ETA, DNA (5'-D(*CP*AP*TP*GP*(6OG)P*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3') TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA POLYMERASE, LESION BYPASS, METHYL-2'-DEOXYGUANOSINE, Y-FAMILY POLYMERASE, TRANSLESION SYNTHESIS (TLS), DNA BINDING PROTEIN., TRANSFERASE-DNA COMP

0L3    7-{2-DEOXY-5-O-[(S)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]OXY}PHOSPHORYL]-BETA-D-ERYTHRO- PENTOFURANOSYL}-5-{5-[(10-HYDROXYDECANOYL)AMINO]PENT- 1-YN-1-YL}-7H-PYRROLO[2,3-D]PYRIMIDIN-4-AMINE

Code	Class Resolution	Description
4df4	prot-nuc 2.20	7-{2-DEOXY-5-O-[(S)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]OXY}PHOSPHORYL]-BETA-D-ERYTHRO- PENTOFURANOSYL}-5-{5-[(10-HYDROXYDECANOYL)AMINO]PENT- 1-YN-1-YL}-7H-PYRROLO[2,3-D]PYRIMIDIN-4-AMINE C26 H42 N5 O14 P3	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQUATICUS IN A CLOSED TERNARY COMPLEX WITH 7-(N-(10 HYDROXYDECANOYL)-AMINOPENTINYL)-7-DEAZA-2 -DATP DNA (5'-D(*AP*AP*AP*TP*GP*GP*CP*GP*CP*CP*GP*TP*GP 3'): DNA TEMPLATE, DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC) CHAIN: B: DNA PRIMER, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

0L4    5-(5-AMINOPENT-1-YN-1-YL)-7-{2-DEOXY-5-O-[(S)- HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]OXY}PHOSPHORYL]-BETA-D-ERYTHRO- PENTOFURANOSYL}-7H-PYRROLO[2,3-D]PYRIMIDIN-4-AMINE

Code	Class Resolution	Description
4df8	prot-nuc 2.00	5-(5-AMINOPENT-1-YN-1-YL)-7-{2-DEOXY-5-O-[(S)- HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]OXY}PHOSPHORYL]-BETA-D-ERYTHRO- PENTOFURANOSYL}-7H-PYRROLO[2,3-D]PYRIMIDIN-4-AMINE C16 H24 N5 O12 P3	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQUATICUS IN A CLOSED TERNARY COMPLEX WITH AMINOPEN DEAZA-2-DATP DNA (5'-D(*AP*AP*AP*TP*GP*GP*CP*GP*CP*CP*GP*TP*GP 3'): DNA TEMPLATE, DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC) CHAIN: B: DNA PRIMER, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

0L5    2'-DEOXY-5-{5-[(10-HYDROXYDECANOYL)AMINO]PENT-1-YN-1- YL}URIDINE 5'-(TETRAHYDROGEN TRIPHOSPHATE)

Code	Class Resolution	Description
4dfk	prot-nuc 1.65	2'-DEOXY-5-{5-[(10-HYDROXYDECANOYL)AMINO]PENT-1-YN-1- YL}URIDINE 5'-(TETRAHYDROGEN TRIPHOSPHATE) C24 H40 N3 O16 P3	LARGE FRAGMENT OF DNA POLYMERASE I FROM THERMUS AQUATICUS IN TERNARY COMPLEX WITH 5-(N-(10-HYDROXYDECANOYL)-AMINOPENTINY 5'-D(GACCACGGCGC DOC)-3': DNA PRIMER, 5'-D(AAAAGGCGCCGTGGTC)-3': DNA TEMPLATE, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

0L6    5-(5-AMINOPENT-1-YN-1-YL)-2'-DEOXYCYTIDINE 5'- (TETRAHYDROGEN TRIPHOSPHATE)

Code	Class Resolution	Description
4dfm	prot-nuc 1.89	5-(5-AMINOPENT-1-YN-1-YL)-2'-DEOXYCYTIDINE 5'- (TETRAHYDROGEN TRIPHOSPHATE) C14 H25 N4 O13 P3	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQUATICUS IN TERNARY COMPLEX WITH 5-(AMINOPENTINYL) DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, 5'-D(AAAGCGCGCCGTGGTC)-3': DNA TEMPLATE, 5'-D(GACCACGGCGC DDG)-3': DNA PRIMER TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

0L7    2-AMINO-5-(5-AMINOPENT-1-YN-1-YL)-7-{2-DEOXY-5-O-[(S)- HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]OXY}PHOSPHORYL]-BETA-D-ERYTHRO- PENTOFURANOSYL}-3,7-DIHYDRO-4H-PYRROLO[2,3- D]PYRIMIDIN-4-ONE

Code	Class Resolution	Description
4dfp	prot-nuc 2.00	2-AMINO-5-(5-AMINOPENT-1-YN-1-YL)-7-{2-DEOXY-5-O-[(S)- HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]OXY}PHOSPHORYL]-BETA-D-ERYTHRO- PENTOFURANOSYL}-3,7-DIHYDRO-4H-PYRROLO[2,3- D]PYRIMIDIN-4-ONE C16 H24 N5 O13 P3	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQAUTICUS IN A TERNARY COMPLEX WITH 7-(AMINOPENTINY DEAZA-DGTP 5'-D(AAACGGCGCCGTGGTC)-3', DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC) CHAIN: B, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, UNP RESIDUES 293-831 TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

0OH    NORTH-METHANOCARBA-2'-DEOXYADENOSINE TRIPHOSPHATE

Code	Class Resolution	Description
4ebc	prot-nuc 2.90	NORTH-METHANOCARBA-2'-DEOXYADENOSINE TRIPHOSPHATE C12 H18 N5 O11 P3	CONFORMATIONALLY RESTRAINED NORTH-METHANOCARBA-2'-DEOXYADENO CORRECTS THE ERROR-PRONE NATURE OF HUMAN DNA POLYMERASE IOT 5'-D(P*CP*TP*GP*GP*GP*TP*CP*CP*T)-3', 5'-D(P*AP*GP*GP*AP*CP*CP*(DOC))-3', DNA POLYMERASE IOTA: UNP RESIDUES 26-445 TRANSFERASE/DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4gc6	prot-nuc 2.90	NORTH-METHANOCARBA-2'-DEOXYADENOSINE TRIPHOSPHATE C12 H18 N5 O11 P3	CRYSTAL STRUCTURE OF DPO4 IN COMPLEX WITH N-MC-DAMP OPPOSITE DNA (5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*TP*TP*CP CHAIN: P, DNA (5'- D(*TP*CP*AP*TP*GP*GP*AP*AP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3' CHAIN: T, DNA POLYMERASE IV TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

0OJ    SOUTH-METHANOCARBA-2'-DEOXYADENOSINE TRIPHOSPHATE

Code	Class Resolution	Description
4ebd	prot-nuc 2.57	SOUTH-METHANOCARBA-2'-DEOXYADENOSINE TRIPHOSPHATE C12 H18 N5 O11 P3	CONFORMATIONALLY RESTRAINED NORTH-METHANOCARBA-2'-DEOXYADENO CORRECTS THE ERROR-PRONE NATURE OF HUMAN DNA POLYMERASE IOT DNA POLYMERASE IOTA: UNP RESIDUES 26-445, 5'-D(P*AP*GP*GP*AP*CP*CP*(DOC))-3', 5'-D(P*CP*TP*GP*GP*GP*TP*CP*CP*T)-3' TRANSFERASE/DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4gc7	prot-nuc 2.89	SOUTH-METHANOCARBA-2'-DEOXYADENOSINE TRIPHOSPHATE 2(C12 H18 N5 O11 P3)	CRYSTAL STRUCTURE OF DPO4 IN COMPLEX WITH S-MC-DADP OPPOSITE DNA (5'- D(*TP*CP*AP*TP*GP*GP*AP*AP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3' CHAIN: D, F, DNA (5'-D(*G*GP*GP*GP*GP*AP*AP*GP*GP*AP*TP*TP*CP* CHAIN: C, E, DNA POLYMERASE IV TRANSFERASE/RNA DNA POLYMERASE, TRANSFERASE-RNA COMPLEX

0QZ    D-ISOSERINE

Code	Class Resolution	Description
4oin	prot-nuc 2.80	D-ISOSERINE C3 H7 N O3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077 DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A, 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP G)-3', GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, RNA POL DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCLEOTIDES, NUC TRANSCRIPTION, TRANSFERASE-ANTIBIOTIC COMPLEX
4oip	prot-nuc 3.40	D-ISOSERINE C3 H7 N O3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077, ATP, AND CMPCPP DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, GE23077, 5'-D(*CP*CP*TP*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*T *GP*GP*G)-3', 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, CMPCPP, POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCL NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIBIOTIC COMPLEX
4oiq	prot-nuc 3.62	D-ISOSERINE C3 H7 N O3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077 AND RIFAMPICIN 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP GP*GP*G)-3', DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, RIFAMPI RIFAMPIN, RNA POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATI RIBONUCLEOTIDES, NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIB COMPLEX
4oir	prot-nuc 3.10	D-ISOSERINE C3 H7 N O3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS RNA POLYMERASE TRA INITIATION COMPLEX SOAKED WITH GE23077 AND RIFAMYCIN SV 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP GP*GP*G)-3', 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, RIFAMYCIN SV, I SITE, I+1 RNA POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCLEOTIDES, NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIB COMPLEX

0R5    2'-DEOXY-5-[(4-ETHYNYLPHENYL)ETHYNYL]URIDINE 5'- (TETRAHYDROGEN TRIPHOSPHATE)

Code	Class Resolution	Description
4elt	prot-nuc 2.20	2'-DEOXY-5-[(4-ETHYNYLPHENYL)ETHYNYL]URIDINE 5'- (TETRAHYDROGEN TRIPHOSPHATE) C19 H19 N2 O14 P3	SNAPSHOT OF THE LARGE FRAGMENT OF DNA POLYMERASE I FROM THER AQUATICUS PROCESSING MODIFIED PYRIMIDINES DNA POLYMERASE I, THERMOSTABLE, DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC) CHAIN: B, DNA (5'-D(*AP*AP*AP*AP*GP*GP*CP*GP*CP*CP*GP*TP*GP 3') TRANSFERASE/DNA DNA POLYMERASE, MODIFIED NUCLEOTIDES, A FAMILY, DNA SYNTHESI LINKER, NON-NATURAL NUCLEOTIDE, TRANSFERASE-DNA COMPLEX

0R6    2'-DEOXY-5-[(4-ETHYNYLPHENYL)ETHYNYL]CYTIDINE 5'- (TETRAHYDROGEN TRIPHOSPHATE)

Code	Class Resolution	Description
4elu	prot-nuc 1.80	2'-DEOXY-5-[(4-ETHYNYLPHENYL)ETHYNYL]CYTIDINE 5'- (TETRAHYDROGEN TRIPHOSPHATE) C19 H20 N3 O13 P3	SNAPSHOT OF THE LARGE FRAGMENT OF DNA POLYMERASE I FROM THER AQUATICUS PROCESSING MODIFIED PYRIMIDINES DNA (5'-D(*AP*AP*AP*GP*CP*GP*CP*GP*CP*CP*GP*TP*GP 3'), DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DDG) CHAIN: B, DNA POLYMERASE I, THERMOSTABLE: UNP RESIDUES 293-832 TRANSFERASE/DNA DNA POLYMERASE, MODIFIED NUCLEOTIDES, A FAMILY, DNA SYNTHESI LINKER, TRANSFERASE-DNA COMPLEX

0R7    [[(2S,5R)-5-[4-AZANYL-5-[2-(4-ETHYNYLPHENYL)ETHYNYL]-2- OXIDANYLIDENE-PYRIMIDIN-1-YL]OXOLAN-2-YL]METHOXY- OXIDANYL-PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE

Code	Class Resolution	Description
4elv	prot-nuc 1.90	[[(2S,5R)-5-[4-AZANYL-5-[2-(4-ETHYNYLPHENYL)ETHYNYL]-2- OXIDANYLIDENE-PYRIMIDIN-1-YL]OXOLAN-2-YL]METHOXY- OXIDANYL-PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C19 H20 N3 O12 P3	SNAPSHOT OF THE LARGE FRAGMENT OF DNA POLYMERASE I FROM THER AQUATICUS PROCESSING MODIFIED PYRIMIDINES DNA POLYMERASE I, THERMOSTABLE: UNP RESIDUES 293-832, DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(0R8) CHAIN: B, DNA (5'-D(*AP*AP*AP*GP*GP*GP*CP*GP*CP*CP*GP*TP*GP 3') TRANSFERASE/DNA DNA POLYMERASE, MODIFIED NUCLEOTIDES, A FAMILY, DNA SYNTHESI LINKER, ELONGATION OF MODIFIED DNA, NON-NATURAL NUCLEOTIDE, TRANSFERASE-DNA COMPLEX

0R8    [(2S,5R)-5-{4-AMINO-5-[(4-ETHYNYLPHENYL)ETHYNYL]-2- OXOPYRIMIDIN-1(2H)-YL}TETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
4elv	prot-nuc 1.90	[(2S,5R)-5-{4-AMINO-5-[(4-ETHYNYLPHENYL)ETHYNYL]-2- OXOPYRIMIDIN-1(2H)-YL}TETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHATE C19 H18 N3 O6 P	SNAPSHOT OF THE LARGE FRAGMENT OF DNA POLYMERASE I FROM THER AQUATICUS PROCESSING MODIFIED PYRIMIDINES DNA POLYMERASE I, THERMOSTABLE: UNP RESIDUES 293-832, DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(0R8) CHAIN: B, DNA (5'-D(*AP*AP*AP*GP*GP*GP*CP*GP*CP*CP*GP*TP*GP 3') TRANSFERASE/DNA DNA POLYMERASE, MODIFIED NUCLEOTIDES, A FAMILY, DNA SYNTHESI LINKER, ELONGATION OF MODIFIED DNA, NON-NATURAL NUCLEOTIDE, TRANSFERASE-DNA COMPLEX

0TD    (3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID

Code	Class Resolution	Description
4dr1	prot-nuc 3.60	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE APO 30S RIBOSOMAL SUBUNIT FROM THER THERMOPHILUS (HB8) 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dr2	prot-nuc 3.25	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr3	prot-nuc 3.35	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr4	prot-nuc 3.97	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, COGNATE TRANSFER RNA ANTICODON STEM-LOO MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr5	prot-nuc 3.45	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED COGNATE RNA ANTICODON STEM-LOOP AND STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*U)-3', 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr6	prot-nuc 3.30	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, NEAR-COGNATE TRANSFER RNA ANTICODON STE MISMATCHED AT THE FIRST CODON POSITION AND STREPTOMYCIN BOU 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*UP*U)-3', 5'-R(P*UP*UP*GP*AP*GP*GP*(PSU)P*GP*G)-3', 30S RIBOSOMAL PROTEIN S10, 5'-R(P*CP*UP*UP*GP*AP*GP*GP*(PSU)P*GP*GP*U)-3', 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr7	prot-nuc 3.75	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED NEAR-CO TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE SECOND C POSITION, AND STREPTOMYCIN BOUND 5'-R(P*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*GP*CP*CP*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 5'-R(*UP*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 5'-R(P*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4duy	prot-nuc 3.39	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4duz	prot-nuc 3.65	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv0	prot-nuc 3.85	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv1	prot-nuc 3.85	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv2	prot-nuc 3.65	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv3	prot-nuc 3.55	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv4	prot-nuc 3.65	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv5	prot-nuc 3.68	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv6	prot-nuc 3.30	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv7	prot-nuc 3.29	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4ji0	prot-nuc 3.49	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji1	prot-nuc 3.14	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji4	prot-nuc 3.69	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji5	prot-nuc 3.85	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji6	prot-nuc 3.55	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4kvb	prot-nuc 4.20	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	THERMUS THERMOPHILUS HB27 30S RIBOSOMAL SUBUNIT LACKING RIBO PROTEIN S17 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, TRANSLATION, 50S RIBOSOMAL SUBUNIT, R
4lf4	prot-nuc 3.34	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf5	prot-nuc 3.75	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf6	prot-nuc 3.31	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf7	prot-nuc 3.15	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf8	prot-nuc 3.15	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf9	prot-nuc 3.28	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfa	prot-nuc 3.65	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfb	prot-nuc 3.01	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfc	prot-nuc 3.60	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4nxm	prot-nuc 3.65	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM A GIDB ( MUTANT OF THERMUS THERMOPHILUS (HB8) RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17 RIBOSOME STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE, DECODING RIBOSOME
4nxn	prot-nuc 3.54	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM A GIDB ( MUTANT OF THERMUS THERMOPHILUS (HB8), BOUND WITH STREPTOMYC RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE, DECODING RIBOSOME-ANTIBIOTIC COMPLEX
4x62	prot-nuc 3.45	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), RNA (5'-D(*AP*AP*AP*UP*UP*U)-3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x64	prot-nuc 3.35	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, RNA (5'-D(*(MA6)P*AP*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x65	prot-nuc 3.35	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, RNA (5'-D(*AP*(MA6)P*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x66	prot-nuc 3.45	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(*AP*AP*(MA6)P*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
5br8	prot-nuc 3.40	(3S)-3-(METHYLSULFANYL)-L-ASPARTIC ACID C5 H9 N O4 S	AMBIENT-TEMPERATURE CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUN THERMUS THERMOPHILUS IN COMPLEX WITH PAROMOMYCIN 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME 30S RIBOSOMAL SUBUNIT, PAROMOMYCIN, AMBIENT TEMPERATURE, SFX ELECTROSPINNING, RIBOSOME

0XS    2-AMINO-6-BROMO-7-(TRIFLUOROMETHYL)-1,8-NAPHTHYRIDINE- 3-CARBOXAMIDE

Code	Class Resolution	Description
4glx	prot-nuc 1.90	2-AMINO-6-BROMO-7-(TRIFLUOROMETHYL)-1,8-NAPHTHYRIDINE- 3-CARBOXAMIDE C10 H6 BR F3 N4 O	DNA LIGASE A IN COMPLEX WITH INHIBITOR DNA (26-MER), DNA LIGASE, DNA (5'-D(*AP*CP*AP*AP*TP*TP*GP*CP*GP*AP*CP*CP*C) CHAIN: C, DNA (5'-D(P*CP*AP*CP*TP*AP*TP*CP*GP*GP*AP*AP*TP*G CHAIN: D LIGASE/LIGASE INHIBITOR/DNA DNA LIGASE A, INHIBITOR, LIGASE-LIGASE INHIBITOR-DNA COMPLEX

118    TETRAPHENYLANTIMONIUM ION

Code	Class Resolution	Description
1exi	prot-nuc 3.12	TETRAPHENYLANTIMONIUM ION 2(C24 H20 SB 1+)	CRYSTAL STRUCTURE OF TRANSCRIPTION ACTIVATOR BMRR, FROM B. S BOUND TO 21 BASE PAIR BMR OPERATOR AND TPSB MULTIDRUG-EFFLUX TRANSPORTER REGULATOR, DNA (5'- D(*AP*CP*CP*CP*TP*CP*CP*CP*CP*TP*TP*AP*GP*GP*GP*GP*AP*GP*GP 3') TRANSCRIPTION/DNA PROTEIN-DNA COMPLEX, MERR-FAMILY TRANSCRIPTION ACTIVATOR, MU BINDING PROTEIN, TRANSCRIPTION-DNA COMPLEX

12A    2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE

Code	Class Resolution	Description
3t1h	prot-nuc 3.11	2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE C16 H23 N6 O11 P S	STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT WITH A HUMAN ANTI-CODON STEM LOOP (HASL) OF TRANSFER RNA LY (TRNALYS3) BOUND TO AN MRNA WITH AN AAA-CODON IN THE A-SITE PAROMOMYCIN 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, TRNA ASL HUMAN LYS3, MRNA A-SITE FRAGMENT, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC PROTEIN SYNTHESIS, TRNA, RIBOSOME-ANTIBIOTIC COMPLEX
3t1y	prot-nuc 2.80	2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE C16 H23 N6 O11 P S	STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT WITH A HUMAN ANTI-CODON STEM LOOP (HASL) OF TRANSFER RNA LY (TRNALYS3) BOUND TO AN MRNA WITH AN AAG-CODON IN THE A-SITE PAROMOMYCIN 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, TRNA ASL HUMAN LYS3, MRNA A-SITE FRAGMENT, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME/ANTIBIOTIC PROTEIN SYNTHESIS, TRNA, RIBOSOME-ANTIBIOTIC COMPLEX
4x62	prot-nuc 3.45	2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE C16 H23 N6 O11 P S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), RNA (5'-D(*AP*AP*AP*UP*UP*U)-3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x64	prot-nuc 3.35	2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE C16 H23 N6 O11 P S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, RNA (5'-D(*(MA6)P*AP*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x65	prot-nuc 3.35	2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE C16 H23 N6 O11 P S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, RNA (5'-D(*AP*(MA6)P*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x66	prot-nuc 3.45	2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE C16 H23 N6 O11 P S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(*AP*AP*(MA6)P*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX

13T    13-DEOXYTEDANOLIDE

Code	Class Resolution	Description
2otj	prot-nuc 2.90	13-DEOXYTEDANOLIDE C32 H50 O10	13-DEOXYTEDANOLIDE BOUND TO THE LARGE SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L10E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L3P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L18P RIBOSOME 13 DEOXYTEDANOLIDE, ANTIBIOTIC COMPLEX, 50S, RIBOSOME

144    TRIS-HYDROXYMETHYL-METHYL-AMMONIUM

Code	Class Resolution	Description
4zm0	prot-nuc 3.17	TRIS-HYDROXYMETHYL-METHYL-AMMONIUM 2(C4 H12 N O3 1+)	ANTITOXIN PHD FROM PHAGE P1 IN COMPLEX WITH ITS OPERATOR DNA REPEAT ANTITOXIN PHD, DNA/RNA (5'-D(CP*AP*TP*GP*TP*GP*TP*AP*CP*AP*CP*AP CHAIN: F, H, DNA/RNA (5'-D(CP*TP*TP*GP*TP*GP*TP*AP*CP*AP*CP*AP CHAIN: E, G TRANSCRIPTION TRANSCRIPTION FACTOR, TOXIN-ANTITOXIN, DNA BINDING, INTRINSI DISORDER, CONDITIONAL COOPERATIVITY, PROTEIN-DNA COMPLEX, TRANSCRIPTION

145    1-O-[O-NITROPHENYL]-BETA-D-GALACTOPYRANOSE

Code	Class Resolution	Description
2pe5	prot-nuc 3.50	1-O-[O-NITROPHENYL]-BETA-D-GALACTOPYRANOSE 3(C12 H15 N O8)	CRYSTAL STRUCTURE OF THE LAC REPRESSOR BOUND TO ONPG IN REPRESSED STATE DNA (5'- D(*DAP*DAP*DTP*DTP*DGP*DTP*DGP*DAP*DGP*DCP*DGP*DCP*DTP*DCP* DAP*DCP*DAP*DAP*DTP*DT)-3'), LACTOSE OPERON REPRESSOR: SEQUENCE DATABASE RESIDUES 2-331 TRANSCRIPTION/DNA LAC REPRESSOR, ALLOSTERIC EFFECTORS, GENE REGULATION, DNA- BINDING, TRANSCRIPTION, TRANSCRIPTION REGULATION, TRANSCRIPTION/DNA COMPLEX

15P    POLYETHYLENE GLYCOL (N=34)

Code	Class Resolution	Description
3m8r	prot-nuc 2.00	POLYETHYLENE GLYCOL (N=34) 2(C69 H140 O35)	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQUATICUS IN A CLOSED TERNARY COMPLEX WITH TRAPPED ETHYLATED DTTP DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC) CHAIN: B, DNA (5'-D(*AP*AP*AP*AP*GP*GP*CP*GP*CP*CP*GP*TP*GP 3'), DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT TRANSFERASE/DNA DNA, DNA POLYMERASE, DNA REPLICATION, NUCLEOTIDES, MODIFIED NUCLEOTIDE, ARTIFICIAL NUCLEOTIDE, NUCLEOTIDE PROBES, DNA-B DNA-DIRECTED DNA POLYMERASE, NUCLEOTIDYLTRANSFERASE, TRANSF TRANSFERASE-DNA COMPLEX
3m8s	prot-nuc 2.20	POLYETHYLENE GLYCOL (N=34) C69 H140 O35	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQUATICUS IN A CLOSED TERNARY COMPLEX WITH TRAPPED METHYLATED DTTP DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC) CHAIN: B, DNA (5'-D(*AP*AP*AP*AP*GP*GP*CP*GP*CP*CP*GP*TP*GP 3') TRANSFERASE/DNA DNA, DNA POLYMERASE, DNA REPLICATION, NUCLEOTIDES, MODIFIED NUCLEOTIDE, ARTIFICIAL NUCLEOTIDE, NUCLEOTIDE PROBES, DNA-B DNA-DIRECTED DNA POLYMERASE, NUCLEOTIDYLTRANSFERASE, TRANSF TRANSFERASE-DNA COMPLEX

16D    HEXANE-1,6-DIAMINE

Code	Class Resolution	Description
2qk9	prot-nuc 2.55	HEXANE-1,6-DIAMINE C6 H16 N2	HUMAN RNASE H CATALYTIC DOMAIN MUTANT D210N IN COMPLEX WITH RNA/DNA HYBRID 5'-D(*GP*GP*AP*AP*TP*CP*AP*GP*GP*TP*GP*TP*CP*GP*C -3', 5'-R(*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*CP*UP*GP*AP*U -3', RIBONUCLEASE H1: C-TERMINAL DOMAIN (RESIDUES 134-286) HYDROLASE/DNA/RNA RNASE H; RNA/DNA HYBRID, HYDROLASE-DNA-RNA COMPLEX

18M    2'-O-METHYLGUANOSINE 3',5'-BIS(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
4hqu	prot-nuc 2.20	2'-O-METHYLGUANOSINE 3',5'-BIS(DIHYDROGEN PHOSPHATE) C11 H17 N5 O11 P2	CRYSTAL STRUCTURE OF HUMAN PDGF-BB IN COMPLEX WITH A MODIFIE NUCLEOTIDE APTAMER (SOMAMER SL5) SOMAMER SL5, PLATELET-DERIVED GROWTH FACTOR SUBUNIT B: PDGF-BB, UNP RESIDUES 82-109 HORMONE/DNA GROWTH FACTOR, SELEX, APTAMER, 5-MODIFIED DEOXYURIDINE, HORM COMPLEX
4hqx	prot-nuc 2.30	2'-O-METHYLGUANOSINE 3',5'-BIS(DIHYDROGEN PHOSPHATE) C11 H17 N5 O11 P2	CRYSTAL STRUCTURE OF HUMAN PDGF-BB IN COMPLEX WITH A MODIFIE NUCLEOTIDE APTAMER (SOMAMER SL4) PLATELET-DERIVED GROWTH FACTOR SUBUNIT B: PDGF-BB, UNP RESIDUES 82-109, SOMAMER SL4 HORMONE/DNA GROWTH FACTOR, SELEX, APTAMER, 5-MODIFIED DEOXYURIDINE, HORM COMPLEX

18Q    2'-DEOXY-5-[(THIOPHEN-2-YLMETHYL)CARBAMOYL]URIDINE 5'- (DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
4hqu	prot-nuc 2.20	2'-DEOXY-5-[(THIOPHEN-2-YLMETHYL)CARBAMOYL]URIDINE 5'- (DIHYDROGEN PHOSPHATE) C15 H18 N3 O9 P S	CRYSTAL STRUCTURE OF HUMAN PDGF-BB IN COMPLEX WITH A MODIFIE NUCLEOTIDE APTAMER (SOMAMER SL5) SOMAMER SL5, PLATELET-DERIVED GROWTH FACTOR SUBUNIT B: PDGF-BB, UNP RESIDUES 82-109 HORMONE/DNA GROWTH FACTOR, SELEX, APTAMER, 5-MODIFIED DEOXYURIDINE, HORM COMPLEX
4hqx	prot-nuc 2.30	2'-DEOXY-5-[(THIOPHEN-2-YLMETHYL)CARBAMOYL]URIDINE 5'- (DIHYDROGEN PHOSPHATE) C15 H18 N3 O9 P S	CRYSTAL STRUCTURE OF HUMAN PDGF-BB IN COMPLEX WITH A MODIFIE NUCLEOTIDE APTAMER (SOMAMER SL4) PLATELET-DERIVED GROWTH FACTOR SUBUNIT B: PDGF-BB, UNP RESIDUES 82-109, SOMAMER SL4 HORMONE/DNA GROWTH FACTOR, SELEX, APTAMER, 5-MODIFIED DEOXYURIDINE, HORM COMPLEX

19C    2-[(3-CHLORANYL-4-FLUORANYL-PHENYL)METHYL]-6, 7-BIS(OXIDANYL)ISOINDOL-1-ONE

Code	Class Resolution	Description
4bdz	prot-nuc 2.85	2-[(3-CHLORANYL-4-FLUORANYL-PHENYL)METHYL]-6, 7-BIS(OXIDANYL)ISOINDOL-1-ONE C15 H11 CL F N O3	PFV INTASOME WITH INHIBITOR XZ-90 17 NUCLEOTIDE PREPROCESSED PFV DONOR DNA (TRANSFE STRAND), 19 NUCLEOTIDE PREPROCESSED PFV DONOR DNA (NON-TRA STRAND), PFV INTEGRASE TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX, DNA INTEGRATION, ENDONUCLEASE, METAL-BINDING, MULTIFUNCTIONAL ENZYME, NUCLEASE, NUCLEOTIDYLTRANSFERASE, NUCLEUS, TRANSFERASE, VIRAL NUCLEOP VIRION, DNA-BINDING, ZINC BINDING, HHCC MOTIF, VIRAL PROTEI RECOMBINATION, INHIBITOR, RECOMBINATION-INHIBITOR-DNA COMPL

1AP    2,6-DIAMINOPURINE NUCLEOTIDE

Code	Class Resolution	Description
1zay	prot-nuc 2.70	2,6-DIAMINOPURINE NUCLEOTIDE C10 H15 N6 O6 P	PURINE REPRESSOR-HYPOXANTHINE-MODIFIED-PURF-OPERATOR COMPLEX PROTEIN (PURINE REPRESSOR), DNA (5'-D(*AP*AP*CP*GP*AP*AP*AP*AP*TP*(1AP) P*TP*TP*TP*TP*CP*GP*T)-3') TRANSCRIPTION/DNA COMPLEX (DNA-BINDING REGULATION/MODIFIED DNA), TRANSCRIPTION/DNA COMPLEX
3c29	prot-nuc 2.20	2,6-DIAMINOPURINE NUCLEOTIDE 2(C10 H15 N6 O6 P)	CRE-LOXP SYNAPTIC STRUCTURE LOXP DNA, CHAIN D,F, LOXP DNA, CHAIN C,, RECOMBINASE CRE, LOXP DNA, CHAIN E RECOMBINATION/DNA 2,6 DI-AMINOPURINE; SYNAPSIS, DNA INTEGRATION, DNA RECOMBINATION, RECOMBINATION/DNA COMPLEX
4hdv	prot-nuc 2.70	2,6-DIAMINOPURINE NUCLEOTIDE C10 H15 N6 O6 P	CRYSTAL STRUCTURE OF S. POMBE ATL1 IN COMPLEX WITH DAMAGED D CONTAINING 2,6-DIAMINOPURINE ALKYLTRANSFERASE-LIKE PROTEIN 1, 5'-D(*CP*TP*AP*CP*TP*AP*GP*CP*CP*AP*TP*GP*G)-3', 5'-D(*GP*CP*CP*AP*TP*GP*(1AP)P*CP*TP*AP*GP*TP*A)- CHAIN: B DNA BINDING PROTEIN/DNA ALKYLTRANSFERASE, DNA REPAIR, NUCLEOTIDE EXCISION REPAIR, NE REPAIR, DNA DAMAGE, GUANINE, ALKYLATION, DNA BINDING PROTEI COMPLEX

1CC    5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE

Code	Class Resolution	Description
3uo7	prot-nuc 3.00	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE C10 H14 N3 O9 P	CRYSTAL STRUCTURE OF HUMAN THYMINE DNA GLYCOSYLASE BOUND TO 5-CARBOXYLCYTOSINE 5'-D(*CP*AP*GP*CP*TP*CP*TP*GP*TP*AP*CP*AP*TP*GP*A *GP*TP*GP*GP*A)-3', G/T MISMATCH-SPECIFIC THYMINE DNA GLYCOSYLASE: UNP RESIDUES 111-308, 5'-D(*CP*CP*AP*CP*TP*GP*CP*TP*CP*AP*(1CC) P*GP*TP*AP*CP*AP*GP*AP*GP*CP*TP*GP*T)-3' HYDROLASE/DNA DSDNA WITH 5CAC, HYDROLASE-DNA COMPLEX
4m9v	prot-nuc 0.97	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE 2(C10 H14 N3 O9 P)	ZFP57 MUTANT (E182Q) IN COMPLEX WITH 5-CARBOXYLCYTOSINE DNA DNA (5'-D(*AP*CP*TP*GP*(1CC)P*GP*GP*CP*AP*AP*T)-3 CHAIN: B, E, ZINC FINGER PROTEIN 57, DNA (5'-D(*TP*AP*TP*TP*GP*CP*(5CM)P*GP*CP*AP*G)-3 CHAIN: A, D TRANSCRIPTION/DNA EPIGENETICS, TRANSCRIPTION FACTOR, 5-CARBOXYLCYTOSINE, C2H2 FINGER, DNA BINDING, TRANSCRIPTION-DNA COMPLEX
4r2r	prot-nuc 2.09	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE C10 H14 N3 O9 P	WILMS TUMOR PROTEIN (WT1) ZINC FINGERS IN COMPLEX WITH CARBO DNA DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(1CC)P*GP*T)-3 CHAIN: B, WILMS TUMOR PROTEIN, ISOFORM 4/CRA_A: ZINC FINGER 2-4 DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
4y52	prot-nuc 3.50	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE C10 H14 N3 O9 P	CRYSTAL STRUCTURE OF 5-CARBOXYCYTOSINE RECOGNITION BY RNA PO II DURING TRANSCRIPTION ELONGATION. DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: F, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: LDNA (29-MER), DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB3, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB11, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB2, DNA (5'-D(*CP*TP*GP*CP*TP*TP*AP*TP*CP*GP*GP*TP*AP CHAIN: N, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: J, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: E, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB1, RNA (5'-D(*AP*UP*GP*GP*AP*GP*AP*GP*G)-3'), DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: HDNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB9 TRANSCRIPTION/DNA/RNA RNA POLYMERASE II, 5-CARBOXYCYTOSINE, TRANSCRIPTION ELONGATI DEMETHYLATION, TRANSCRIPTION-DNA-RNA COMPLEX
4y7n	prot-nuc 3.30	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE C10 H14 N3 O9 P	THE STRUCTURE INSIGHT INTO 5-CARBOXYCYTOSINE RECOGNITION BY POLYMERASE II DURING TRANSCRIPTION ELONGATION. RNA (5'-D(*AP*UP*GP*GP*AP*GP*AP*GP*G)-3'), DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB1, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: E, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: J, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: HDNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB9, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: LDNA (29-MER), DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: F, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB2,DNA-D RNA POLYMERASE II SUBUNIT RPB2, DNA (5'-D(*CP*TP*GP*CP*TP*TP*AP*TP*CP*GP*GP*TP*AP CHAIN: N, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB11, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB3 TRANSCRIPTION/DNA/RNA RNA POLYMERASE II, 5-CARBOXYCYTOSINE, TRANSCRIPTION ELONGATI DEMETHYLATION, TRANSCRIPTION-DNA-RNA COMPLEX
5exh	prot-nuc 1.30	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE 2(C10 H14 N3 O9 P)	CRYSTAL STRUCTURE OF MTET3-CXXC DOMAIN IN COMPLEX WITH 5- CARBOXYLCYTOSINE DNA AT 1.3 ANGSTROMS RESOLUTION. METHYLCYTOSINE DIOXYGENASE TET3: CXXC DOMAIN (UNP RESIDUES 51-96), DNA (5'-D(*GP*AP*AP*TP*CP*(1CC)P*GP*GP*AP*TP*TP*C CHAIN: A, B OXIDOREDUCTASE/DNA MOUSE TET3, COMPLEX, 5-CARBOXYLCYTOSINE, READER, OXIDOREDUCT COMPLEX
5eyo	prot-nuc 2.39	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE 2(C10 H14 N3 O9 P)	THE CRYSTAL STRUCTURE OF THE MAX BHLH DOMAIN IN COMPLEX WITH CARBOXYL CYTOSINE DNA DNA (5'-D(*AP*GP*TP*AP*GP*CP*AP*(1CC) P*GP*TP*GP*CP*TP*AP*CP*T)-3'), PROTEIN MAX: UNP RESIDUES 22-107 TRANSCRIPTION/DNA BHLH PROTEIN, 5-CARBOXYLCYTOSINE DNA, TRANSCRIPTION-DNA COMP
5kl5	prot-nuc 2.29	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE C10 H14 N3 O9 P	WILMS TUMOR PROTEIN (WT1) ZNF2-4 Q369H IN COMPLEX WITH CARBO DNA DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(1CC)P*GP*T)-3 CHAIN: B, DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, WILMS TUMOR PROTEIN: UNP RESIDUES 333-420 TRANSCRIPTION/DNA WILMS TUMOR PROTEIN, WT1, ZINC FINGER, 5-CARBOXYL CYTOSINE, TRANSCRIPTION-DNA COMPLEX
5kl7	prot-nuc 1.58	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE C10 H14 N3 O9 P	WILMS TUMOR PROTEIN (WT1) ZNF2-4Q369R IN COMPLEX WITH CARBOX WILMS TUMOR PROTEIN: UNP RESIDUES 333-420, DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(1CC)P*GP*T)-3 CHAIN: B TRANSCRIPTION/DNA WILMS TUMOR PROTEIN, WT1, ZINC FINGER, 5-CARBOXYL CYTOSINE, TRANSCRIPTION-DNA COMPLEX

1F2    (3AS,4R,7R,8S,9S,10R,11R,13R,15R,15AR)-4-ETHYL-11- METHOXY-3A,7,9,11,13,15-HEXAMETHYL-2,6,14-TRIOXO-10- {[3,4,6-TRIDEOXY-3-(DIMETHYLAMINO)-BETA-D-XYLO- HEXOPYRANOSYL]OXY}TETRADECAHYDRO-2H- OXACYCLOTETRADECINO[4,3-D][1,3]OXAZOL-8-YL (2R)-2- (PYRIDIN-3-YL)P

Code	Class Resolution	Description
4io9	prot-nuc 3.20	(3AS,4R,7R,8S,9S,10R,11R,13R,15R,15AR)-4-ETHYL-11- METHOXY-3A,7,9,11,13,15-HEXAMETHYL-2,6,14-TRIOXO-10- {[3,4,6-TRIDEOXY-3-(DIMETHYLAMINO)-BETA-D-XYLO- HEXOPYRANOSYL]OXY}TETRADECAHYDRO-2H- OXACYCLOTETRADECINO[4,3-D][1,3]OXAZOL-8-YL (2R)-2- (PYRIDIN-3-YL)P C41 H64 N4 O11	CRYSTAL STRUCTURE OF COMPOUND 4D BOUND TO LARGE RIBOSOMAL SU (50S) FROM DEINOCOCCUS RADIODURANS 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L36, 50S RIBOSOMAL PROTEIN L17, 50S RIBOSOMAL PROTEIN L3, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L19, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L27, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L33, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L18, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L2 RIBOSOME/RIBOSOME INHIBITOR RIBOSOME-RIBOSOME INHIBITOR COMPLEX

1F3    (3AS,4R,7R,8S,9S,10R,11R,13R,15R,15AR)-4-ETHYL-11- METHOXY-3A,7,9,11,13,15-HEXAMETHYL-2,6,14-TRIOXO-10- {[3,4,6-TRIDEOXY-3-(DIMETHYLAMINO)-BETA-D-XYLO- HEXOPYRANOSYL]OXY}TETRADECAHYDRO-2H- OXACYCLOTETRADECINO[4,3-D][1,3]OXAZOL-8-YL (2R)-2-[4- (ACETYLAMINO

Code	Class Resolution	Description
4ioa	prot-nuc 3.20	(3AS,4R,7R,8S,9S,10R,11R,13R,15R,15AR)-4-ETHYL-11- METHOXY-3A,7,9,11,13,15-HEXAMETHYL-2,6,14-TRIOXO-10- {[3,4,6-TRIDEOXY-3-(DIMETHYLAMINO)-BETA-D-XYLO- HEXOPYRANOSYL]OXY}TETRADECAHYDRO-2H- OXACYCLOTETRADECINO[4,3-D][1,3]OXAZOL-8-YL (2R)-2-[4- (ACETYLAMINO C44 H66 N4 O12	CRYSTAL STRUCTURE OF COMPOUND 4E BOUND TO LARGE RIBOSOMAL SU (50S) FROM DEINOCOCCUS RADIODURANS 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L18, 50S RIBOSOMAL PROTEIN L16, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L33, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L27, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L19, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L5, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L36, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L17 RIBOSOME/RIBOSOME INHIBITOR RIBOSOME-RIBOSOME INHIBITOR COMPLEX

1F4    (3AS,4R,7R,8S,9S,10R,11R,13R,15S,15AR)-4-ETHYL-11- METHOXY-3A,7,9,11,13,15-HEXAMETHYL-2,6,14-TRIOXO-10- {[3,4,6-TRIDEOXY-3-(DIMETHYLAMINO)-BETA-D-XYLO- HEXOPYRANOSYL]OXY}TETRADECAHYDRO-2H- OXACYCLOTETRADECINO[4,3-D][1,3]OXAZOL-8-YL (2R)-4,4- DIMETHYL-2-(P

Code	Class Resolution	Description
4ioc	prot-nuc 3.60	(3AS,4R,7R,8S,9S,10R,11R,13R,15S,15AR)-4-ETHYL-11- METHOXY-3A,7,9,11,13,15-HEXAMETHYL-2,6,14-TRIOXO-10- {[3,4,6-TRIDEOXY-3-(DIMETHYLAMINO)-BETA-D-XYLO- HEXOPYRANOSYL]OXY}TETRADECAHYDRO-2H- OXACYCLOTETRADECINO[4,3-D][1,3]OXAZOL-8-YL (2R)-4,4- DIMETHYL-2-(P C43 H68 N4 O11	CRYSTAL STRUCTURE OF COMPOUND 4F BOUND TO LARGE RIBOSOMAL SU (50S) FROM DEINOCOCCUS RADIODURANS 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L18, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L33, 50S RIBOSOMAL PROTEIN L27, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L19, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L3, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L17, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L36 RIBOSOME/RIBOSOME INHIBITOR RIBOSOME-RIBOSOME INHIBITOR COMPLEX

1FC    4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-2-OXO-1,2-DIHYDROPYRIMIDINE-5- CARBOXYLIC ACID

Code	Class Resolution	Description
3uob	prot-nuc 3.01	4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-2-OXO-1,2-DIHYDROPYRIMIDINE-5- CARBOXYLIC ACID C10 H13 F N3 O9 P	CRYSTAL STRUCTURE OF HUMAN THYMINE DNA GLYCOSYLASE BOUND TO ANALOG 2'-DEOXY-2'-BETA-FLUORO-CYTIDINE 5'-D(*CP*CP*AP*CP*TP*GP*CP*TP*CP*AP*(1FC) P*GP*TP*AP*CP*AP*GP*AP*GP*CP*TP*GP*T)-3', G/T MISMATCH-SPECIFIC THYMINE DNA GLYCOSYLASE: UNP RESIDUES 111-308, 5'-D(*CP*AP*GP*CP*TP*CP*TP*GP*TP*AP*CP*GP*TP*GP*A *GP*TP*GP*GP*A)-3' HYDROLASE/DNA DSDNA, HYDROLASE-DNA COMPLEX

1FO    6-[4-(3-FLUOROBENZOYL)-1H-PYRROL-2-YL]-2-HYDROXY-4- OXOHEXA-2,5-DIENOIC ACID

Code	Class Resolution	Description
4iqv	prot-nuc 2.90	6-[4-(3-FLUOROBENZOYL)-1H-PYRROL-2-YL]-2-HYDROXY-4- OXOHEXA-2,5-DIENOIC ACID C17 H12 F N O5	TDT CORE IN COMPLEX WITH INHIBITOR 6-[4-(3-FLUOROBENZOYL)-1H YL]-2-HYDROXY-4-OXOHEXA-2,5-DIENOIC ACID AND SSDNA DNA NUCLEOTIDYLEXOTRANSFERASE: SEE REMARK 999, 5'-D(*GP*CP*CP*G)-3' TRANSFERASE/TRANSFERASE INHIBITOR/DNA TERMINAL TRANSFERASE, TRANSFERASE-TRANSFERASE INHIBITOR-DNA

1FQ    (2Z,5E)-6-[4-(4-FLUOROBENZOYL)-1H-PYRROL-2-YL]-2- HYDROXY-4-OXOHEXA-2,5-DIENOIC ACID

Code	Class Resolution	Description
4iqw	prot-nuc 2.60	(2Z,5E)-6-[4-(4-FLUOROBENZOYL)-1H-PYRROL-2-YL]-2- HYDROXY-4-OXOHEXA-2,5-DIENOIC ACID C17 H12 F N O5	TDT CORE IN COMPLEX WITH INHIBITOR (2Z,5E)-6-[4-(4-FLUOROBEN PYRROL-2-YL]-2-HYDROXY-4-OXOHEXA-2,5-DIENOIC ACID AND SSDNA 5'-D(*GP*CP*CP*G)-3', DNA NUCLEOTIDYLEXOTRANSFERASE: SEE REMARK 999 TRANSFERASE/TRANSFERASE INHIBITOR/DNA TERMINAL TRANSFERASE, TRANSFERASE-TRANSFERASE INHIBITOR-DNA

1FZ    5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE

Code	Class Resolution	Description
4ir1	prot-nuc 2.38	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE 2(C10 H18 N3 O13 P3)	POLYMERASE-DNA COMPLEX DNA (5'- D(*TP*CP*TP*AP*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3' CHAIN: G, B, DNA (5'-D(*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP CHAIN: H, DNA POLYMERASE IV, DNA (5'- D(*CP*TP*AP*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3') TRANSFERASE/DNA DNA POLYMERASE, Y-FAMILY, TRANSFERASE-DNA COMPLEX
4mff	prot-nuc 2.55	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH O6MG I TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTP UP PRIMER, TEMPLATE, DN PRIMER, DNA POLYMERASE BETA TRANSFERASE/DNA DNA POLYMERASE X FAMILY, DNA SYNTHESIS, TRANSFERASE-DNA COMP
4nxz	prot-nuc 2.56	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	DNA POLYMERASE BETA WITH O6MG IN THE TEMPLATE BASE OPPOSITE INCOMING NON-HYDROLYZABLE TTP WITH MANGANESE IN THE ACTIVE 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*(6OG)P*TP*CP*GP*CP*AP*TP*CP* 3', DNA POLYMERASE BETA: UNP RESIDUES 10-335 TRANSFERASE, LYASE/DNA DNA BINDING, DNA POLYMERASE FOLD, NUCLEOTIDYL TRANSFER, NUCL TRANSFERASE, LYASE-DNA COMPLEX
4o5e	prot-nuc 2.53	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE COMPLEXED WITH N7MG IN THE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTP DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'): UP PRIMER DNA, DNA (5'-D(*CP*CP*GP*AP*CP*(FMG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'): TEMPLATE DNA, DNA POLYMERASE BETA: DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3'): DOWN PRIMER DNA TRANSFERASE, LYASE/DNA DNA BINDING, POLYMERASE FOLD, NUCLEOTIDYL TRANSFER, DNA, NUC TRANSFERASE, LYASE-DNA COMPLEX
4p2h	prot-nuc 1.99	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE COMPLEXED WITH N7MG IN THE OPPOSITE TO INCOMING NON-HYDROLYZABLE TTP WITH MANGANESE IN ACTIVE SITE DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*(FMG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'), DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA POLYMERASE BETA: UNP RESIDUES 10-335 TRANSFERASE/DNA NUCLEOTIDYL TRANSFER, DNA BINDING, DNA POLYMERASE FOLD, TRAN DNA COMPLEX
4pgq	prot-nuc 2.30	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH G IN T TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTP DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA POLYMERASE BETA, DNA (5'-D(*CP*CP*GP*AP*CP*GP*TP*CP*GP*CP*AP*TP*CP 3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3') TRANSFERASE,LYASE/DNA DNA POLYMERASE, NUCLEOTIDYL SYNTHESIS, TRANSFERASE, LYASE-DN
4pgx	prot-nuc 2.08	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH G IN T TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTP AND DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*GP*TP*CP*GP*CP*AP*TP*CP 3'), DNA POLYMERASE BETA TRANSFERASE,LYASE/DNA HUMAN DNA POLYMERASE, NUCLEOTIDYL SYNTHTSIS, TRANSFERASE, LY COMPLEX
4q44	prot-nuc 2.71	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE 2(C10 H18 N3 O13 P3)	POLYMERASE-DAMAGED DNA COMPLEX DNA (5'-D(*TP*CP*TP*AP*(RDG) P*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3'), DNA POLYMERASE IV: UNP RESIDUES 2-341 TRANSFERASE/DNA POLYMERASE, DNA POLYMERASE, DNA, TRANSFERASE-DNA COMPLEX
4q45	prot-nuc 2.18	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE 2(C10 H18 N3 O13 P3)	DNA POLYMERASE- DAMAGED DNA COMPLEX DNA POLYMERASE IV: UNP RESIDUES 2-341, DNA (5'-D(*TP*CP*TP*AP*GP*GP*(RDG) P*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3'), DNA (5'- D(*TP*CP*TP*A*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3') CHAIN: H, C TRANSFERASE/DNA POLYMERASE, DNA POLYMERASE, DNA, TRANSFERASE-DNA COMPLEX
4r8u	prot-nuc 2.30	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE 2(C10 H18 N3 O13 P3)	S-SAD STRUCTURE OF DINB-DNA COMPLEX DNA POLYMERASE IV: UNP RESIDUES 2-340, DNA, DNA, DNA POLYMERASE IV: UNP RESIDUES 2-338, DNA TRANSFERASE/DNA NUCLEOTIDYL TRANSFERASE, DNA POLYMERASE, TRANSFERASE-DNA COM
4yn4	prot-nuc 2.24	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH N7BG I TEMPLATE OPPOSITE TO INCOMING NON-HYDROLYZABLE DTTP WITH MA THE ACTIVE SITE DNA 16-MER (TEMPLATE), DNA 10-MER (UP-PRIMER), DNA 5-MER (DN-PRIMER), DNA POLYMERASE BETA TRANSFERASE/DNA HUMAN DNA POLYMERASE BETA, TRANSFERASE-DNA COMPLEX
4z6d	prot-nuc 2.51	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA 279NA MUTANT COMPLEXE IN THE TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*GP*TP*CP*GP*CP*AP*TP*CP 3'), DNA POLYMERASE BETA: UNP RESIDUES 7-335, DNA (5'-D(P*GP*TP*CP*GP*G)-3') TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4z6e	prot-nuc 2.75	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA 279NA MUTANT COMPLEXE IN THE TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE MANGANESE DNA POLYMERASE BETA: UNP RESIDUES 10-335, DNA (5'-D(*CP*CP*GP*AP*CP*GP*TP*CP*GP*CP*AP*TP*CP 3'), DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3') TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4z6f	prot-nuc 2.44	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	STRUCTURE OF HUMAN DNA POLYMERASE BETA 279NA MUTANT COMPLEXE IN THE TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE MANGANESE DNA POLYMERASE BETA: UNP RESIDUES 10-335, DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*(6OG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
5dga	prot-nuc 2.30	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA EXTENDING AN 1 ETHENODEOXYADENOSINE : DT PAIR BY INSERTING DTMPNPP OPPOSIT DA DNA POLYMERASE ETA: UNP RESIDUES 1-432, DNA (5'-D(*CP*AP*TP*AP*(EDA)P*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3') TRANSFERASE/DNA DNA POLYMERASE, DNA ENZYME, DNA DAMAGE, TRANSLESION DNA SYNT ETHENO DNA ADDUCTS, TRANSFERASE-DNA COMPLEX
5dgb	prot-nuc 1.79	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA EXTENDING AN 1 ETHENODEOXYADENOSINE : DA PAIR BY INSERTING DTMPNPP OPPOSIT DA DNA POLYMERASE ETA: UNP RESIDUES 1-432, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*A)-3'), DNA (5'-D(*CP*AP*TP*AP*(EDA)P*TP*GP*AP*CP*GP*CP*T CHAIN: T TRANSFERASE/DNA DNA POLYMERASE, DNA ENZYME, DNA DAMAGE, TRANSLESION DNA SYNT ETHENO DNA ADDUCTS, TRANSFERASE-DNA COMPLEX
5l1j	prot-nuc 1.94	5'-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]AMINO}PHOSPHORYL]THYMIDINE C10 H18 N3 O13 P3	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DTMP OPPOSITE O6-METHYL-2'-DEOXYGUANOSINE DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA (5'-D(*CP*AP*TP*(6OG)P*AP*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA POLYMERASE ETA TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA POLYMERASE, LESION BYPASS, METHYL-2'-DEOXYGUANOSINE, Y-FAMILY POLYMERASE, TRANSLESION SYNTHESIS (TLS), DNA BINDING PROTEIN., TRANSFERASE-DNA COMP

1GC    2'-DEOXY-5'-O-[(R)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}PHOSPHORYL]GUANOSINE

Code	Class Resolution	Description
3pml	prot-nuc 2.60	2'-DEOXY-5'-O-[(R)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}PHOSPHORYL]GUANOSINE 2(C11 H18 N5 O12 P3)	CRYSTAL STRUCTURE OF A POLYMERASE LAMBDA VARIANT WITH A DGTP OPPOSITE A TEMPLATING T 5'-D(*CP*GP*GP*CP*TP*GP*TP*AP*CP*TP*G)-3', 5'-D(P*GP*CP*CP*G)-3', 5'-D(*CP*AP*GP*TP*AP*C)-3', DNA POLYMERASE LAMBDA: UNP RESIDUES 242-575 LYASE,TRANSFERASE/DNA PROTEIN-DNA COMPLEX, LYASE, TRANSFERASE, DNA, LYASE,TRANSFER COMPLEX
3pmn	prot-nuc 2.20	2'-DEOXY-5'-O-[(R)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}PHOSPHORYL]GUANOSINE C11 H18 N5 O12 P3	TERNARY CRYSTAL STRUCTURE OF POLYMERASE LAMBDA VARIANT WITH MISPAIR AT THE PRIMER TERMINUS WITH MN2+ IN THE ACTIVE SITE 5'-D(*CP*AP*GP*TP*AP*G)-3', 5'-D(*CP*GP*GP*CP*CP*TP*TP*AP*CP*TP*G)-3', DNA POLYMERASE LAMBDA: UNP RESIDUES 242-575, 5'-D(*GP*CP*CP*G)-3' LYASE,TRANSFERASE/DNA PROTEIN-DNA COMPLEX, LYASE, TRANSFERASE, DNA, LYASE,TRANSFER COMPLEX
3pnc	prot-nuc 2.00	2'-DEOXY-5'-O-[(R)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}PHOSPHORYL]GUANOSINE C11 H18 N5 O12 P3	TERNARY CRYSTAL STRUCTURE OF A POLYMERASE LAMBDA VARIANT WIT MISPAIR AT THE PRIMER TERMINUS AND SODIUM AT CATALYTIC META DNA POLYMERASE LAMBDA: UNP RESIDUES 242-575, 5'-D(*GP*CP*CP*G)-3', 5'-D(*CP*GP*GP*CP*CP*TP*TP*AP*CP*TP*G)-3', 5'-D(*CP*AP*GP*TP*AP*G)-3' LYASE,TRANSFERASE/DNA PROTEIN-DNA COMPLEX, LYASE, TRANSFERASE, DNA, LYASE,TRANSFER COMPLEX
5bol	prot-nuc 1.98	2'-DEOXY-5'-O-[(R)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}PHOSPHORYL]GUANOSINE C11 H18 N5 O12 P3	DNA POLYMERASE BETA TERNARY COMPLEX WITH A TEMPLATING 5CLC A INCOMING DGTP ANALOG DNA (5'-D(*CP*CP*GP*AP*CP*(CDO) P*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3')DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3'), DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3') TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX

1MA    6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1f7u	prot-nuc 2.20	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF THE ARGINYL-TRNA SYNTHETASE COMPLEXED W TRNA(ARG) AND L-ARG ARGINYL-TRNA SYNTHETASE, TRNA(ARG) LIGASE/RNA RNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETASE LIGASE-RNA COMPLEX
1f7v	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF YEAST ARGINYL-TRNA SYNTHETASE COMPLEXED TRNAARG TRNA(ARG), ARGINYL-TRNA SYNTHETASE LIGASE/RNA TRNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETAS LIGASE-RNA COMPLEX
1h3e	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	TYROSYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS COMPLEXED WITH WILD-TYPE TRNATYR(GUA) AND WITH ATP AND TYROSINOL WILD-TYPE TRNATYR(GUA), TYROSYL-TRNA SYNTHETASE LIGASE LIGASE, CLASS I AMINOACYL-TRNA SYNTHETASE: ATP + L-TYROSINE TRNA(TYR) -> AMP + PPI + L-TYROSYL-TRNA(TYR)
1ip8	prot-nuc model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS IN THE PRE- TRANSLOCATIONAL STATE RIBOSOMAL PROTEIN L11, ELONGATION FACTOR G, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA RIBOSOME POSSIBLE INTERACTION BETWEEN SMALL AND LARGE RIBOSOMAL RNAS, MRNA AND TRNAS
1ipm	prot-nuc model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 3(C11 H18 N5 O7 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR G, ELONGATION FACTOR TU, TRNAS BOUND TO A, P, AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-G, EF-TU
1ipo	prot-nuc model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 23S RIBOSOMAL RNA, TRNA BOUND TO R SITE, 16S RIBOSOMAL RNA, ELONGATION FACTOR G, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', ELONGATION FACTOR TU, TRNA BOUND TO P SITE TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA
1ipq	prot-nuc model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, ELONGATION FACTOR TU, TRNAS BOUND TO P AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3' TRANSLATION/RNA TRANSITION SUB-STATE, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-TU
1ipr	prot-nuc model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRNA BOUND TO P SITE, ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*GP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', ELONGATION FACTOR G, 16S RIBOSOMAL RNA, TRNA BOUND TO R SITE, 23S RIBOSOMAL RNA TRANSLATION/RNA NONCOGNATE CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-TU
1ipu	prot-nuc model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 3(C11 H18 N5 O7 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', TRNAS BOUND TO E, P, AND R SITES, NASCENT POLYPEPTIDE, 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA TRANSLATION/RNA PROOFREADING, GTP HYDROLYSIS, EF-TU, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA
1ir4	prot-nuc model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	DOCKING MODEL OF T. THERMOPHILUS ARGRS AND YEAST TRNA(ARG) ARGINYL T-RNA, ARGINYL-TRNA SYNTHETASE LIGASE/RNA ROSSMANN FOLD, A-HELIX BUNDLE
1jgo	prot-nuc 5.60	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, MESSENGER RNA MK27, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S11, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgp	prot-nuc 7.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S8, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MV36, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S2 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgq	prot-nuc 5.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MF36, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S4, TRNA(PHE), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1l1u	prot-nuc model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	TERNARY COMPLEX DOCKED IN THE DECODING SITE OF THE 30S RIBOSOMAL SUBUNIT 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S9, 5'-STACKED TRNA, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, ELONGATION FACTOR TU, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S13, MESSENGER RNA IN THE D-SITE/ASITE, P-SITE AND E- SITE ON THE 30S RIBOSOME, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S7, 50S RIBOSOMAL PROTEIN L7/L12, 30S RIBOSOMAL PROTEIN S3, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S6 RIBOSOME TRNA, 5'-STACK, ANTICODON, DECODING, ELONGATION, PROTEIN SYNTHESIS, TRANSORIENTATION
1mj1	prot-nuc 13.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	FITTING THE TERNARY COMPLEX OF EF-TU/TRNA/GTP AND RIBOSOMAL INTO A 13 A CRYO-EM MAP OF THE COLI 70S RIBOSOME S12 RIBOSOMAL PROTEIN, HELIX 69 OF 23S RRNA, SARCIN-RICIN LOOP OF 23SRRNA, PHE-TRNA, ELONGATION FACTOR TU, S13 RIBOSOMAL PROTEIN, L11 RIBOSOMAL PROTEIN RIBOSOME 70S RIBOSOME, LOW RESOLUTION MODEL TERNARY COMPLEX, EF-TU, R
1ml5	prot-nuc 14.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF THE E. COLI RIBOSOMAL TERMINATION COMPLEX WITH FACTOR 2 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN THX, 50S 5S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S19, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L16, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S4, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L13, T-RNA(PHE), 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S14, A- AND P-SITE MESSENGER RNA CODONS, 50S RIBOSOMAL PROTEIN L18, 30S RIBOSOMAL PROTEIN S16, 50S RIBOSOMAL PROTEIN L19, 30S RIBOSOMAL PROTEIN S15, 50S RIBOSOMAL PROTEIN L1, 50S RIBOSOMAL PROTEIN L14, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L24, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 50S RIBOSOMAL PROTEIN L5, 50S 23S RIBOSOMAL RNA, 30S 16S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L4, 30S RIBOSOMAL PROTEIN S8, 50S RIBOSOMAL PROTEIN L15, 30S RIBOSOMAL PROTEIN S10, 50S RIBOSOMAL PROTEIN L30, 30S RIBOSOMAL PROTEIN S2, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L29, PEPTIDE CHAIN RELEASE FACTOR 2, 30S RIBOSOMAL PROTEIN S13 RIBOSOME E. COLI, RIBOSOME, TERMINATION OF PROTEIN SYNTHESIS, RELEASE CRYO-ELETRON MICROSCOPY, ANGULAR RECONSTITUTION
1ob2	prot-nuc 3.35	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	E. COLI ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC KIRROMYCIN, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE/NUCLEAR PROTEIN HYDROLASE/NUCLEAR PROTEIN, HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA
1ob5	prot-nuc 3.10	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O7 P)	T. AQUATICUS ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC ENACYLOXIN IIA, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA, GTP-BINDING, NUCLEOTIDE-BINDING, PROTEIN BIOSYNTHESIS
1s72	prot-nuc 2.40	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARG RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L7AE, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AE RIBOSOME RIBOSOME ASSEMBLY, RNA-RNA, PROTEIN-RNA, PROTEIN-PROTEIN, RI
1sz1	prot-nuc 6.21	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	MECHANISM OF CCA-ADDING ENZYMES SPECIFICITY REVEALED BY CRYS STRUCTURES OF TERNARY COMPLEXES TRNA NUCLEOTIDYLTRANSFERASE, T-RNA (76-MER) TRANSFERASE/RNA CCA-ADDING ENZYME, SPECIFICITY, TRNA, COMPLEX, TRANSFERASE-R COMPLEX
1ttt	prot-nuc 2.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O7 P)	PHE-TRNA, ELONGATION FACTOR EF-TU:GDPNP TERNARY COMPLEX OF ELONGATION FACTOR TU (EF-TU), TRANSFER RIBONUCLEIC ACID (YEAST, PHE) COMPLEX (ELONGATION FACTOR/TRNA) PROTEIN SYNTHESIS, EF-TU, TRNA, RIBOSOME, 1EFT, 4TNA, PEPTID ELONGATION RIBONUCLEOPROTEIN, COMPLEX (ELONGATION FACTOR-TR COMPLEX (ELONGATION FACTOR-TRNA) COMPLEX
1vq4	prot-nuc 2.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DAA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L2P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L21E, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3'), 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L3P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq5	prot-nuc 2.60	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "RAA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3' CHAIN: 4, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq6	prot-nuc 2.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF C-HPMN AND CCA-PHE-CAP-BIO BOUND TO THE LAR RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L15E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L14P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L19E, 5'-R(*CP*(5AA)*(HFA))-3', 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L39E, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3', 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L44E RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq7	prot-nuc 2.50	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DCA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3'), 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L14P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L5P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq8	prot-nuc 2.20	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF CCDA-PHE-CAP-BIO AND THE ANTIBIOTIC SPARSOM TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3', 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L6P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L19E RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq9	prot-nuc 2.40	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF CCA-PHE-CAP-BIO AND THE ANTIBIOTIC SPARSOMY TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L18P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L21E, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L2P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L19E RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vqk	prot-nuc 2.30	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF CCDA-PHE-CAP-BIO BOUND TO THE A SITE OF THE SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L21E, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3', 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L3P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L2P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L14P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vql	prot-nuc 2.30	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DCSN" BOUND LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L18P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L21E, 5'-R(*CP*CP*(PPU)*(TSE)*(DA)*CP*C)-3', 50S RIBOSOMAL PROTEIN L7AE, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L2P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L11P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vqm	prot-nuc 2.30	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DAN" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L7AE, 5'-R(*CP*CP*(PPU)P*(PO2)P*(DA)P*C*C)-3'), 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L30P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L11P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vqn	prot-nuc 2.40	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF CC-HPMN AND CCA-PHE-CAP-BIO BOUND TO THE LA RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L2P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L14P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L19E, 5'-R(*CP*CP*(PPU)*(LOF))-3', 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L13P, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3', 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L15P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vqo	prot-nuc 2.20	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF CCPMN BOUND TO THE LARGE RIBOSOMAL SUBUNIT MARISMORTUI 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L30P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE, 5'-R(*CP*CP*(PPU))-3', 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L18P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vqp	prot-nuc 2.25	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "RAP" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L18P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L21E, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3', 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L2P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L11P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1yhq	prot-nuc 2.40	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF AZITHROMYCIN BOUND TO THE G2099A MUTANT RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L3P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L14P RIBOSOME AZITHROMYCIN, ANTIBIOTIC COMPLEXES, MUTATED 50S SUBUNITS, RI
1yi2	prot-nuc 2.65	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF ERYTHROMYCIN BOUND TO THE G2099A MUTANT RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L7AE, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L19E RIBOSOME ERYTHROMYCIN, ANTIBIOTIC COMPLEXES, MUTATED 50S SUBUNITS, RI
1yij	prot-nuc 2.60	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF TELITHROMYCIN BOUND TO THE G2099A MUTAN RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L3P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L37AE, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P RIBOSOME TELITHROMYCIN, ANTIBIOTIC COMPLEXES, MUTATED 50S SUBUNITS, R
1yit	prot-nuc 2.80	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF VIRGINIAMYCIN M AND S BOUND TO THE 50S SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L37AE, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L24P, VIRGINIAMYCIN S1, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L29P RIBOSOME/ANTIBIOTIC VIRGINIAMYCIN M, VIRGINIAMYCIN S, PEPTIDYL TRANSFERASE, RIBO STREPTOGRAMIN, RIBOSOME-ANTIBIOTIC COMPLEX, ANTIBIOTIC, CYCLOHEXADEPSIPEPTIDE
1yj9	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF THE MUTANT 50S RIBOSOMAL SUBUNIT OF HAL MARISMORTUI CONTAINING A THREE RESIDUE DELETION IN L22 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L14P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L21E RIBOSOME L22, DELETION MUTATION, MUTATED 50S SUBUNITS, RIBOSOME
1yjn	prot-nuc 3.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF CLINDAMYCIN BOUND TO THE G2099A MUTANT RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L14P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L6P RIBOSOME CLINDAMYCIN, ANTIBIOTIC COMPLEXES, MUTATED 50S SUBUNITS, RIB
1yjw	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF QUINUPRISTIN BOUND TO THE G2099A MUTANT RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L31E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24P, QUINUPRISTIN, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L39E RIBOSOME/ANTIBIOTIC QUINUPRISTIN, DALFOPRISTIN, STREPTOGRAMIN, ANTIBIOTIC, MUTAT SUBUNITS, RIBOSOME, RIBOSOME-ANTIBIOTIC COMPLEX
2dlc	prot-nuc 2.40	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF THE TERNARY COMPLEX OF YEAST TYROSYL-TR SYNTHETASE T-RNA (76-MER), TYROSYL-TRNA SYNTHETASE, CYTOPLASMIC LIGASE/TRNA TYRRS, TRNA, LIGASE-TRNA COMPLEX
2otj	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	13-DEOXYTEDANOLIDE BOUND TO THE LARGE SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L10E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L3P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L18P RIBOSOME 13 DEOXYTEDANOLIDE, ANTIBIOTIC COMPLEX, 50S, RIBOSOME
2otl	prot-nuc 2.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	GIRODAZOLE BOUND TO THE LARGE SUBUNIT OF HALOARCULA MARISMOR 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L11P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L15E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37E RIBOSOME GIRODAZOLE, GIROLLINE, ANTIBIOTIC COMPLEX, 50S, RIBOSOME, LA SUBUNIT
2qex	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	NEGAMYCIN BINDS TO THE WALL OF THE NASCENT CHAIN EXIT TUNNEL 50S RIBOSOMAL SUBUNIT ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L15E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L3P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15P RIBOSOME LARGE RIBOSOMAL SUBUNIT, 50S, NEGAMYCIN, HALOARCULA MARISMOR RIBOSOME
3cc2	prot-nuc 2.40	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION WITH RRNA SEQU THE 23S RRNA AND GENOME-DERIVED SEQUENCES FOR R-PROTEINS 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE RIBOSOME GENOMIC SEQUNECE FOR R-PROTEINS, RIBONUCLEOPROTEIN, RIBOSOMA PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METAL-BIN ZINC-FINGER, RIBOSOME
3cc4	prot-nuc 2.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CO-CRYSTAL STRUCTURE OF ANISOMYCIN BOUND TO THE 50S RIBOSOMA 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15E RIBOSOME WILD TYPE, LARGE RIBOSOMAL SUBUNIT, HALOARCULA MARISMORTUI, CRYSTAL, ANISOMYCIN, RIBOSOME
3cc7	prot-nuc 2.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION C2487U 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L14P RIBOSOME ANISOMYCIN RESISTANCE, C2487U, LARGE RIBOSOMAL SUBUNIT, 23S RIBONUCLEOPROTEIN, RIBOSOMAL PROTEIN, RNA-BINDING, RRNA-BIN TRNA-BINDING, METAL-BINDING, ZINC-FINGER, RIBOSOME
3cce	prot-nuc 2.75	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION U2535A 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15E RIBOSOME 23S RRNA MUTATION U2535A, RIBOSOME
3ccj	prot-nuc 3.30	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION C2534U 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15E RIBOSOME C2534U MUTATION, 23S RRNA, LARGE RIBOSOMAL SUBUNIT, RIBOSOME
3ccl	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION U2535C. DENSITY FOR ANISOMYCIN IS VISIBLE BUT NOT IN MODEL. 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L21E RIBOSOME U2535C MUTATION, 23S RRNA, LARGE RIBOSOMAL SUBUNIT, RIBOSOME
3ccm	prot-nuc 2.55	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION G2611U 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P RIBOSOME G2611U MUTATION, 23S RRNA, LARGE RIBOSOMAL SUBUNIT, RIBOSOME
3ccq	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION A2488U 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P RIBOSOME GENOMIC SEQUNECE FOR R-PROTEINS, RIBOSOME
3ccr	prot-nuc 3.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION A2488C. DENSITY FOR ANISOMYCIN IS VISIBLE BUT NOT IN THE MODEL. 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E RIBOSOME A2488C MUTATION, 23S RRNA, LARGE RIBOSOMAL SUBUNIT, RIBOSOME
3ccs	prot-nuc 2.95	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION G2482A 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E RIBOSOME G2482A MUTATION, 23S RRNA, LARGE RIBOSOMAL SUBUNIT, RIBOSOME
3ccu	prot-nuc 2.80	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION G2482C 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L15E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E RIBOSOME G2482C MUTATION, 23S RRNA, LARGE RIBOSOMAL SUBUNIT, RIBOSOME
3ccv	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S MUTATION G2616A 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L2P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L3P RIBOSOME G2616A MUTATION, 23S RRNA, LARGE RIBOSOMAL SUBUNIT, RIBOSOME
3cd6	prot-nuc 2.75	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CO-CYSTAL OF LARGE RIBOSOMAL SUBUNIT MUTANT G2616A WITH CC-P 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, RNA (5'-R(*CP*CP*(PPU))-3'), 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L15E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E RIBOSOME G2616A MUTATION, 23S RRNA, LARGE RIBOSOMAL SUBUNIT, CC-PUROM RIBOSOME
3cma	prot-nuc 2.80	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF CCA AND CCA-PHE-CAP-BIO BOUND TO THE LARGE SUBUNIT OF HALOARCULA MARISMORTUI 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, RNA (5'-R(*CP*CP*A)-3'), 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, RNA (5'-R(*CP*CP*(8AN))-3') RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL-TRNA HYDROLYSIS, RIBOSOME
3cme	prot-nuc 2.95	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE STRUCTURE OF CA AND CCA-PHE-CAP-BIO BOUND TO THE LARGE R SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L39E, RNA (5'-R(*CP*CP*(8AN))-3'), 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, RNA (5'-R(*C*CP*A)-3'), 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, HYDROLYSIS OF PEPTIDYL-TRNA, RIBOSOME
3deg	prot-nuc 10.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	COMPLEX OF ELONGATING ESCHERICHIA COLI 70S RIBOSOME AND EF4( GMPPNP 50S RNA HELIX 42-44, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 30S RNA HELIX 8, P-TRNA, GTP-BINDING PROTEIN LEPA: EF4, 50S RNA HELIX 92, A/L-TRNA, 30S RNA HELIX 14, 50S RNA HELIX 95, 50S RNA HELIX 71 RIBOSOME RIBOSOME, TRANSLATION, LEPA, EF4, GTP-BINDING, MEMBRANE, NUC BINDING, ANTIBIOTIC RESISTANCE, RIBONUCLEOPROTEIN, RIBOSOMA PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METHYLATI
3g4s	prot-nuc 3.20	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CO-CRYSTAL STRUCTURE OF TIAMULIN BOUND TO THE LARGE RIBOSOMA 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L2P: RESIDUES 143-264, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L4P, 23S RIBOSOMAL RNA: RESIDUES 2634210-2637132, 50S RIBOSOMAL PROTEIN L10, 50S RIBOSOMAL PROTEIN L31E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15P RIBOSOME LARGE RIBOSOMAL SUBUNIT, TIAMULIN, HALOARCULA MARISMORTUI, RIBONUCLEOPROTEIN, RIBOSOMAL PROTEIN, RNA-BINDING, RRNA-BIN TRNA-BINDING, METAL-BINDING, ZINC-FINGER, RIBOSOME
3g6e	prot-nuc 2.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CO-CRYSTAL STRUCTURE OF HOMOHARRINGTONINE BOUND TO THE LARGE SUBUNIT 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L2P: RESIDUES 143-264, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L37E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L4P, 23S RIBOSOMAL RNA: RESIDUES 2634210-2637132, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L21E RIBOSOME LARGE RIBOSOMAL SUBUNIT, ANTIBIOTIC SPECIFICITY, HOMOHARRING HALOARCULA MARISMORTUI, RIBONUCLEOPROTEIN, RIBOSOMAL PROTEI BINDING, RRNA-BINDING, TRNA-BINDING, METAL-BINDING, ZINC-FI RIBOSOME
3g71	prot-nuc 2.85	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CO-CRYSTAL STRUCTURE OF BRUCEANTIN BOUND TO THE LARGE RIBOSO SUBUNIT 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L2P: RESIDUES 143-264, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L4P, 23S RIBOSOMAL RNA: RESIDUES 2634210-2637132, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L7AE RIBOSOME LARGE RIBOSOMAL SUBUNIT, HALOARCULA MARISMORTUI, BRUCEANTIN, RIBONUCLEOPROTEIN, RIBOSOMAL PROTEIN, RNA-BINDING, RRNA-BIN TRNA-BINDING, METAL-BINDING, ZINC-FINGER, RIBOSOME
3i55	prot-nuc 3.11	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	CO-CRYSTAL STRUCTURE OF MYCALAMIDE A BOUND TO THE LARGE RIBOSOMAL SUBUNIT 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L18P, DNA/RNA (5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2) P*AP*CP*C)-3'), 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L10E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L4P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L18E RIBOSOME/ANTIBIOTIC LARGE RIBOSOMAL SUBUNIT, MYCALAMIDE A, RIBONUCLEOPROTEIN, RIBOSOMAL PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METAL-BINDING, ZINC, ZINC-FINGER, ACETYLATION, RIBOSOME- ANTIBIOTIC COMPLEX
3i56	prot-nuc 2.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	CO-CRYSTAL STRUCTURE OF TRIACETYLOLEANDOMCYIN BOUND TO THE LARGE RIBOSOMAL SUBUNIT 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L6P RIBOSOME/ANTIBIOTIC LARGE RIBOSOMAL SUBUNIT, TRIACETYLOLEANDOMCYIN, RIBONUCLEOPROTEIN, RIBOSOMAL PROTEIN, RNA-BINDING, RRNA- BINDING, TRNA-BINDING, METAL-BINDING, ZINC, ZINC-FINGER, ACETYLATION, RIBOSOME, RIBOSOME-ANTIBIOTIC COMPLEX
4cxg	prot-nuc 8.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT ROLLING: A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 18S RRNA - H44, 40S RIBOSOMAL PROTEIN US12, TRANSFER RNA, 28S RRNA - H95, 28S RRNA - H89, ELONGATION FACTOR 1A, MESSENGER RNA, 18S RRNA - H8, 18S RRNA - H5-H14 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX
4cxh	prot-nuc 8.90	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 28S RRNA - H95, TRANSFER RNA, 40S RIBOSOMAL PROTEIN US12, 18S RRNA - H44, 18S RRNA - H8, 18S RRNA - H5-H14, MESSENGER RNA, ELONGATION FACTOR 1A, 28S RRNA - H89 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX, ELONGATION FACTOR EE
5ccx	prot-nuc 2.10	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF THE PRODUCT COMPLEX OF TRNA M1A58 METHYLTRANSFE TRNA3LYS AS SUBSTRATE TRNA (ADENINE(58)-N(1))-METHYLTRANSFERASE CATALYT TRMT61A, TRNA3LYS, TRNA (ADENINE(58)-N(1))-METHYLTRANSFERASE NON-CAT SUBUNIT TRM6 TRANSFERASE/RNA TRNA MODIFICATION, SAM-DEPENDENT METHYLTRANSFERASE CLASS I, METHYLTRANSFERASE FOLD, HIV-1 PRIMER, TRANSFERASE-RNA COMPL

1MG    1N-METHYLGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1asy	prot-nuc 2.90	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	CLASS II AMINOACYL TRANSFER RNA SYNTHETASES: CRYSTAL STRUCTURE OF YEAST ASPARTYL-TRNA SYNTHETASE COMPLEXED WITH TRNA ASP T-RNA (75-MER), ASPARTYL-TRNA SYNTHETASE COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA) COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA)
1asz	prot-nuc 3.00	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE ACTIVE SITE OF YEAST ASPARTYL-TRNA SYNTHETASE: STRUCTURAL AND FUNCTIONAL ASPECTS OF THE AMINOACYLATION REACTION T-RNA (75-MER), ASPARTYL-TRNA SYNTHETASE COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA) COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA)
1f7u	prot-nuc 2.20	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE ARGINYL-TRNA SYNTHETASE COMPLEXED W TRNA(ARG) AND L-ARG ARGINYL-TRNA SYNTHETASE, TRNA(ARG) LIGASE/RNA RNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETASE LIGASE-RNA COMPLEX
1f7v	prot-nuc 2.90	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF YEAST ARGINYL-TRNA SYNTHETASE COMPLEXED TRNAARG TRNA(ARG), ARGINYL-TRNA SYNTHETASE LIGASE/RNA TRNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETAS LIGASE-RNA COMPLEX
1il2	prot-nuc 2.60	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	CRYSTAL STRUCTURE OF THE E. COLI ASPARTYL-TRNA SYNTHETASE:YEAST TRNAASP:ASPARTYL-ADENYLATE COMPLEX ASPARTYL TRANSFER RNA, ASPARTYL-TRNA SYNTHETASE LIGASE/RNA PROTEIN-RNA COMPLEX, LIGASE/RNA COMPLEX
1ir4	prot-nuc model  	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	DOCKING MODEL OF T. THERMOPHILUS ARGRS AND YEAST TRNA(ARG) ARGINYL T-RNA, ARGINYL-TRNA SYNTHETASE LIGASE/RNA ROSSMANN FOLD, A-HELIX BUNDLE

1MK    CHLORIDO(ETA-6-P-CYMENE)(N-FLUOROPHENYL-2- PYRIDINECARBOTHIOAMIDE)OSMIUM(II)

Code	Class Resolution	Description
4j8w	prot-nuc 2.41	CHLORIDO(ETA-6-P-CYMENE)(N-FLUOROPHENYL-2- PYRIDINECARBOTHIOAMIDE)OSMIUM(II) 3(C22 H23 CL F N2 OS S)	X-RAY STRUCTURE OF NCP145 WITH CHLORIDO(ETA-6-P-CYMENE)(N- FLUOROPHENYL-2-PYRIDINECARBOTHIOAMIDE)OSMIUM(II) DNA (145-MER), HISTONE H4, HISTONE H2A, HISTONE H2B 1.1, HISTONE H3.2, DNA (145-MER) STRUCTURAL PROTEIN/DNA NUCLEOSOMES, HISTONE, STRUCTURAL PROTEIN-DNA COMPLEX

1PE    PENTAETHYLENE GLYCOL

Code	Class Resolution	Description
1tk0	prot-nuc 2.30	PENTAETHYLENE GLYCOL C10 H22 O6	T7 DNA POLYMERASE TERNARY COMPLEX WITH 8 OXO GUANOSINE AND DDCTP AT THE INSERTION SITE 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*A*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP* CP*AP*(DDG))-3', THIOREDOXIN 1, 5'-D(*CP*CP*CP*(8OG) P*CP*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP* TP*CP*G)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA 8 OXO GUANOSINE, DNA POLYMERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1tk5	prot-nuc 2.20	PENTAETHYLENE GLYCOL C10 H22 O6	T7 DNA POLYMERASE BINARY COMPLEX WITH 8 OXO GUANOSINE IN THE TEMPLATING STRAND 5'-D(*CP*CP*CP*(8OG) P*CP*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP* TP*CP*G)-3', DNA POLYMERASE, 5'- D(*CP*GP*AP*AP*A*GP*CP*CP*AP*GP*TP*GP*CP*CP*AP*(DDG) P*TP*GP*CP*AP*A)-3', THIOREDOXIN 1 TRANSFERASE/ELECTRON TRANSPORT/DNA 8-OXOGUANOSINE DNA POLYMERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1tk8	prot-nuc 2.50	PENTAETHYLENE GLYCOL C10 H22 O6	T7 DNA POLYMERASE TERNARY COMPLEX WITH 8 OXO GUANOSINE AND DAMP AT THE ELONGATION SITE THIOREDOXIN 1, 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*AP*(2DA))-3', 5'-D(*CP*CP*CP*AP*(8OG) P*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA 8-OXOGUANOSINE DNA POLYMERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1tkd	prot-nuc 2.49	PENTAETHYLENE GLYCOL C10 H22 O6	T7 DNA POLYMERASE TERNARY COMPLEX WITH 8 OXO GUANOSINE AND DCMP AT THE ELONGATION SITE DNA POLYMERASE, DNA (5'-D(*CP*CP*CP*AP*(8OG) P*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3'), DNA (5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*AP*(DOC))-3'), THIOREDOXIN 1 TRANSFERASE/ELECTRON TRANSPORT/DNA 8-OXOGUANOSINE DNA POLYMERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
2jea	prot-nuc 2.33	PENTAETHYLENE GLYCOL C10 H22 O6	STRUCTURE OF A 9-SUBUNIT ARCHAEAL EXOSOME BOUND TO RNA EXOSOME COMPLEX EXONUCLEASE 2, EXOSOME COMPLEX RNA-BINDING PROTEIN 1, RNA, EXOSOME COMPLEX EXONUCLEASE 1 HYDROLASE/RNA HYDROLASE RNA COMPLEX, HYDROLASE-RNA COMPLEX, NUCLEASE, HYDROLASE, RNA-BINDING, EXONUCLEASE, PHOSPHOROLYTIC, EXORIBONUCLEASE, RNA DEGRADATION, RRP4, RRP42, RRP41, EXOSOME, RNASE PH
2vnu	prot-nuc 2.30	PENTAETHYLENE GLYCOL C10 H22 O6	CRYSTAL STRUCTURE OF SC RRP44 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP)-3', EXOSOME COMPLEX EXONUCLEASE RRP44: RESIDUES 242-1001 HYDROLASE/RNA HYDROLASE-RNA COMPLEX, RNA DEGRADATION, RNA-BINDING, RNA PRO
2xzl	prot-nuc 2.40	PENTAETHYLENE GLYCOL 12(C10 H22 O6)	UPF1-RNA COMPLEX 5- R(*UP*UP*UP*UP*UP*UP*UP*UP*U) -3, ATP-DEPENDENT HELICASE NAM7: CH DOMAIN AND HELICASE DOMAIN, RESIDUES 54-850 HYDROLASE/RNA HYDROLASE-RNA COMPLEX, NMD, RNA DEGRADATION, ALLOSTERIC REGU
2xzo	prot-nuc 2.40	PENTAETHYLENE GLYCOL 3(C10 H22 O6)	UPF1 HELICASE - RNA COMPLEX REGULATOR OF NONSENSE TRANSCRIPTS 1: HELICASE DOMAIN, RESIDUES 295-914, 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3' HYDROLASE/RNA HYDROLASE-RNA COMPLEX, NMD, RNA DEGRADATION, ALLOSTERIC REGU
3gox	prot-nuc 1.50	PENTAETHYLENE GLYCOL C10 H22 O6	CRYSTAL STRUCTURE OF THE BETA-BETA-ALPHA-ME TYPE II RESTRICT ENDONUCLEASE HPY99I IN THE ABSENCE OF EDTA RESTRICTION ENDONUCLEASE HPY99I, 5'-(*DCP*DTP*DCP*DGP*DAP*DCP*DGP*DTP*DAP*DGP*DA)- CHAIN: C, 5'-(*DTP*DAP*DCP*DGP*DTP*DCP*DGP*DAP*DGP*DTP*DC)- CHAIN: D HYDROLASE/DNA ENDONUCLEASE-DNA COMPLEX, RESTRICTION ENZYME, HPY99I, PSEUDOPALINDROME, HYDROLASE-DNA COMPLEX
3mxa	prot-nuc 2.30	PENTAETHYLENE GLYCOL C10 H22 O6	MOLECULAR BASIS OF ENGINEERED MEGANUCLEASE TARGETING OF THE HUMAN RAG1 LOCUS DNA (5'-D(*TP*CP*TP*GP*GP*CP*TP*GP*AP*GP*GP*TP*AP CHAIN: E, SCV3V2(G19S), DNA (5'-D(*TP*TP*GP*TP*TP*CP*TP*CP*AP*GP*GP*TP*AP CHAIN: C, DNA (5'-D(P*CP*TP*CP*AP*GP*CP*CP*AP*GP*A)-3'), DNA (5'-D(P*CP*TP*GP*AP*GP*AP*AP*CP*AP*A)-3') HYDROLASE/DNA PROTEIN-DNA COMPLEX, HYDROLASE-DNA COMPLEX
3tq6	prot-nuc 2.45	PENTAETHYLENE GLYCOL C10 H22 O6	CRYSTAL STRUCTURE OF HUMAN MITOCHONDRIAL TRANSCRIPTION FACTO OR MTTFA, BOUND TO THE LIGHT STRAND PROMOTER LSP DNA (5'- D(*GP*TP*TP*AP*GP*TP*TP*GP*GP*GP*GP*GP*GP*TP*GP*AP*CP*TP*GP 3'), DNA (5'- D(*TP*AP*AP*CP*AP*GP*TP*CP*AP*CP*CP*CP*CP*CP*CP*AP*AP*CP*(B P*AP*AP*C)-3'), TRANSCRIPTION FACTOR A, MITOCHONDRIAL TRANSCRIPTION/DNA TRANSCRIPTION, TRANSCRIPTION REGULATION, MITOCHONDRION, DNA- HMGB-UBF_HMG-BOX, MINOR GROOVE, TANDEM HMG BOXES, TRANSCRIP COMPLEX, MITOCHONDRIAL NUCLEOID, LIGHT-STRAND MITOCHONDRIAL PROMOTER, LSP
4ba2	prot-nuc 2.50	PENTAETHYLENE GLYCOL C10 H22 O6	ARCHAEAL EXOSOME (RRP4-RRP41(D182A)-RRP42) BOUND TO INORGANIC PHOSPHATE PROBABLE EXOSOME COMPLEX EXONUCLEASE 1, PROBABLE EXOSOME COMPLEX RNA-BINDING PROTEIN 1, 5'-R(*AP*AP*AP*AP)-3', PROBABLE EXOSOME COMPLEX EXONUCLEASE 2 HYDROLASE/RNA HYDROLASE-RNA COMPLEX, ARCHAEA, RNA DEGRADATION, PHOSPHOROLY REACTION MECHANISM
4qcl	prot-nuc 2.20	PENTAETHYLENE GLYCOL C10 H22 O6	CRYSTAL STRUCTURE OF THE CATALYTIC CORE OF HUMAN DNA POLYMER IN TERNARY COMPLEX WITH AN RNA-PRIMED DNA TEMPLATE AND DCTP RNA PRIMER, DNA TEMPLATE, DNA POLYMERASE ALPHA CATALYTIC SUBUNIT: HUMAN DNA POLYMERASE APHA CATALYTIC CORE DOMAIN R 336-1257 TRANSFERASE/DNA/RNA B-FAMILY DNA POLYMERASE, DNA REPLICATION, TRANSFERASE-DNA-RN
4zlr	prot-nuc 2.30	PENTAETHYLENE GLYCOL C10 H22 O6	STRUCTURE OF THE BRAT-NHL DOMAIN BOUND TO CONSENSUS RNA MOTI RNA (5'-R(*UP*UP*GP*UP*UP*GP*UP*UP*UP*UP*UP*UP*UP CHAIN: C, BRAIN TUMOR PROTEIN: UNP RESIDUES 756-1037 TRANSLATION NHL-DOMAIN, BETA-PROPELLER, RNA BINDING, TRANSLATIONAL REPRE TRANSLATION

1RN    (E)-N-{[4-OXO-1-(5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-2-THIOXO-1,2,3,4- TETRAHYDROPYRIMIDIN-5-YL]METHYLIDENE}GLYCINE

Code	Class Resolution	Description
4jyz	prot-nuc 2.50	(E)-N-{[4-OXO-1-(5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-2-THIOXO-1,2,3,4- TETRAHYDROPYRIMIDIN-5-YL]METHYLIDENE}GLYCINE C12 H16 N3 O10 P S	CRYSTAL STRUCTURE OF E. COLI GLUTAMINYL-TRNA SYNTHETASE BOUN AND NATIVE TRNA(GLN) CONTAINING THE CMNM5S2U34 ANTICODON WO RNA (72-MER), GLUTAMINE--TRNA LIGASE LIGASE/RNA ROSSMANN FOLD, PROTEIN-RNA COMPLEX, AMINOACYL-TRNA SYNTHETAS LIGASE, LIGASE-RNA COMPLEX

1RT    4-AMINO-2-OXO-1,2-DIHYDROPYRIMIDINE-5-CARBOXYLIC ACID

Code	Class Resolution	Description
4jgc	prot-nuc 2.58	4-AMINO-2-OXO-1,2-DIHYDROPYRIMIDINE-5-CARBOXYLIC ACID C5 H5 N3 O3	HUMAN TDG N140A MUTANT IN A COMPLEX WITH 5-CARBOXYLCYTOSINE G/T MISMATCH-SPECIFIC THYMINE DNA GLYCOSYLASE: UNP RESIDUES 111-308, OLIGONUCLEOTIDE CONTAINING 5-CARBOXYLCYTOSINE, OLIGONUCLEOTIDE HYDROLASE/DNA 5-CARBOXYLCYTOSINE; THYMINE DNA GLYCOSYLASE; DNA MODIFICATIO 5MC OXIDATION; EPIGENETIC REGULATION, DNA DEMETHYLATION, 5- CARBOXYLCYTOSINE, HYDROLASE-DNA COMPLEX

1RY    [[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE

Code	Class Resolution	Description
4k4i	prot-nuc 2.25	[[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE 4(C8 H13 F N3 O12 P3 S)	TERNARY CRYSTAL STRUCTURES OF A HUMAN DNA POLYMERASE LAMBDA WITH DNA AND (-)FTC-TP. DNA (5'-D(*CP*GP*GP*CP*GP*GP*TP*AP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*TP*AP*C)-3'), DNA (5'-D(P*GP*CP*CP*G)-3'), DNA POLYMERASE LAMBDA TRANSFERASE/DNA DNA POLYMERASE, DNA REPAIR, PHOSPHORYL TRANSFER REACTION, TRANSFERASE-DNA COMPLEX
5c51	prot-nuc 3.43	[[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C8 H13 F N3 O12 P3 S	PROBING THE STRUCTURAL AND MOLECULAR BASIS OF NUCLEOTIDE SEL BY HUMAN MITOCHONDRIAL DNA POLYMERASE GAMMA DNA, DNA POLYMERASE SUBUNIT GAMMA-1, DNA POLYMERASE SUBUNIT GAMMA-2, MITOCHONDRIAL, DNA (5'-D(*(AD) P*AP*AP*AP*CP*GP*AP*GP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*GP*TP* CHAIN: P TRANSFERASE/DNA NUCLEOSIDE REVERSE TRANSCRIPTASE INHIBITORS (NRTIS), HIV RT, MITOCHONDRIAL DNA POLYMERASE, MITOCHONDRIAL TOXICITY, DRUG AND TOXICITY, TRANSFERASE-DNA COMPLEX
5c52	prot-nuc 3.64	[[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C8 H13 F N3 O12 P3 S	PROBING THE STRUCTURAL AND MOLECULAR BASIS OF NUCLEOTIDE SEL BY HUMAN MITOCHONDRIAL DNA POLYMERASE GAMMA DNA POLYMERASE SUBUNIT GAMMA-2, MITOCHONDRIAL, DNA (26-MER), DNA (5'- D(*AP*AP*AP*AP*CP*GP*AP*GP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*GP 3'), DNA POLYMERASE SUBUNIT GAMMA-1 TRANSFERASE/DNA NUCLEOSIDE REVERSE TRANSCRIPTASE INHIBITORS (NRTIS), HIV REV TRANSCRIPTASE (RT), HUMAN MITOCHONDRIAL DNA POLYMERASE, TRA DNA COMPLEX
5tb9	prot-nuc 2.49	[[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C8 H13 F N3 O12 P3 S	PRECATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA IN CONFORMATION WITH GAPPED DNA SUBSTRATE INCOMING (-)FTC-TP A 16- MER TEMPLATE, DNA POLYMERASE BETA, 5-MER PHOSPHORYLATED DOWNSTREAM PRIMER, 10- MER PRIMER TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM
5u2t	prot-nuc 1.79	[[(2R,5S)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C8 H13 F N3 O12 P3 S	PRE-CATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA W DNA SUBSTRATE INCOMING (-)FTC-TP AND CA2+. DNA POLYMERASE BETA, 16- MER TEMPLATE, 5-MER PHOSPHORYLATED DOWNSTREAM PRIMER, 10- MER PRIMER TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM

1RZ    [[(2R,5S)-5-(4-AZANYL-2-OXIDANYLIDENE-PYRIMIDIN-1-YL)- 1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL-PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE

Code	Class Resolution	Description
4k4h	prot-nuc 2.10	[[(2R,5S)-5-(4-AZANYL-2-OXIDANYLIDENE-PYRIMIDIN-1-YL)- 1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL-PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE 4(C8 H14 N3 O12 P3 S)	TERNARY CRYSTAL STRUCTURES OF A HUMAN DNA POLYMERASE LAMBDA WITH DNA AND (-)3TC-TP. DNA (5'-D(P*GP*CP*CP*G)-3'), DNA POLYMERASE LAMBDA, DNA (5'-D(*CP*AP*GP*TP*AP*C)-3'), DNA (5'-D(*CP*GP*GP*CP*GP*GP*TP*AP*CP*TP*G)-3') TRANSFERASE/DNA DNA POLYMERASE, DNA REPAIR, PHOSPHORYL TRANSFER REACTION, TRANSFERASE-DNA COMPLEX
5tb8	prot-nuc 2.00	[[(2R,5S)-5-(4-AZANYL-2-OXIDANYLIDENE-PYRIMIDIN-1-YL)- 1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL-PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C8 H14 N3 O12 P3 S	PRECATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA IN CONFORMATION WITH GAPPED DNA SUBSTRATE INCOMING (-)3TC-TP A 10- MER PRIMER, 5-MER PHOSPHORYLATED DOWNSTREAM PRIME, DNA POLYMERASE BETA, 16- MER TEMPLATE TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM
5tbc	prot-nuc 1.85	[[(2R,5S)-5-(4-AZANYL-2-OXIDANYLIDENE-PYRIMIDIN-1-YL)- 1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL-PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C8 H14 N3 O12 P3 S	PRECATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA WI DNA SUBSTRATE, INCORPORATED (-)3TC-MP AND AN ANOTHER INCOMI TP NUCLEOTIDE. DNA POLYMERASE BETA, 16- MER TEMPLATE, 10- MER PRIMER, 5-MER PHOSPHORYLATED DOWNSTREAM PRIMER TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM
5u2s	prot-nuc 2.30	[[(2R,5S)-5-(4-AZANYL-2-OXIDANYLIDENE-PYRIMIDIN-1-YL)- 1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL-PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C8 H14 N3 O12 P3 S	PRE-CATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA W DNA SUBSTRATE INCOMING (-)3TC-TP AND CA2+. 10- MER PRIMER, 5-MER PHOSPHORYLATED DOWNSTREAM PRIMER, 16- MER TEMPLATE, DNA POLYMERASE BETA TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM

1S0    4-AMINO-1-{2-DEOXY-5-O-[(R)-HYDROXY{[(S)- HYDROXY(PHOSPHONOOXY)PHOSPHORYL]OXY}PHOSPHORYL]-BETA- L-ERYTHRO-PENTOFURANOSYL}PYRIMIDIN-2(1H)-ONE

Code	Class Resolution	Description
4k4g	prot-nuc 2.15	4-AMINO-1-{2-DEOXY-5-O-[(R)-HYDROXY{[(S)- HYDROXY(PHOSPHONOOXY)PHOSPHORYL]OXY}PHOSPHORYL]-BETA- L-ERYTHRO-PENTOFURANOSYL}PYRIMIDIN-2(1H)-ONE 4(C9 H16 N3 O13 P3)	TERNARY CRYSTAL STRUCTURES OF HUMAN DNA POLYMERASE LAMBDA IN WITH DNA AND L-DCTP. DNA (5'-D(*CP*AP*GP*TP*AP*C)-3'), DNA (5'-D(*CP*GP*GP*CP*GP*GP*TP*AP*CP*TP*G)-3'), DNA (5'-D(P*GP*CP*CP*G)-3'), DNA POLYMERASE LAMBDA TRANSFERASE/DNA DNA POLYMERASE, DNA REPAIR, PHOSPHORYL TRANSFER REACTION,, TRANSFERASE-DNA COMPLEX
5u2r	prot-nuc 1.80	4-AMINO-1-{2-DEOXY-5-O-[(R)-HYDROXY{[(S)- HYDROXY(PHOSPHONOOXY)PHOSPHORYL]OXY}PHOSPHORYL]-BETA- L-ERYTHRO-PENTOFURANOSYL}PYRIMIDIN-2(1H)-ONE C9 H16 N3 O13 P3	PRECATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA WI DNA SUBSTARTE, INCOMING L-DCTP AND CA2+ DNA POLYMERASE BETA, 5-MER PHOSPHORYLATED DOWNSTREAM PRIMER, 16- MER TEMPLATE, 10- MER PRIMER TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM

1SY    CGAMP

Code	Class Resolution	Description
4lez	prot-nuc 2.36	CGAMP 2(C20 H24 N10 O13 P2)	STRUCTURE OF MOUSE CGAS BOUND TO AN 18BP DNA AND CGAS PRODUC CYCLIC GMP-AMP SYNTHASE: MOUSE CGAS CATALYTIC DOMAIN, UNP RESIDUES 142-507 SYNONYM: CGAMP SYNTHASE, CGAS, M-CGAS, MAB-21 DOMAIN-CONTAI PROTEIN 1, 18BP DSDNA TRANSFERASE/DNA NTASE, DNA SENSOR, TRANSFERASE-DNA COMPLEX

1SZ    N-[5-[[4-[[5-[[5-[[5-[[5-[[3-[3-(DIMETHYLAMINO) PROPYLAMINO]-3-OXIDANYLIDENE-PROPYL]CARBAMOYL]-1- METHYL-PYRROL-3-YL]CARBAMOYL]-1-METHYL-PYRROL-3- YL]CARBAMOYL]-1-METHYL-PYRROL-3-YL]CARBAMOYL]-1- METHYL-PYRROL-3-YL]AMINO]-4-OXIDANYLIDENE- BUTYL]CARBAMOYL]

Code	Class Resolution	Description
1m18	prot-nuc 2.45	N-[5-[[4-[[5-[[5-[[5-[[5-[[3-[3-(DIMETHYLAMINO) PROPYLAMINO]-3-OXIDANYLIDENE-PROPYL]CARBAMOYL]-1- METHYL-PYRROL-3-YL]CARBAMOYL]-1-METHYL-PYRROL-3- YL]CARBAMOYL]-1-METHYL-PYRROL-3-YL]CARBAMOYL]-1- METHYL-PYRROL-3-YL]AMINO]-4-OXIDANYLIDENE- BUTYL]CARBAMOYL] 2(C58 H71 N21 O10)	LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSO HISTONE H2B.1, HISTONE H4, HISTONE H3.2, HISTONE H2A.1, PALINDROMIC 146 BASE PAIR DNA FRAGMENT STRUCTURAL PROTEIN/DNA NUCLEOSOME, CHROMATIN, HISTONE, PYRROLE-IMIDAZOLE POLYAMIDE, REGOGNITION, CHROMATIN REMODELING, STRUCTURAL PROTEIN-DNA C

1TU    4-(3,5-DIFLUORO-4-HYDROXYBENZYL)-1,2-DIMETHYL-1H- IMIDAZOL-5-OL

Code	Class Resolution	Description
4kzd	prot-nuc 2.19	4-(3,5-DIFLUORO-4-HYDROXYBENZYL)-1,2-DIMETHYL-1H- IMIDAZOL-5-OL C12 H12 F2 N2 O2	CRYSTAL STRUCTURE OF AN RNA APTAMER IN COMPLEX WITH FLUOROPH FAB BL3-6 FAB ANTIBODY, HEAVY CHAIN, RNA (84-MER), BL3-6 FAB ANTIBODY, LIGHT CHAIN IMMUNE SYSTEM/RNA G-QUADRUPLEX, FLUORESCENCE, FLUOROPHORE BINDING, IN VITRO, I SYSTEM-RNA COMPLEX

1TW    2-AMINO-9-(2-SE-METHYL-5-O-PHOSPHONO-2-SELENO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE

Code	Class Resolution	Description
4o0i	prot-nuc 2.20	2-AMINO-9-(2-SE-METHYL-5-O-PHOSPHONO-2-SELENO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE 2(C11 H16 N5 O7 P SE)	CRYSTAL STRUCTURE OF FRAGMENT DNA POLYMERASE I FROM BACILLUS STEAROTHERMOPHILUS WITH 2'-MESE-ARABINO-GUANOSINE DERIVATIZ 5'-D(*C*(1TW)P*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3', DNA POLYMERASE I TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX

1UV    (3AS,4R)-4-AMINO-13-CYCLOPROPYL-8-FLUORO-10-OXO-3A,4,5, 6,10,13-HEXAHYDRO-1H,3H-PYRROLO[2',1':3,4][1, 4]OXAZEPINO[5,6-H]QUINOLINE-11-CARBOXYLIC ACID

Code	Class Resolution	Description
4kpf	prot-nuc 3.24	(3AS,4R)-4-AMINO-13-CYCLOPROPYL-8-FLUORO-10-OXO-3A,4,5, 6,10,13-HEXAHYDRO-1H,3H-PYRROLO[2',1':3,4][1, 4]OXAZEPINO[5,6-H]QUINOLINE-11-CARBOXYLIC ACID 2(C19 H20 F N3 O4)	NOVEL FLUOROQUINOLONES IN COMPLEX WITH TOPOISOMERASE IV FROM PNEUMONIAE AND E-SITE G-GATE E-SITE4, E-SITE2, PARC55: PARC55, PARE30: PARE30, E-SITE1, E-SITE3 ISOMERASE/DNA/INHIBITOR PROTEIN-DNA CLEAVAGE COMPLEX, ISOMERASE-DNA-INHIBITOR COMPLE TOPOISOMERASE IIA, QUINOLONE, ACHN-454

1W5    (1R)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-2-DEOXY-5-O-PHOSPHONO-D-ERYTHRO-PENTITOL

Code	Class Resolution	Description
4xo0	prot-nuc 1.70	(1R)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-2-DEOXY-5-O-PHOSPHONO-D-ERYTHRO-PENTITOL 2(C10 H14 N3 O9 P)	CRYSTAL STRUCTURE OF 5'-CTTATPPTAZZATAAG IN A HOST-GUEST COM REVERSE TRANSCRIPTASE: UNP RESIDUES 683-937, DNA (5'-D(P*AP*(1W5)P*(1W5)P*AP*TP*AP*AP*G)-3'), DNA (5'-D(*CP*TP*TP*AP*TP*(1WA)P*(1WA)P*T)-3') TRANSFERASE/DNA HOST-GUEST COMPLEX, B-DNA, NON-NATURAL NUCLEOBASE PAIR, SYNT BIOLOGY, TRANSFERASE-DNA COMPLEX

1WA    2-AMINO-8-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-HYDROXY-1H-IMIDAZO[1,2-A][1,3, 5]TRIAZINE-5,8-DIIUM

Code	Class Resolution	Description
4xo0	prot-nuc 1.70	2-AMINO-8-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-HYDROXY-1H-IMIDAZO[1,2-A][1,3, 5]TRIAZINE-5,8-DIIUM 2(C10 H16 N5 O7 P 2+)	CRYSTAL STRUCTURE OF 5'-CTTATPPTAZZATAAG IN A HOST-GUEST COM REVERSE TRANSCRIPTASE: UNP RESIDUES 683-937, DNA (5'-D(P*AP*(1W5)P*(1W5)P*AP*TP*AP*AP*G)-3'), DNA (5'-D(*CP*TP*TP*AP*TP*(1WA)P*(1WA)P*T)-3') TRANSFERASE/DNA HOST-GUEST COMPLEX, B-DNA, NON-NATURAL NUCLEOBASE PAIR, SYNT BIOLOGY, TRANSFERASE-DNA COMPLEX

20V    3-[(E)-{4-FORMYL-5-HYDROXY-6-METHYL-3-[(PHOSPHONOOXY) METHYL]PYRIDIN-2-YL}DIAZENYL]-7-NITRONAPHTHALENE-1,5- DISULFONIC ACID

Code	Class Resolution	Description
4lq3	prot-nuc 2.60	3-[(E)-{4-FORMYL-5-HYDROXY-6-METHYL-3-[(PHOSPHONOOXY) METHYL]PYRIDIN-2-YL}DIAZENYL]-7-NITRONAPHTHALENE-1,5- DISULFONIC ACID 4(C18 H15 N4 O14 P S2)	CRYSTAL STRUCTURE OF HUMAN NOROVIRUS RNA-DEPENDENT RNA-POLYM BOUND TO THE INHIBITOR PPNDS RNA-DEPENDENT RNA-POLYMERASE, 5'-R(P*GP*G)-3' VIRAL PROTEIN/REPLICATION INHIBITOR/RNA RNA-DEPENDENT-RNA-POLYMERASE, RDRP-INHIBOTIR COMPLEX, VIRAL REPLICATION INHIBITOR-RNA COMPLEX

23G    GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE

Code	Class Resolution	Description
3qrr	prot-nuc 3.10	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O10 P2	STRUCTURE OF THERMUS THERMOPHILUS CSE3 BOUND TO AN RNA REPRE PRODUCT COMPLEX PUTATIVE UNCHARACTERIZED PROTEIN TTHB192, RNA (5'- R(*GP*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*GP*UP*GP*GP*GP*(23G) CHAIN: B RNA BINDING PROTEIN/RNA PROTEIN-RNA COMPLEX, RAMP DOMAIN, RNA BINDING PROTEIN-RNA CO
4c8z	prot-nuc 2.50	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O10 P2	CAS6 (TTHA0078) PRODUCT COMPLEX R1 REPEAT RNA CLEAVAGE PRODUCT: REPEAT STEM-LOOP, CAS6A HYDROLASE/RNA HYDROLASE-RNA COMPLEX, CRISPR CAS PROTEIN, RNA PROCESSING RIBONUCLEASE
4c9d	prot-nuc 3.00	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C10 H13 N5 O10 P2)	CAS6 (TTHB231) PRODUCT COMPLEX CAS6B, R3 REPEAT RNA CLEAVAGE PRODUCT: REPEAT STEM-LOOP HYDROLASE/RNA HYDROLASE-RNA COMPLEX, CRISPR, RNA PROCESSING RIBONUCLEASE
5cd4	prot-nuc 3.20	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C10 H13 N5 O10 P2)	THE TYPE IE CRISPR CASCADE COMPLEX FROM E. COLI, WITH TWO AS IN THE ASYMMETRIC UNIT ARRANGED BACK-TO-BACK CRRNA, CRISPR SYSTEM CASCADE SUBUNIT CASE, CRISPR SYSTEM CASCADE SUBUNIT CASA, CRISPR SYSTEM CASCADE SUBUNIT CASC, CRISPR SYSTEM CASCADE SUBUNIT CASD, CRISPR SYSTEM CASCADE SUBUNIT CASB HYDROLASE/RNA CRISPR, CASCADE, RNA SURVEILLANCE, ADAPTIVE IMMUNITY, HYDROL COMPLEX
5h9e	prot-nuc 3.21	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O10 P2	CRYSTAL STRUCTURE OF E. COLI CASCADE BOUND TO A PAM-CONTAINI TARGET (32-NT SPACER) AT 3.20 ANGSTROM RESOLUTION. CRISPR SYSTEM CASCADE SUBUNIT CASB, CRISPR SYSTEM CASCADE SUBUNIT CASC, CRRNA (61-MER), DNA (47-MER) NON-TARGET, DNA (47-MER) TARGET, CRISPR SYSTEM CASCADE SUBUNIT CASD, CRISPR SYSTEM CASCADE SUBUNIT CASA, CRISPR SYSTEM CASCADE SUBUNIT CASE IMMUNE SYSTEM/RNA CRISPR CASCADE, IMMUNE SYSTEM-RNA COMPLEX
5h9f	prot-nuc 2.45	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O10 P2	CRYSTAL STRUCTURE OF E. COLI CASCADE BOUND TO A PAM-CONTAINI TARGET AT 2.45 ANGSTROM RESOLUTION. CRRNA (61-MER), CRISPR SYSTEM CASCADE SUBUNIT CASB, CRISPR SYSTEM CASCADE SUBUNIT CASC, CRISPR SYSTEM CASCADE SUBUNIT CASD, CRISPR SYSTEM CASCADE SUBUNIT CASA, CRISPR SYSTEM CASCADE SUBUNIT CASE, DNA (50-MER) TARGET, DNA (28-MER) NON-TARGET IMMUNE SYSTEM/RNA CRISPR CASCADE, IMMUNE SYSTEM-RNA COMPLEX

23T    2',3'-DIDEOXY-THYMIDINE-5'-TRIPHOSPHATE

Code	Class Resolution	Description
2hhw	prot-nuc 1.88	2',3'-DIDEOXY-THYMIDINE-5'-TRIPHOSPHATE 2(C10 H17 N2 O13 P3)	DDTTP:O6-METHYL-GUANINE PAIR IN THE POLYMERASE ACTIVE SITE, IN THE CLOSED CONFORMATION DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT), 5'-D(*CP*AP*TP*(6OG)P*CP*GP*AP*GP*TP*CP*AP*GP*G)- 3', 5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*(DDG))-3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, DNA- PROTEIN COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX

2AD    2'-AMINO-2'-DEOXYADENOSINE

Code	Class Resolution	Description
2bte	prot-nuc 2.90	2'-AMINO-2'-DEOXYADENOSINE 2(C10 H14 N6 O3)	THERMUS THERMOPHILUS LEUCYL-TRNA SYNTHETASE COMPLEXED WITH WITH A TRNALEU TRANSCRIPT IN THE POST-EDITING CONFORMATION AND A POST-TRANSFER EDITING SUBSTRATE ANALOGUE TRNALEU TRANSCRIPT WITH ANTICODON CAG, AMINOACYL-TRNA SYNTHETASE LIGASE LIGASE, CLASS I AMINOACYL-TRNA SYNTHETASE EDITING

2BA    (2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE

Code	Class Resolution	Description
3muv	prot-nuc 3.20	(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE C20 H24 N10 O12 P2	CRYSTAL STRUCTURE OF THE G20A/C92U MUTANT C-DI-GMP RIBOSWITH C-DI-AMP U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A: UNP RESIDUES 1-98, G20A/C92U MUTANT C-DI-GMP RIBOSWITCH RNA BINDING PROTEIN/RNA RNA, RIBOSWITCH, C-DI-AMP, C-DI-GMP, RNA BINDING PROTEIN-RNA
4w90	prot-nuc 3.12	(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE 2(C20 H24 N10 O12 P2)	CRYSTAL STRUCTURE OF BACILLUS SUBTILIS CYCLIC-DI-AMP RIBOSWI U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A, RIBOSWITCH A PSEUDO-DIMERIC RNA RNA BINDING PROTEIN/RNA RIBOSWITCH, CYCLIC-DI-AMP, PROTEIN-RNA COMPLEX, RNA BINDING RNA COMPLEX
4w92	prot-nuc 3.21	(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE 2(C20 H24 N10 O12 P2)	CRYSTAL STRUCTURE OF BACILLUS SUBTILIS CYCLIC-DI-AMP RIBOSWI C-DI-AMP RIBSOSWITCH, U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A: UNP RESIDUES 6-96 RNA BINDING PROTEIN/RNA RIBOSWITCH, CYCLIC-DI-AMP, PROTEIN-RNA COMPLEX, RNA BINDING RNA COMPLEX

2DA    2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1mq2	prot-nuc 3.10	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	HUMAN DNA POLYMERASE BETA COMPLEXED WITH GAPPED DNA CONTAINING AN 8-OXO-7,8-DIHYDRO-GUANINE AND DAMP DNA POLYMERASE BETA, 5'-D(*CP*CP*GP*AP*CP*(8OG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(2DA))-3' TRANSFERASE/DNA TRANSFERASE, DNA, TRANSFERASE/DNA COMPLEX
1qsy	prot-nuc 2.30	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	DDATP-TRAPPED CLOSED TERNARY COMPLEX OF THE LARGE FRAGMENT O POLYMERASE I FROM THERMUS AQUATICUS 5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DA))-3', 5'-D(*AP*TP*TP*GP*CP*GP*CP*CP*TP*P*GP*GP*TP*C)-3' CHAIN: C, DNA POLYMERASE I: KLENOW FRAGMENT TRANSFERASE/DNA PROTEIN-DNA COMPLEX, CLOSED, DDATP, POLYMERASE/DNA, TRANSFER COMPLEX
1r0a	prot-nuc 2.80	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTASE COVALENTLY TO DNA TEMPLATE-PRIMER SOLVED TO 2.8 ANGSTROMS MONOCLONAL ANTIBODY (HEAVY CHAIN): FAB 28, 5'-D(*A*TP*GP*CP*AP*TP*CP*GP*GP*CP*GP*CP*TP*CP*GP AP*GP*GP*GP*AP*CP*GP*GP*T)-3', REVERSE TRANSCRIPTASE: HIV-1 RT, 5'-D(*C*CP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*AP*GP CP*GP*(2DA))-3', REVERSE TRANSCRIPTASE: HIV-1 RT, MONOCLONAL ANTIBODY (LIGHT CHAIN): FAB 28 TRANSFERASE/IMMUNE SYSTEM/DNA HIV-1, TRANSFERASE, IMMUNE SYSTEM, DNA, TRANSFERASE-IMMUNE S COMPLEX
1skr	prot-nuc 2.40	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	T7 DNA POLYMERASE COMPLEXED TO DNA PRIMER/TEMPLATE AND DDATP 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*C*GP*GP*CP*CP*AP*GP*TP*GP*CP* CP*AP*(2DA))-3', THIOREDOXIN 1, DNA POLYMERASE, 5'- D(*CP*CP*CP*TP*TP*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP *GP*TP*TP*TP*TP*CP*G)-3' TRANSFERASE/ELECTRON TRANSPORT/DNA DNA POLYMERASE, UV-LESION, REPLICATION, OPEN, CLOSE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1sl1	prot-nuc 2.20	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	BINARY 5' COMPLEX OF T7 DNA POLYMERASE WITH A DNA PRIMER/TEMPLATE CONTAINING A CIS-SYN THYMINE DIMER ON THE TEMPLATE 5'-D(*CP*CP*C*(TTD) P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3', DNA POLYMERASE, THIOREDOXIN 1, 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*TP*(2DA))-3' TRANSFERASE/ELECTRON TRANSPORT/DNA DNA POLYMERASE, FIDELITY, LESION BYPASS, THYMINE DIMER, OPEN, CLOSE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1sl2	prot-nuc 2.30	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	TERNARY 5' COMPLEX OF T7 DNA POLYMERASE WITH A DNA PRIMER/TEMPLATE CONTAINING A CIS-SYN THYMINE DIMER ON THE TEMPLATE AND AN INCOMING NUCLEOTIDE 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*TP*(2DA))-3', THIOREDOXIN 1, 5'-D(*CP*CP*CP*(TTD) P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA DNA POLYMERASE, FIDELITY, LESION BYPASS, THYMINE DIMER, OPEN, CLOSE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1t7p	prot-nuc 2.20	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	T7 DNA POLYMERASE COMPLEXED TO DNA PRIMER/TEMPLATE,A NUCLEOSIDE TRIPHOSPHATE, AND ITS PROCESSIVITY FACTOR THIOREDOXIN PROTEIN (THIOREDOXIN), DNA (5'-D(P*GP*CP*CP*AP*GP*TP*GP*CP*CP*AP*2DA)- 3'), DNA (5'- D(P*CP*CP*TP*TP*GP*GP*CP*AP*CP*TP*GP*GP*C)-3'), PROTEIN (DNA POLYMERASE) TRANSFERASE/DNA T7 DNA POLYMERASE, DNA REPLICATION, NUCLEOTIDYL TRANSFERASE, SEQUENCING, THIOREDOXIN, PROCESSIVITY FACTOR, COMPLEX (HYDROLASE/ELECTRON TRANSPORT/DNA), TRANSFERASE/DNA COMPLEX
1tk8	prot-nuc 2.50	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	T7 DNA POLYMERASE TERNARY COMPLEX WITH 8 OXO GUANOSINE AND DAMP AT THE ELONGATION SITE THIOREDOXIN 1, 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*AP*(2DA))-3', 5'-D(*CP*CP*CP*AP*(8OG) P*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA 8-OXOGUANOSINE DNA POLYMERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
2pyl	prot-nuc 2.20	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	PHI29 DNA POLYMERASE COMPLEXED WITH PRIMER-TEMPLATE DNA AND INCOMING NUCLEOTIDE SUBSTRATES (TERNARY COMPLEX) 5'-D(CTGACGAATGTACA)-3', DNA POLYMERASE, 5'-D(GACTGCTTAC(2DA))-3' REPLICATION, TRANSFERASE/DNA PROTEIN-DNA COMPLEX, REPLICATION, TRANSFERASE/DNA COMPLEX
3gij	prot-nuc 2.40	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O5 P)	DPO4 EXTENSION TERNARY COMPLEX WITH OXOG(SYN)-A(ANTI) AND OX A(SYN) PAIRS 5'-D(*GP*TP*TP*GP*GP*AP*TP*GP*GP*TP*AP*GP*(2DA))- CHAIN: D, H5'-D(*CP*TP*AP*AP*CP*(8OG) P*CP*TP*AP*CP*CP*AP*TP*CP*CP*AP*AP*C)-3', DNA POLYMERASE IV TRANSFERASE/DNA DNA POLYMERASE, 8-OXOGUANINE, Y-FAMILY, LESION BYPASS, DNA D DNA REPAIR, DNA REPLICATION, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, METAL-BINDING, MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, TRANSFERASE-DNA COMPLE
3khg	prot-nuc 2.96	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	DPO4 EXTENSION TERNARY COMPLEX WITH MISINSERTED A OPPOSITE T AMINOFLUORENE-GUANINE [AF]G LESION DNA POLYMERASE IV, 5'-D(*GP*TP*TP*GP*GP*AP*TP*GP*GP*TP*AP*GP*(2DA))- CHAIN: D, H5'-D(*C*CP*TP*AP*AP*CP*GP*CP*TP*AP*CP*CP*AP*TP*CP CP*C)-3' TRANSFERASE/DNA LESION BYPASS, DNA POLYMERASE, Y-FAMILY POLYMERASE, 2-AMINOF SEMI-TARGETED MUTAGENESIS, DNA DAMAGE, DNA REPAIR, DNA REPL DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, METAL- MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, TRANS DNA COMPLEX
3kle	prot-nuc 3.20	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE 4(C10 H14 N5 O5 P)	CRYSTAL STRUCTURE OF AZT-RESISTANT HIV-1 REVERSE TRANSCRIPTA CROSSLINKED TO A DSDNA WITH A BOUND EXCISION PRODUCT, AZTPP P51 RT, DNA (25-MER), DNA (5'- D(*AP*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG) P*CP*GP*CP*CP*(2DA))-3'), REVERSE TRANSCRIPTASE/RIBONUCLEASE H TRANSFERASE/DNA AZT RESISTANCE MECHANISM, HIV-1, REVERSE TRANSCRIPTASE, RT, RESISTANCE MUTATIONS, P51/P66, NUCLEOSIDE INHIBITOR, NUCLEO EXCISION, THYMIDINE ANALOG MUTATIONS, AIDS, HIV, DNA POLYME NRTI, NRTI RESISTANCE, AZTPPPPA, AZTP4A, AZT ADENOSINE DINU TETRAPHOSPHATE, DNA-DIRECTED DNA POLYMERASE, ENDONUCLEASE, HYDROLASE, MAGNESIUM, METAL-BINDING, MULTIFUNCTIONAL ENZYME MYRISTATE, NUCLEASE, RNA-DIRECTED DNA POLYMERASE, TRANSFERA TRANSFERASE-DNA COMPLEX
3klf	prot-nuc 3.15	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE 4(C10 H14 N5 O5 P)	CRYSTAL STRUCTURE OF WILD-TYPE HIV-1 REVERSE TRANSCRIPTASE C TO A DSDNA WITH A BOUND EXCISION PRODUCT, AZTPPPPA P51 RT, DNA (5'- D(*AP*T*GP*CP*AP*TP*GP*GP*CP*GP*CP*CP*CP*GP*AP*AP*CP*AP*GP* P*TP*GP*TP*G)-3'), REVERSE TRANSCRIPTASE/RIBONUCLEASE H, DNA (5'- D(*A*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG) P*CP*GP*CP*CP*(2DA))-3') TRANSFERASE/DNA AZT RESISTANCE MECHANISM, HIV-1 REVERSE TRANSCRIPTASE, WILD- RESISTANCE MUTATIONS, P51/P66, NUCELEOSIDE INHIBITOR, THYMI ANALOG MUTATIONS, AIDS, HIV, DNA POLYMERASE, NRTI, NRTI RES AZT, AZTPPPPA, AZTP4A, DINUCLEOSIDE TETRAPHOSPHATE, DNA-DIR POLYMERASE, ENDONUCLEASE, HYDROLASE, MAGNESIUM, METAL-BINDI MULTIFUNCTIONAL ENZYME, NUCLEASE, RNA-DIRECTED DNA POLYMERA TRANSFERASE, TRANSFERASE-DNA COMPLEX
3lwl	prot-nuc 2.25	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	STRUCTURE OF KLENOW FRAGMENT OF TAQ POLYMERASE IN COMPLEX WI ABASIC SITE DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, UNP RESIDUES 293-832, DNA (5'-D(*AP*AP*AP*(3DR) P*TP*GP*CP*GP*CP*CP*GP*TP*GP*GP*TP*C)-3'), DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DA) CHAIN: B TRANSFERASE/DNA DNA REPLICATION, DNA REPAIR, DNA POLYMERASES, ABASIC SITES, TRANSLESION SYNTHESIS, DNA DAMAGE, DNA-BINDING, DNA-DIRECTE POLYMERASE, AMINO ACID-TEMPLATING MECHANISM, TRANSFERASE-DN
3lwm	prot-nuc 2.19	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	STRUCTURE OF THE LARGE FRAGMENT OF THERMUS AQUATICUS DNA POL IN COMPLEX WITH A BLUNT-ENDED DNA AND DDATP DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DA) CHAIN: B, DNA (5'-D(*TP*GP*CP*GP*CP*CP*GP*TP*GP*GP*TP*C)-3' CHAIN: C, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, UNP RESIDUES 293-832 TRANSFERASE/DNA DNA REPLICATION, DNA POLYMERASES, DNA-BINDING, DNA-DIRECTED POLYMERASE, AMINO ACID-TEMPLATING MECHANISM, NUCLEOTIDYLTRA TRANSFERASE, TRANSFERASE-DNA COMPLEX, BLUNT-ENDED DNA, TEMP INDEPENDENT DNA SYNTHESIS, TERMINAL DEOXYNUCLEOTIDYL TRANSF TEMPLATE-INDEPENDENT NUCLEOTIDE ADDITION
3os1	prot-nuc 2.97	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	PFV TARGET CAPTURE COMPLEX (TCC) AT 2.97 A RESOLUTION DNA (5'- D(*AP*TP*TP*GP*TP*CP*AP*TP*GP*GP*AP*AP*TP*TP*TP*CP*GP*CP*A) CHAIN: C, DNA (5'- D(*TP*GP*CP*GP*AP*AP*AP*TP*TP*CP*CP*AP*TP*GP*AP*CP*(2DA))-3 CHAIN: D, DNA (5'- D(*CP*CP*CP*GP*AP*GP*GP*CP*AP*CP*GP*TP*GP*CP*TP*AP*GP*CP*AP GP*CP*CP*TP*CP*GP*GP*G)-3'), INTEGRASE RECOMBINATION/DNA PROTEIN-DNA COMPLEX, TETRAMER, DNA INTEGRATION, ENDONUCLEASE BINDING, MULTIFUNCTIONAL ENZYME, NUCLEASE, NUCLEOTIDYLTRANS NUCLEUS, TRANSFERASE, VIRAL NUCLEOPROTEIN, VIRION, DNA-BIND BINDING, HHCC MOTIF, VIRAL PROTEIN, RECOMBINATION, RECOMBIN COMPLEX
3po4	prot-nuc 1.80	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	STRUCTURE OF A MUTANT OF THE LARGE FRAGMENT OF DNA POLYMERAS THERMUS AQUATICUS IN COMPLEX WITH A BLUNT-ENDED DNA AND DDA DNA POLYMERASE I: KLENOW FRAGMENT, DNA (5'-D(*TP*GP*CP*GP*CP*CP*GP*TP*GP*GP*TP*C)-3' CHAIN: C: DNA TEMPLATE, DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DA) CHAIN: B: DNA PRIMER TRANSFERASE/DNA DNA POLYMERASE, BLUNT-ENDED DNA, PROCESSING AN A-OVERHANG, D PRIMER/TEMPLATE DUPLEX, DDATP, TRANSFERASE-DNA COMPLEX
3po5	prot-nuc 2.39	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	STRUCTURE OF A MUTANT OF THE LARGE FRAGMENT OF DNA POLYMERAS THERMUS AUQATICUS IN COMPLEX WITH AN ABASIC SITE AND DDATP DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DA) CHAIN: B: DNA PRIMER, DNA (5'-D(P*(3DR)P*TP*GP*CP*GP*CP*CP*GP*TP*GP*GP* CHAIN: C: DNA TEMPLATE, DNA POLYMERASE I: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, LESION BYPASS, APSITE, ABASIC SITE, TRANSFER COMPLEX
3rb6	prot-nuc 2.70	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O5 P)	DPO4 EXTENSION TERNARY COMPLEX WITH 3'-TERMINAL PRIMER A BAS THE 3-METHYLCYTOSINE (M3C) LESION DNA (5'-D(*GP*TP*TP*GP*GP*AP*TP*GP*GP*TP*AP*GP*(2 CHAIN: D, HDNA (5'-D(*C*CP*TP*AP*AP*CP*(ME6) P*CP*TP*AP*CP*CP*AP*TP*CP*CP*AP*AP*CP*C)-3'), DNA POLYMERASE IV TRANSFERASE/DNA DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA-BINDING, DNA-DI DNA POLYMERASE, MAGNESIUM, METAL-BINDING, MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, TRANSFERASE-DNA COMPLE BYPASS, DNA POLYMERASE, Y-FAMILY POLYMERASE, METAL-BINDING; BINDING, 3-METHYLCYTOSINE
3sq2	prot-nuc 2.10	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DTTP OPPOSITE 2AP ( SEQUENCE) 5'-D(*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP*TP*TP*(2DA))- CHAIN: P, 5'-D(P*CP*(2PR)P*TP*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP 3', DNA POLYMERASE TRANSFERASE/DNA 2-AMINOPURINE, AT RICH, TRANSFERASE-DNA COMPLEX
3sq4	prot-nuc 2.23	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DTTP OPPOSITE 2AP ( SEQUENCE) 5'-D(*CP*GP*CP*GP*CP*GP*GP*CP*GP*GP*CP*GP*(2DA))- CHAIN: P, 5'-D(P*CP*(2PR)P*TP*CP*GP*CP*CP*GP*CP*CP*GP*CP*GP 3', DNA POLYMERASE TRANSFERASE/DNA 2-AMINOPURINE, GC RICH, TRANSFERASE-DNA COMPLEX
3sun	prot-nuc 2.42	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	RB69 DNA POLYMERASE (Y567A) TERNARY COMPLEX WITH DTTP OPPOSI RICH SEQUENCE) 5'-D(*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP*TP*TP*(2DA))- CHAIN: P, 5'-D(P*CP*(2PR)P*TP*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP 3', DNA POLYMERASE TRANSFERASE/DNA 2-AMINOPURINE, AT RICH, RB69POL, TRANSFERASE-DNA COMPLEX
3suo	prot-nuc 2.23	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	RB69 DNA POLYMERASE (Y567A) TERNARY COMPLEX WITH DTTP OPPOSI RICH SEQUENCE) DNA POLYMERASE, 5'-D(*CP*GP*CP*GP*CP*GP*GP*CP*GP*GP*CP*GP*(2DA))- CHAIN: P, 5'-D(P*CP*(2PR)P*TP*CP*GP*CP*CP*GP*CP*CP*GP*CP*GP 3' TRANSFERASE/DNA 2-AMINOPURINE, GC RICH, RB69POL, TRANSFERASE-DNA COMPLEX
3sup	prot-nuc 2.32	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	RB69 DNA POLYMERASE (Y567A) TERNARY COMPLEX WITH DCTP OPPOSI RICH SEQUENCE) DNA POLYMERASE, 5'-D(P*CP*(2PR)P*TP*CP*GP*CP*CP*GP*CP*CP*GP*CP*GP 3', 5'-D(*CP*GP*CP*GP*CP*GP*GP*CP*GP*GP*CP*GP*(2DA))- CHAIN: P TRANSFERASE/DNA 2-AMINOPURINE, GC RICH, RB69POL, TRANSFERASE-DNA COMPLEX
3suq	prot-nuc 3.15	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	RB69 DNA POLYMERASE (Y567A) TERNARY COMPLEX WITH DCTP OPPOSI RICH SEQUENCE) 5'-D(P*CP*(2PR)P*TP*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP 3', 5'-D(*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP*TP*TP*(2DA))- CHAIN: P, DNA POLYMERASE TRANSFERASE/DNA 2-AMINOPURINE, AT RICH, DCTP, RB69POL, Y567A, TRANSFERASE-DN
3thv	prot-nuc 1.61	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O5 P)	CRYSTAL STRUCTURE OF BACILLUS DNA POLYMERASE I LARGE FRAGMEN DNA AND DDATP-DT IN CLOSED CONFORMATION 5'-D(*C*AP*TP*TP*TP*GP*AP*GP*TP*CP*AP*GP*G)-3', 5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*(2DA))-3', DNA POLYMERASE I: BACILLUS FRAGMENT (UNP RESIDUES 285-876) TRANSFERASE/DNA DNA POLYMERASE I, PROTEIN-DNA COMPLEX, TRANSFERASE-DNA COMPL
4k8z	prot-nuc 2.29	2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O5 P	KOD POLYMERASE IN BINARY COMPLEX WITH DSDNA DNA POLYMERASE, DNA (5'-D(*AP*AP*AP*TP*TP*CP*GP*CP*AP*GP*TP*TP*CP 3'), DNA (5'-D(*CP*GP*CP*GP*AP*AP*CP*TP*GP*CP*GP*(2DA) CHAIN: P TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

2DT    3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1qtm	prot-nuc 2.30	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	DDTTP-TRAPPED CLOSED TERNARY COMPLEX OF THE LARGE FRAGMENT OF DNA POLYMERASE I FROM THERMUS AQUATICUS 5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DT))-3', 5'-D(*AP*AP*AP*GP*CP*GP*CP*CP*GP*TP*GP*GP*TP*C)- 3', DNA POLYMERASE I: KLENOW FRAGMENT, RESIDUES 293-831 TRANSFERASE/DNA PROTEIN-DNA COMPLEX, CLOSED, DDTTP, POLYMERASE/DNA, TRANSFERASE/DNA COMPLEX
1sks	prot-nuc 2.30	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	BINARY 3' COMPLEX OF T7 DNA POLYMERASE WITH A DNA PRIMER/TEMPLATE CONTAINING A CIS-SYN THYMINE DIMER ON THE TEMPLATE DNA POLYMERASE, 5'-D(*CP*CP*CP*(TTD) P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3', THIOREDOXIN 1, 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*C*GP*GP*CP*CP*AP*GP*TP*GP*CP* CP*(2DT))-3' TRANSFERASE/ELECTRON TRANSPORT/DNA DNA POLYMERASE, LESION BYPASS, FIDELITY, OPEN, CLOSE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1skw	prot-nuc 2.30	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	BINARY 3' COMPLEX OF T7 DNA POLYMERASE WITH A DNA PRIMER/TEMPLATE CONTAINING A DISORDERED CIS-SYN THYMINE DIMER ON THE TEMPLATE THIOREDOXIN 1, 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*C*GP*GP*CP*CP*AP*GP*TP*GP*CP* CP*(2DT))-3', DNA POLYMERASE, 5'-D(*CP*CP*CP*(TTD) P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3' TRANSFERASE/ELECTRON TRANSPORT/DNA DNA POLYMERASE, FIDELITY, LESION BYPASS, THYMINE DIMER, OPEN, CLOSE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1sl0	prot-nuc 3.20	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	TERNARY 3' COMPLEX OF T7 DNA POLYMERASE WITH A DNA PRIMER/TEMPLATE CONTAINING A DISORDERED CIS-SYN THYMINE DIMER ON THE TEMPLATE AND AN INCOMING NUCLEOTIDE DNA POLYMERASE, 5'-D(*CP*CP*CP*(TTD) P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3', THIOREDOXIN 1, 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*(2DT))-3' TRANSFERASE/ELECTRON TRANSPORT/DNA DNA POLYMERASE, FIDELITY, LESION BYPASS, THYMINE DIMER, OPEN, CLOSE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1t8e	prot-nuc 2.54	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	T7 DNA POLYMERASE TERNARY COMPLEX WITH DCTP AT THE INSERTION SITE. THIOREDOXIN 1, 5'- D(P*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*C P*CP*AP*(2DT))-3', DNA POLYMERASE, 25-MER TRANSFERASE/ELECTRON TRANSPORT/DNA PROTEIN, DNA, TRANSFERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1x9m	prot-nuc 2.10	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	T7 DNA POLYMERASE IN COMPLEX WITH AN N-2- ACETYLAMINOFLUORENE-ADDUCTED DNA 5'- D(*GP*GP*AP*GP*AP*GP*TP*GP*AP*TP*TP*GP*GP*TP*AP*GP*TP*GP*TP *GP*AP*(2DT))-3', THIOREDOXIN 1, 5'-D(*CP*CP*CP*(8FG) P*AP*TP*CP*AP*CP*AP*CP*TP*AP*CP*CP*AP*AP*TP*CP*AP*CP*TP*CP* TP*CP*C)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA DNA PLOYMERASE, N-2-ACETYLAMINOFLUORENE, REPLICATION BLOCK, MUTAGENESIS, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1x9s	prot-nuc 2.70	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	T7 DNA POLYMERASE IN COMPLEX WITH A PRIMER/TEMPLATE DNA CONTAINING A DISORDERED N-2 AMINOFLUORENE ON THE TEMPLATE, CRYSTALLIZED WITH DIDEOXY-CTP AS THE INCOMING NUCLEOTIDE. 5'- D(*GP*GP*AP*GP*AP*GP*TP*GP*AP*TP*T*GP*GP*TP*AP*GP*TP*GP*TP* GP*AP*(2DT))-3', THIOREDOXIN 1, 5'-D(*CP*CP*CP*(AFG) P*AP*TP*CP*AP*CP*AP*CP*TP*AP*CP*CP*AP*AP*TP*CP*AP*CP*TP*CP* TP*CP*C)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA DNA POLYMERASE, N-2-AMINOFLUORENE, MUTAGENESIS, REPLICATION BLOCK, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1x9w	prot-nuc 2.30	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	T7 DNA POLYMERASE IN COMPLEX WITH A PRIMER/TEMPLATE DNA CONTAINING A DISORDERED N-2 AMINOFLUORENE ON THE TEMPLATE, CRYSTALLIZED WITH DIDEOXY-ATP AS THE INCOMING NUCLEOTIDE. 5'-D(*CP*CP*CP*(AFG) *AP*TP*CP*AP*CP*AP*CP*TP*AP*CP*CP*AP*AP*TP*CP*AP*CP*TP*CP*T P*CP*C)-3', DNA POLYMERASE, 5'- D(*GP*GP*AP*GP*AP*GP*TP*GP*AP*TP*T*GP*GP*T*AP*GP*TP*GP*TP*G P*AP*(2DT))-3', THIOREDOXIN 1 TRANSFERASE/ELECTRON TRANSPORT/DNA DNA POLYMERASE, N-2-AMINOFLUORENE, MUTAGENESIS, REPLICATION BLOCK, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1xsn	prot-nuc 1.95	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE LAMBDA IN COMPLEX WITH A ONE NUCLEOTIDE DNA GAP AND DDTTP DNA POLYMERASE LAMBDA: 39 KDA CATALYTIC C-TERMINAL DOMAIN, 5'-D(*CP*GP*GP*CP*AP*AP*TP*AP*CP*TP*G)-3', 5'-D(*CP*AP*GP*TP*AP*(2DT))-3', 5'-D(P*GP*CP*CP*G)-3' TRANSFERASE/DNA DNA POLYMERASE LAMBDA, PROTEIN-DNA COMPLEX, HELIX-HAIRPIN- HELIX, TRANSFERASE/DNA COMPLEX
2ajq	prot-nuc 2.60	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	STRUCTURE OF REPLICATIVE DNA POLYMERASE PROVIDES INSIGTS INTO THE MECHANISMS FOR PROCESSIVITY, FRAMESHIFTING AND EDITING THIOREDOXIN 1, DNA PRIMER, DNA TEMPLATE, T7 DNA POLYMERASE TRANSFERASE,TRANSCRIPTION/DNA POLYMERASE T7; X-RAY CRYSTALLOGRAPHY; TERNARY COMPLEX, TRANSFERASE, TRANSCRIPTION/DNA COMPLEX, TRANSFERASE, TRANSCRIPTION/DNA COMPLEX
3bdp	prot-nuc 1.90	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	DNA POLYMERASE I/DNA COMPLEX DNA (5'-D(*AP*GP*CP*AP*TP*CP*AP*TP*GP*C)-3'), PROTEIN (DNA POLYMERASE I): RESIDUES 297-876, DNA (5'-D(*GP*CP*AP*TP*GP*AP*TP*GP*CP*2DT)-3') TRANSFERASE/DNA BACILLUS STEAROTHERMOPHILUS DNA POLYMERASE, BF THERMOPHILUS POLYMERASE, COMPLEX (NUCLEOTIDYLTRANSFERASE/DNA)
3c5g	prot-nuc 2.20	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	STRUCTURE OF A TERNARY COMPLEX OF THE R517K POL LAMBDA MUTANT DNA (5'-D(*DCP*DAP*DGP*DTP*DAP*(2DT))-3'), DNA (5'- D(*DCP*DGP*DGP*DCP*DAP*DAP*DTP*DAP*DCP*DTP*DG)-3'), DNA POLYMERASE LAMBDA: DNA BINDING REGION, DNA (5'-D(P*DGP*DCP*DCP*DG)-3') TRANSFERASE/DNA, LYASE/DNA HELIX-HAIRPIN-HELIX, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA SYNTHESIS, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, LYASE, MANGANESE, METAL-BINDING, NUCLEOTIDYLTRANSFERASE, NUCLEUS, PHOSPHOPROTEIN, POLYMORPHISM, TRANSFERASE, TRANSFERASE/DNA, LYASE/DNA COMPLEX
3gil	prot-nuc 2.71	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	DPO4 EXTENSION TERNARY COMPLEX WITH OXOG(ANTI)-T(ANTI) PAIR 5'-D(*GP*TP*TP*GP*GP*AP*TP*GP*GP*TP*AP*GP*(2DT))- CHAIN: D, H5'-D(*CP*TP*AP*AP*CP*(8OG) P*CP*TP*AP*CP*CP*AP*TP*CP*CP*AP*AP*C)-3', DNA POLYMERASE IV TRANSFERASE/DNA DNA POLYMERASE, 8-OXOGUANINE, Y-FAMILY, LESION BYPASS, DNA D DNA REPAIR, DNA REPLICATION, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, METAL-BINDING, MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, TRANSFERASE-DNA COMPLE
3hwt	prot-nuc 1.95	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	TERNARY COMPLEX OF DNA POLYMERASE LAMBDA BOUND TO A TWO NUCL GAPPED DNA SUBSTRATE WITH A SCRUNCHED DA 5'-D(*CP*GP*GP*CP*AP*AP*AP*TP*AP*CP*TP*G)-3', 5'-D(*CP*AP*GP*TP*AP*(2DT))-3', 5'-D(P*GP*CP*CP*G)-3', DNA POLYMERASE LAMBDA: UNP RESIDUES 242-575 TRANSFERASE/DNA HELIX-HAIRPIN-HELIX, DNA DAMAGE, DNA REPAIR, DNA REPLICATION SYNTHESIS, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, LYASE, MANGANESE, METAL-BINDING, NUCLEOTIDYLTRANSFERASE, NUCLEUS, PHOSPHOPROTEIN, TRANSFERASE, TRANSFERASE-DNA COMPLEX
3pv8	prot-nuc 1.52	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	CRYSTAL STRUCTURE OF BACILLUS DNA POLYMERASE I LARGE FRAGMEN DNA AND DDTTP-DA IN CLOSED CONFORMATION DNA (5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*(2DT))-3'): DNA PRIMER STRAND, DNA (5'-D(*C*AP*TP*AP*AP*GP*AP*GP*TP*CP*AP*GP*G)- CHAIN: C, F: DNA TEMPLATE STRAND, DNA POLYMERASE I: BACILLUS FRAGMENT (ANALOGOUS TO E. COLI KLENOW FR EC: 2.7.7.7 TRANSFERASE/DNA DNA POLYMERASE I, PROTEIN-DNA COMPLEX, THYMINE-ADENINE, CLOS CONFORMATION, TRANSFERASE-DNA COMPLEX
3rax	prot-nuc 1.89	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	DPO4 EXTENSION TERNARY COMPLEX WITH 3'-TERMINAL PRIMER T BAS THE 1-METHYLGUANINE (M1G) LESION DNA (5'-D(*GP*TP*TP*GP*GP*AP*TP*GP*GP*TP*AP*GP*(2 CHAIN: D, HDNA (5'-D(*CP*CP*TP*AP*AP*CP*(MG1) P*CP*TP*AP*CP*CP*AP*TP*CP*CP*AP*AP*CP*C)-3'), DNA POLYMERASE IV TRANSFERASE/DNA DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA-BINDING, DNA-DI DNA POLYMERASE, MAGNESIUM, METAL-BINDING, MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, TRANSFERASE-DNA COMPLE BYPASS, DNA POLYMERASE, Y-FAMILY POLYMERASE, DNTP BINDING, METHYLGUANINE
3rbe	prot-nuc 2.80	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	DPO4 EXTENSION TERNARY COMPLEX WITH 3'-TERMINAL PRIMER T BAS THE 3-METHYLCYTOSINE (M3C) LESION DNA POLYMERASE IV, DNA (5'-D(*GP*TP*TP*GP*GP*AP*TP*GP*GP*TP*AP*GP*(2 CHAIN: D, HDNA (5'-D(*C*CP*TP*AP*AP*CP*(ME6) P*CP*TP*AP*CP*CP*AP*TP*CP*CP*AP*AP*CP*C)-3') TRANSFERASE/DNA DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA-BINDING, DNA-DI DNA POLYMERASE, MAGNESIUM, METAL-BINDING, MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, TRANSFERASE-DNA COMPLE BYPASS, DNA POLYMERASE, Y-FAMILY POLYMERASE, DNTP-BINDING, METHYLCYTOSINE
3rrh	prot-nuc 1.80	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	TERNARY STRUCTURE OF THE LARGE FRAGMENT OF TAQ DNA POLYMERAS AN ABASIC SITE AND A DDTTP (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DT))-3' CHAIN: B: DNA PRIMER, (5'-D(*AP*AP*AP*(3DR)P*AP*GP*CP*GP*CP*CP*GP*TP*GP 3'): DNA TEMPLATE, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, TRANSLESION SYNTHESIS, A-RULE, TRANSFERASE-DNA COMPLEX
3v6k	prot-nuc 3.60	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	REPLICATION OF N2,3-ETHENOGUANINE BY DNA POLYMERASES DNA (5'-D(P*GP*AP*AP*GP*GP*AP*TP*TP*CP*(2DT))-3') CHAIN: P, K, DNA (5'-D(*TP*CP*AP*CP*(EFG)P*GP*AP*AP*TP*CP*CP*T 3'), DNA POLYMERASE IV TRANSFERASE/DNA SULFOLOBUS SOLFATARICUS DNA POLYMERASE IV, DPO4, ETHENOGUANI ADDUCT, DNA LESION, DNA POLYMERASE, DNA REPLICATION, LESION 2'-FLUORO ARABINOSE, N2,3-ETHENOGUANINE, TRANSFERASE-DNA CO
4du1	prot-nuc 2.15	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DATP OPPOSITE DT DNA POLYMERASE, DNA PRIMER, DNA TEMPLATE TRANSFERASE/DNA DATP/DT, TRANSFERASE-DNA COMPLEX
4du3	prot-nuc 2.02	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DDTP OPPOSITE DT WI DEAZA-ADENINE AT THE N-1 POSITION OF TEMPLATE STRAND DNA POLYMERASE, DNA TEMPLATE, DNA PRIMER TRANSFERASE/DNA DATP, 3-DEAZAADENINE, TRANSFERASE-DNA COMPLEX
4ez9	prot-nuc 1.64	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	BACILLUS DNA POLYMERASE I LARGE FRAGMENT COMPLEX 2 DNA (5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*(2DT))-3'), DNA (5'-D(*CP*AP*TP*TP*AP*GP*AP*GP*TP*CP*AP*GP*G) CHAIN: C, F, DNA POLYMERASE: BACILLUS FRAGMENT (ANALOGOUS TO E. COLI KLENOW FR UNP RESIDUES 287-878) TRANSFERASE/DNA DNA POLYMERASE I, PROTEIN-DNA COMPLEX, CLOSED FORM, TRANSFER COMPLEX
4f3o	prot-nuc 1.57	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	DNA POLYMERASE I LARGE FRAGMENT COMPLEX 5 DNA (5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*(2DT))-3'), DNA (5'-D(*C*AP*TP*GP*AP*GP*AP*GP*TP*CP*AP*GP*G)- CHAIN: C, F, DNA POLYMERASE: UNP RESIDUES 287-878 TRANSFERASE/DNA DNA POLYMERASE I, PROTEIN-DNA COMPLEX, CLOSED FORM, TRANSFER COMPLEX
4i27	prot-nuc 2.60	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O7 P	TERNARY COMPLEX OF MOUSE TDT WITH SSDNA AND INCOMING NUCLEOT DNA NUCLEOTIDYLEXOTRANSFERASE: SEE REMARK 999, 5'-D(*AP*AP*AP*AP*AP*T)-3' TRANSFERASE/DNA TERMINAL TRANSFERASE, TRANSFERASE-DNA COMPLEX
4yfu	prot-nuc 1.50	3'-DEOXYTHYMIDINE-5'-MONOPHOSPHATE 2(C10 H15 N2 O7 P)	CRYSTAL STRUCTURE OF OPEN BACILLUS FRAGMENT DNA POLYMERASE B DNA AND DTTP TEMPLATE DNA: TEMPLATE DNA OLIGONUCLEOTIDE, PRIMER DNA: PRIMER DNA OLIGONUCLEOTIDE, DNA POLYMERASE TRANSFERASE/DNA PROTEIN-DNA COMPLEX, TRANSFERASE-DNA COMPLEX

2EG    2'-DEOXY-N-ETHYLGUANOSINE 5'-PHOSPHATE

Code	Class Resolution	Description
3epg	prot-nuc 2.50	2'-DEOXY-N-ETHYLGUANOSINE 5'-PHOSPHATE C12 H18 N5 O7 P	STRUCTURE OF HUMAN DNA POLYMERASE IOTA COMPLEXED WITH N2-ETH 5'-D(*DTP*DCP*DTP*(2EG) P*DGP*DGP*DGP*DTP*DCP*DCP*DTP*DAP*DGP*DGP*DAP*DCP*DCP*(DOC) CHAIN: B, C, DNA POLYMERASE IOTA: CATALYTIC FRAGMENT (UNP RESIDUES 1-420) TRANSFERASE/DNA DNA POL IOTA, LESION BYPASS, N2-ETHYLGUANINE, DNA DAMAGE, DN DNA REPLICATION, DNA SYNTHESIS, DNA-BINDING, DNA-DIRECTED D POLYMERASE, MAGNESIUM, METAL-BINDING, MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, NUCLEUS, SCHIFF BASE, TRANSFERASE, TRANSFERASE-DNA COMPLEX
3epi	prot-nuc 2.90	2'-DEOXY-N-ETHYLGUANOSINE 5'-PHOSPHATE C12 H18 N5 O7 P	STRUCTURE OF HUMAN DNA POLYMERASE IOTA COMPLEXED WITH N2-ETH AND INCOMING TTP DNA POLYMERASE IOTA: CATALYTIC FRAGMENT (UNP RESIDUES 1-420), 5'-D(*DTP*DCP*DTP*(2EG) P*DGP*DGP*DGP*DTP*DCP*DCP*DTP*DAP*DGP*DGP*DAP*DCP*DCP*(DOC) CHAIN: B, C TRANSFERASE/DNA DNA POL IOTA, LESION BYPASS, N2-ETHYLGUANINE, DNA DAMAGE, DN DNA REPLICATION, DNA SYNTHESIS, DNA-BINDING, DNA-DIRECTED D POLYMERASE, MAGNESIUM, METAL-BINDING, MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, NUCLEUS, SCHIFF BASE, TRANSFERASE, TRANSFERASE-DNA COMPLEX

2FE    2'-FLUORO-2'-DEOXY-1,N6-ETHENOADENINE

Code	Class Resolution	Description
3cwu	prot-nuc 2.80	2'-FLUORO-2'-DEOXY-1,N6-ETHENOADENINE 2(C12 H13 F N5 O6 P)	CRYSTAL STRUCTURE OF AN ALKA HOST/GUEST COMPLEX 2'-FLUORO- 2'-DEOXY-1,N6-ETHENOADENINE:THYMINE BASE PAIR DNA-3-METHYLADENINE GLYCOSYLASE 2, DNA (5'-D(*DGP*DAP*DCP*DAP*DTP*DGP*DAP*(2FE) P*DTP*DGP*DCP*DC)-3'), DNA (5'- D(*DGP*DGP*DCP*DAP*DTP*DTP*DCP*DAP*DTP*DGP*DTP*DC)-3') HYDROLASE/DNA ALKA, 2'-FLUORO-2'-DEOXY-1, N6-ETHENOADENINE, DNA REPAIR, HOST/GUEST COMPLEX, DNA STRUCTURE, DNA DAMAGE, HYDROLASE, HYDROLASE/DNA COMPLEX

2FI    2'-FLUORO-2'-DEOXYINOSINE

Code	Class Resolution	Description
3cws	prot-nuc 2.30	2'-FLUORO-2'-DEOXYINOSINE 2(C10 H12 F N4 O7 P)	CRYSTAL STRUCTURE OF AN ALKA HOST/GUEST COMPLEX 2'-FLUORO- 2'-DEOXYINOSINE:THYMINE BASE PAIR DNA-3-METHYLADENINE GLYCOSYLASE 2, DNA (5'-D(*DGP*DAP*DCP*DAP*DTP*DGP*DAP*(2FI) P*DTP*DGP*DCP*DC)-3'), DNA (5'- D(*DGP*DGP*DCP*DAP*DTP*DTP*DCP*DAP*DTP*DGP*DTP*DC)-3') HYDROLASE/DNA ALKA, 2'-FLUORO-2'-DEOXYINOSINE, DNA REPAIR, HOST/GUEST COMPLEX, DNA STRUCTURE, DNA DAMAGE, HYDROLASE, HYDROLASE/DNA COMPLEX
3cwt	prot-nuc 2.30	2'-FLUORO-2'-DEOXYINOSINE 2(C10 H12 F N4 O7 P)	CRYSTAL STRUCTURE OF AN ALKA HOST/GUEST COMPLEX 2'-FLUORO- 2'-DEOXYINOSINE:ADENINE BASE PAIR DNA (5'-D(*DGP*DAP*DCP*DAP*DTP*DGP*DAP*(2FI) P*DTP*DGP*DCP*DC)-3'), DNA (5'- D(*DGP*DGP*DCP*DAP*DAP*DTP*DCP*DAP*DTP*DGP*DTP*DC)-3'), DNA-3-METHYLADENINE GLYCOSYLASE 2 HYDROLASE/DNA ALKA, 2'-FLUORO-2'-DEOXYINOSINE, DNA REPAIR, HOST/GUEST COMPLEX, DNA STRUCTURE, DNA DAMAGE, HYDROLASE, HYDROLASE/DNA COMPLEX

2HP    DIHYDROGENPHOSPHATE ION

Code	Class Resolution	Description
2ddg	prot-nuc 2.10	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	CRYSTAL STRUCTURE OF URACIL-DNA GLYCOSYLASE IN COMPLEX WITH CONTAINING DNA 5'-D(*GP*GP*AP*CP*TP*AP*AP*GP*GP*CP*AP*AP*CP*A)-3 CHAIN: D, URACIL-DNA GLYCOSYLASE, 5'-D(*AP*TP*GP*TP*TP*GP*CP*(D1P)P*TP*TP*AP*GP*TP* CHAIN: C HYDROLASE/DNA BASE EXCISION REPAIR, URACIL-DNA GLYCOSYLASE, IRON/SULFER CL DNA COMPLEX, THERMOPHILE, STRUCTURAL GENOMICS, NPPSFA, NATI PROJECT ON PROTEIN STRUCTURAL AND FUNCTIONAL ANALYSES, RIKE STRUCTURAL GENOMICS/PROTEOMICS INITIATIVE, RSGI, HYDROLASE- COMPLEX
2dem	prot-nuc 1.95	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	CRYSTAL STRUCTURE OF URACIL-DNA GLYCOSYLASE IN COMPLEX WITH CONTAINING DNA URACIL-DNA GLYCOSYLASE, 5'-D(*GP*GP*AP*CP*TP*AP*AP*AP*GP*CP*AP*AP*CP*A)-3 CHAIN: D, 5'-D(*AP*TP*GP*TP*TP*GP*CP*(D1P)P*TP*TP*AP*GP*TP* CHAIN: C HYDROLASE/DNA BASE EXCISION REPAIR, URACIL-DNA GLYCOSYLASE, IRON/SULFUR CL THERMOPHILE, STRUCTURAL GENOMICS, NPPSFA, NATIONAL PROJECT PROTEIN STRUCTURAL AND FUNCTIONAL ANALYSES, RIKEN STRUCTURA GENOMICS/PROTEOMICS INITIATIVE, RSGI, HYDROLASE-DNA COMPLEX
2dp6	prot-nuc 1.80	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	CRYSTAL STRUCTURE OF URACIL-DNA GLYCOSYLASE IN COMPLEX WITH CONTAINING DNA 5'-D(*GP*GP*AP*CP*TP*AP*AP*CP*GP*CP*AP*AP*CP*A)-3 CHAIN: D, URACIL-DNA GLYCOSYLASE, 5'-D(*AP*TP*GP*TP*TP*GP*CP*(D1P)P*TP*TP*AP*GP*TP* CHAIN: C HYDROLASE/DNA BASE EXCISION REPAIR, URACIL-DNA GLYCOSYLASE, IRON/SULFER CL DNA COMPLEX, THERMOPHILE, STRUCTURAL GENOMICS, NPPSFA, NATI PROJECT ON PROTEIN STRUCTURAL AND FUNCTIONAL ANALYSES, RIKE STRUCTURAL GENOMICS/PROTEOMICS INITIATIVE, RSGI, HYDROLASE- COMPLEX
3c46	prot-nuc 2.00	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	X-RAY CRYSTAL STRUCTURE OF THE N4 MINI-VRNAP P2_7A PROMOTER COMPLEX SOAKED WITH MGCL2 VIRION RNA POLYMERASE: RESIDUES 998-2102, P2_7A PROMOTER DNA TRANSFERASE/DNA PROTEIN-DNA COMPLEX, NUCLEOTIDYLTRANSFERASE, PROMOTER BINARY COMPLEX, DNA-HAIRPIN, VIRION RNA POLYMERASE, PHOSPHATE ION, TRANSFERASE/DNA COMPLEX
3q22	prot-nuc 2.11	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	X-RAY CRYSTAL STRUCTURE OF THE N4 MINI-VRNAP AND P2_7A PROMO TRANSCRIPTION INITIATION COMPLEX WITH GTP AND MAGNESIUM: SU COMPLEX I DNA (5'- D(*TP*GP*CP*CP*TP*CP*CP*CP*AP*GP*GP*CP*AP*TP*CP*CP*AP*AP*AP AP*GP*CP*GP*GP*AP*GP*CP*TP*TP*CP*TP*TP*C)-3'), VIRION RNA POLYMERASE TRANSFERASE/DNA PROTEIN-DNA COMPLEX, TWO-METAL CATALYSIS, DE NOVO TRANSCRIPT INITIATION, NUCLEOTIDYLTRANSFERASE, INITIATION COMPLEX, DNA VIRION RNA POLYMERASE, PHOSPHATE ION, TRANSFERASE-DNA COMPL POLYMERASE
3q23	prot-nuc 1.80	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	X-RAY CRYSTAL STRUCTURE OF THE N4 MINI-VRNAP AND P2_7A PROMO TRANSCRIPTION INITIATION COMPLEX WITH GMPCPP AND MANGANESE: COMPLEX II DNA (5'- D(*TP*GP*CP*CP*TP*CP*CP*CP*AP*GP*GP*CP*AP*TP*CP*CP*AP*AP*AP AP*GP*CP*GP*GP*AP*GP*CP*TP*TP*CP*TP*TP*C)-3'), VIRION RNA POLYMERASE TRANSFERASE/DNA PROTEIN-DNA COMPLEX, TWO-METAL CATALYSIS, GMPCPP, GPCPP, DE TRANSCRIPTION INITIATION, NUCLEOTIDYLTRANSFERASE, INITIATIO COMPLEX, DNA-HAIRPIN, VIRION RNA POLYMERASE, PHOSPHATE ION, POLYMERASE, TRANSFERASE-DNA COMPLEX
3q24	prot-nuc 1.81	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	X-RAY CRYSTAL STRUCTURE OF THE N4 MINI-VRNAP AND P2_7A PROMO TRANSCRIPTION INITIATION COMPLEX WITH PPPGPG AND PYROPHOSPH PRODUCT COMPLEX DNA (5'- D(*TP*GP*CP*CP*TP*CP*CP*CP*AP*GP*GP*CP*AP*TP*CP*CP*AP*AP*AP AP*GP*CP*GP*GP*AP*GP*CP*TP*TP*CP*TP*TP*C)-3'), VIRION RNA POLYMERASE TRANSFERASE/DNA/RNA PROTEIN-DNA COMPLEX, TWO-METAL CATALYSIS, DE NOVO TRANSCRIPT INITIATION, NUCLEOTIDYLTRANSFERASE, INITIATION COMPLEX, DNA VIRION RNA POLYMERASE, TRANSFERASE-DNA-RNA COMPLEX
4c4w	prot-nuc 2.95	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	STRUCTURE OF A RARE, NON-STANDARD SEQUENCE K-TURN BOUND BY L7AE PROTEIN U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A: RRM 1 DOMAIN, RESIDUES 1-102, 50S RIBOSOMAL PROTEIN L7AE, TSKT-23: KINK TURN MOTIF, RESIDUES 1-35 RNA BINDING PROTEIN/RNA RNA BINDING PROTEIN-RNA COMPLEX, RNA BINDING PROTEIN, KINK T

2IA    2'-DEOXY-2'-IODOADENOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
3s2h	prot-nuc 3.30	2'-DEOXY-2'-IODOADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C10 H13 I N5 O6 P	RNA POLYMERASE II INITIATION COMPLEX WITH A 6-NT RNA CONTAIN 2[PRIME]-IODO ATP DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB9, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: H, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: E, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB1, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: J, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB3, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB11, DNA (5'- D(*CP*TP*AP*CP*CP*GP*AP*TP*AP*AP*GP*CP*AP*GP*AP*CP*GP*AP*TP CP*TP*CP*GP*AP*TP*G)-3'), DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB2, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: LRNA (5'-R(*AP*GP*AP*GP*GP*(2IA))-3'), DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: F TRANSCRIPTION/RNA/DNA RNA POLYMERASE II, INITIATION COMPLEX, TRANSCRIPTION-RNA-DNA

2JU    2'-DEOXY-5-[(NAPHTHALEN-1-YLMETHYL)CARBAMOYL]URIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
4ni7	prot-nuc 2.40	2'-DEOXY-5-[(NAPHTHALEN-1-YLMETHYL)CARBAMOYL]URIDINE 5'-(DIHYDROGEN PHOSPHATE) C21 H22 N3 O9 P	CRYSTAL STRUCTURE OF HUMAN INTERLEUKIN 6 IN COMPLEX WITH A M NUCLEOTIDE APTAMER (SOMAMER SL1025) SOMAMER SL1025, INTERLEUKIN-6 CYTOKINE/DNA INTERLEUKIN-6, CYTOKINE-DNA COMPLEX
4ni9	prot-nuc 2.55	2'-DEOXY-5-[(NAPHTHALEN-1-YLMETHYL)CARBAMOYL]URIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C21 H22 N3 O9 P)	CRYSTAL STRUCTURE OF HUMAN INTERLEUKIN 6 IN COMPLEX WITH A M NUCLEOTIDE APTAMER (SOMAMER SL1025), FORM 2 INTERLEUKIN-6, SOMAMER SL1025 CYTOKINE/DNA SELEX, SOMAMER, CYTOKINE-DNA COMPLEX

2JV    N-(8-AMINOPYREN-1-YL)-2'-DEOXY-5'-O-(TRIHYDROXY- LAMBDA~5~-PHOSPHANYL)GUANOSINE

Code	Class Resolution	Description
4rzr	prot-nuc 2.20	N-(8-AMINOPYREN-1-YL)-2'-DEOXY-5'-O-(TRIHYDROXY- LAMBDA~5~-PHOSPHANYL)GUANOSINE 2(C26 H25 N6 O7 P)	BYPASS OF A BULKY ADDUCT DG1,8 BY DPO4 DNA POLYMERASE IV, DNA (5'-D(*TP*TP*GP*C*(2JV) P*GP*AP*CP*TP*GP*GP*TP*AP*TP*TP*GP*GP*G)-3'), DNA (5'-D(P*CP*CP*CP*AP*AP*TP*AP*CP*CP*AP*GP*TP*C CHAIN: C, F TRANSFERASE/DNA DPO4, DBH, POLYMERASE, TRANSFERASE-DNA COMPLEX

2LF    (6S,7S,8S,10R)-2-AMINO-8-HYDROXY-4-OXO-3,6,7,8,9,10- HEXAHYDRO-4H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
4tqr	prot-nuc 1.58	(6S,7S,8S,10R)-2-AMINO-8-HYDROXY-4-OXO-3,6,7,8,9,10- HEXAHYDRO-4H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O7 P	TERNARY COMPLEX OF Y-FAMILY DNA POLYMERASE DPO4 WITH (5'S)-8 2'-DEOXYGUANOSINE AND DTTP DNA POLYMERASE IV: UNP RESIDUES 1-342, DNA (5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*TP*T)-3' CHAIN: P, DNA (5'-D(*TP*CP*AP*CP*(2LF) P*GP*AP*AP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3') TRANSFERASE/DNA Y FAMILY DNA POLYMERASE, DNA DAMAGE, CYCLOPURINE, TRANSLESIO SYNTHESIS
4tqs	prot-nuc 2.06	(6S,7S,8S,10R)-2-AMINO-8-HYDROXY-4-OXO-3,6,7,8,9,10- HEXAHYDRO-4H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O7 P	TERNARY COMPLEX OF Y-FAMILY DNA POLYMERASE DPO4 WITH (5'S)-8 2'-DEOXYGUANOSINE AND DCTP DNA POLYMERASE IV, DNA (5'-D(P*TP*CP*AP*CP*(2LF) P*GP*AP*AP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3'), DNA (5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*TP*T)-3' CHAIN: C, P TRANSFERASE/DNA Y-FAMILY DNA POLYMERASE, DNA DAMAGE, CYCLOPURINE, TRANSLESIO SYNTHESIS, TRANSFERASE

2MA    2-METHYLADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1efw	prot-nuc 3.00	2-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF ASPARTYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS COMPLEXED TO TRNAASP FROM ESCHERICHIA COLI ASPARTYL-TRNA SYNTHETASE, ASPARTYL-TRNA LIGASE/RNA ASPARTYL-TRNA SYNTHETASE, TRNA, PROTEIN/RNA COMPLEX, LIGASE/RNA
1gsg	prot-nuc 2.80	2-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF E.COLI GLUTAMINYL-TRNA SYNTHETASE COMPLEXED WIT AND ATP AT 2.8 ANGSTROMS RESOLUTION TRNAGLN, GLUTAMINYL-TRNA SYNTHETASE LIGASE/RNA PROTEIN-T-RNA COMPLEX, SINGLE STRAND, PROTEIN/RNA, LIGASE-RN
4jyz	prot-nuc 2.50	2-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF E. COLI GLUTAMINYL-TRNA SYNTHETASE BOUN AND NATIVE TRNA(GLN) CONTAINING THE CMNM5S2U34 ANTICODON WO RNA (72-MER), GLUTAMINE--TRNA LIGASE LIGASE/RNA ROSSMANN FOLD, PROTEIN-RNA COMPLEX, AMINOACYL-TRNA SYNTHETAS LIGASE, LIGASE-RNA COMPLEX

2MG    2N-METHYLGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1f7u	prot-nuc 2.20	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE ARGINYL-TRNA SYNTHETASE COMPLEXED W TRNA(ARG) AND L-ARG ARGINYL-TRNA SYNTHETASE, TRNA(ARG) LIGASE/RNA RNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETASE LIGASE-RNA COMPLEX
1f7v	prot-nuc 2.90	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF YEAST ARGINYL-TRNA SYNTHETASE COMPLEXED TRNAARG TRNA(ARG), ARGINYL-TRNA SYNTHETASE LIGASE/RNA TRNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETAS LIGASE-RNA COMPLEX
1ip8	prot-nuc model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS IN THE PRE- TRANSLOCATIONAL STATE RIBOSOMAL PROTEIN L11, ELONGATION FACTOR G, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA RIBOSOME POSSIBLE INTERACTION BETWEEN SMALL AND LARGE RIBOSOMAL RNAS, MRNA AND TRNAS
1ipm	prot-nuc model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR G, ELONGATION FACTOR TU, TRNAS BOUND TO A, P, AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-G, EF-TU
1ipo	prot-nuc model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 23S RIBOSOMAL RNA, TRNA BOUND TO R SITE, 16S RIBOSOMAL RNA, ELONGATION FACTOR G, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', ELONGATION FACTOR TU, TRNA BOUND TO P SITE TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA
1ipq	prot-nuc model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, ELONGATION FACTOR TU, TRNAS BOUND TO P AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3' TRANSLATION/RNA TRANSITION SUB-STATE, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-TU
1ipr	prot-nuc model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRNA BOUND TO P SITE, ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*GP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', ELONGATION FACTOR G, 16S RIBOSOMAL RNA, TRNA BOUND TO R SITE, 23S RIBOSOMAL RNA TRANSLATION/RNA NONCOGNATE CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-TU
1ipu	prot-nuc model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', TRNAS BOUND TO E, P, AND R SITES, NASCENT POLYPEPTIDE, 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA TRANSLATION/RNA PROOFREADING, GTP HYDROLYSIS, EF-TU, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA
1ir4	prot-nuc model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	DOCKING MODEL OF T. THERMOPHILUS ARGRS AND YEAST TRNA(ARG) ARGINYL T-RNA, ARGINYL-TRNA SYNTHETASE LIGASE/RNA ROSSMANN FOLD, A-HELIX BUNDLE
1jgo	prot-nuc 5.60	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, MESSENGER RNA MK27, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S11, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgp	prot-nuc 7.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S8, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MV36, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S2 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgq	prot-nuc 5.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MF36, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S4, TRNA(PHE), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1l1u	prot-nuc model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	TERNARY COMPLEX DOCKED IN THE DECODING SITE OF THE 30S RIBOSOMAL SUBUNIT 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S9, 5'-STACKED TRNA, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, ELONGATION FACTOR TU, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S13, MESSENGER RNA IN THE D-SITE/ASITE, P-SITE AND E- SITE ON THE 30S RIBOSOME, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S7, 50S RIBOSOMAL PROTEIN L7/L12, 30S RIBOSOMAL PROTEIN S3, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S6 RIBOSOME TRNA, 5'-STACK, ANTICODON, DECODING, ELONGATION, PROTEIN SYNTHESIS, TRANSORIENTATION
1mj1	prot-nuc 13.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	FITTING THE TERNARY COMPLEX OF EF-TU/TRNA/GTP AND RIBOSOMAL INTO A 13 A CRYO-EM MAP OF THE COLI 70S RIBOSOME S12 RIBOSOMAL PROTEIN, HELIX 69 OF 23S RRNA, SARCIN-RICIN LOOP OF 23SRRNA, PHE-TRNA, ELONGATION FACTOR TU, S13 RIBOSOMAL PROTEIN, L11 RIBOSOMAL PROTEIN RIBOSOME 70S RIBOSOME, LOW RESOLUTION MODEL TERNARY COMPLEX, EF-TU, R
1ml5	prot-nuc 14.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	STRUCTURE OF THE E. COLI RIBOSOMAL TERMINATION COMPLEX WITH FACTOR 2 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN THX, 50S 5S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S19, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L16, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S4, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L13, T-RNA(PHE), 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S14, A- AND P-SITE MESSENGER RNA CODONS, 50S RIBOSOMAL PROTEIN L18, 30S RIBOSOMAL PROTEIN S16, 50S RIBOSOMAL PROTEIN L19, 30S RIBOSOMAL PROTEIN S15, 50S RIBOSOMAL PROTEIN L1, 50S RIBOSOMAL PROTEIN L14, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L24, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 50S RIBOSOMAL PROTEIN L5, 50S 23S RIBOSOMAL RNA, 30S 16S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L4, 30S RIBOSOMAL PROTEIN S8, 50S RIBOSOMAL PROTEIN L15, 30S RIBOSOMAL PROTEIN S10, 50S RIBOSOMAL PROTEIN L30, 30S RIBOSOMAL PROTEIN S2, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L29, PEPTIDE CHAIN RELEASE FACTOR 2, 30S RIBOSOMAL PROTEIN S13 RIBOSOME E. COLI, RIBOSOME, TERMINATION OF PROTEIN SYNTHESIS, RELEASE CRYO-ELETRON MICROSCOPY, ANGULAR RECONSTITUTION
1ob2	prot-nuc 3.35	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	E. COLI ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC KIRROMYCIN, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE/NUCLEAR PROTEIN HYDROLASE/NUCLEAR PROTEIN, HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA
1ob5	prot-nuc 3.10	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	T. AQUATICUS ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC ENACYLOXIN IIA, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA, GTP-BINDING, NUCLEOTIDE-BINDING, PROTEIN BIOSYNTHESIS
1sz1	prot-nuc 6.21	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	MECHANISM OF CCA-ADDING ENZYMES SPECIFICITY REVEALED BY CRYS STRUCTURES OF TERNARY COMPLEXES TRNA NUCLEOTIDYLTRANSFERASE, T-RNA (76-MER) TRANSFERASE/RNA CCA-ADDING ENZYME, SPECIFICITY, TRNA, COMPLEX, TRANSFERASE-R COMPLEX
1ttt	prot-nuc 2.70	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	PHE-TRNA, ELONGATION FACTOR EF-TU:GDPNP TERNARY COMPLEX OF ELONGATION FACTOR TU (EF-TU), TRANSFER RIBONUCLEIC ACID (YEAST, PHE) COMPLEX (ELONGATION FACTOR/TRNA) PROTEIN SYNTHESIS, EF-TU, TRNA, RIBOSOME, 1EFT, 4TNA, PEPTID ELONGATION RIBONUCLEOPROTEIN, COMPLEX (ELONGATION FACTOR-TR COMPLEX (ELONGATION FACTOR-TRNA) COMPLEX
2dlc	prot-nuc 2.40	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE TERNARY COMPLEX OF YEAST TYROSYL-TR SYNTHETASE T-RNA (76-MER), TYROSYL-TRNA SYNTHETASE, CYTOPLASMIC LIGASE/TRNA TYRRS, TRNA, LIGASE-TRNA COMPLEX
3deg	prot-nuc 10.90	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	COMPLEX OF ELONGATING ESCHERICHIA COLI 70S RIBOSOME AND EF4( GMPPNP 50S RNA HELIX 42-44, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 30S RNA HELIX 8, P-TRNA, GTP-BINDING PROTEIN LEPA: EF4, 50S RNA HELIX 92, A/L-TRNA, 30S RNA HELIX 14, 50S RNA HELIX 95, 50S RNA HELIX 71 RIBOSOME RIBOSOME, TRANSLATION, LEPA, EF4, GTP-BINDING, MEMBRANE, NUC BINDING, ANTIBIOTIC RESISTANCE, RIBONUCLEOPROTEIN, RIBOSOMA PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METHYLATI
4cxg	prot-nuc 8.70	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT ROLLING: A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 18S RRNA - H44, 40S RIBOSOMAL PROTEIN US12, TRANSFER RNA, 28S RRNA - H95, 28S RRNA - H89, ELONGATION FACTOR 1A, MESSENGER RNA, 18S RRNA - H8, 18S RRNA - H5-H14 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX
4cxh	prot-nuc 8.90	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 28S RRNA - H95, TRANSFER RNA, 40S RIBOSOMAL PROTEIN US12, 18S RRNA - H44, 18S RRNA - H8, 18S RRNA - H5-H14, MESSENGER RNA, ELONGATION FACTOR 1A, 28S RRNA - H89 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX, ELONGATION FACTOR EE
4dr1	prot-nuc 3.60	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE APO 30S RIBOSOMAL SUBUNIT FROM THER THERMOPHILUS (HB8) 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dr2	prot-nuc 3.25	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr3	prot-nuc 3.35	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr4	prot-nuc 3.97	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, COGNATE TRANSFER RNA ANTICODON STEM-LOO MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr5	prot-nuc 3.45	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED COGNATE RNA ANTICODON STEM-LOOP AND STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*U)-3', 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr6	prot-nuc 3.30	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, NEAR-COGNATE TRANSFER RNA ANTICODON STE MISMATCHED AT THE FIRST CODON POSITION AND STREPTOMYCIN BOU 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*UP*U)-3', 5'-R(P*UP*UP*GP*AP*GP*GP*(PSU)P*GP*G)-3', 30S RIBOSOMAL PROTEIN S10, 5'-R(P*CP*UP*UP*GP*AP*GP*GP*(PSU)P*GP*GP*U)-3', 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr7	prot-nuc 3.75	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED NEAR-CO TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE SECOND C POSITION, AND STREPTOMYCIN BOUND 5'-R(P*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*GP*CP*CP*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 5'-R(*UP*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 5'-R(P*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4duy	prot-nuc 3.39	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4duz	prot-nuc 3.65	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv0	prot-nuc 3.85	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv1	prot-nuc 3.85	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv2	prot-nuc 3.65	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv3	prot-nuc 3.55	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv4	prot-nuc 3.65	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv5	prot-nuc 3.68	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv6	prot-nuc 3.30	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv7	prot-nuc 3.29	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4ji0	prot-nuc 3.49	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji1	prot-nuc 3.14	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji2	prot-nuc 3.64	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji3	prot-nuc 3.35	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji4	prot-nuc 3.69	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji5	prot-nuc 3.85	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji6	prot-nuc 3.55	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji7	prot-nuc 3.50	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji8	prot-nuc 3.74	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4kvb	prot-nuc 4.20	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	THERMUS THERMOPHILUS HB27 30S RIBOSOMAL SUBUNIT LACKING RIBO PROTEIN S17 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, TRANSLATION, 50S RIBOSOMAL SUBUNIT, R
4lf4	prot-nuc 3.34	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf5	prot-nuc 3.75	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf6	prot-nuc 3.31	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf7	prot-nuc 3.15	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf8	prot-nuc 3.15	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf9	prot-nuc 3.28	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfa	prot-nuc 3.65	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfb	prot-nuc 3.01	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfc	prot-nuc 3.60	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4nxm	prot-nuc 3.65	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM A GIDB ( MUTANT OF THERMUS THERMOPHILUS (HB8) RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17 RIBOSOME STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE, DECODING RIBOSOME
4nxn	prot-nuc 3.54	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM A GIDB ( MUTANT OF THERMUS THERMOPHILUS (HB8), BOUND WITH STREPTOMYC RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE, DECODING RIBOSOME-ANTIBIOTIC COMPLEX
4x62	prot-nuc 3.45	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), RNA (5'-D(*AP*AP*AP*UP*UP*U)-3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x64	prot-nuc 3.35	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, RNA (5'-D(*(MA6)P*AP*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x65	prot-nuc 3.35	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, RNA (5'-D(*AP*(MA6)P*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x66	prot-nuc 3.45	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(*AP*AP*(MA6)P*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
5br8	prot-nuc 3.40	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	AMBIENT-TEMPERATURE CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUN THERMUS THERMOPHILUS IN COMPLEX WITH PAROMOMYCIN 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME 30S RIBOSOMAL SUBUNIT, PAROMOMYCIN, AMBIENT TEMPERATURE, SFX ELECTROSPINNING, RIBOSOME
5me0	prot-nuc 13.50	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 1 (30S IC-1) STA GE81112 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, FMET-TRNA, 30S RIBOSOMAL PROTEIN S5 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION
5me1	prot-nuc 13.50	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 2 (30S IC-2) STA GE81112 FMET-TRNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION
5no2	prot-nuc 5.16	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE) 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S6, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME
5no3	prot-nuc 5.16	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE WITHOUT US3) 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S18, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S5, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S16 RIBOSOME RIBOSOME
5no4	prot-nuc 5.16	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE WITH US3) 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S6, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S5, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME
5u4j	prot-nuc 3.70	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	STRUCTURAL BASIS OF CO-TRANSLATIONAL QUALITY CONTROL BY ARFA BOUND TO RIBOSOME 23S RRNA, PEPTIDE CHAIN RELEASE FACTOR 2, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S5, ALTERNATIVE RIBOSOME-RESCUE FACTOR A, P-SITE TRNA FMET, MRNA, 30S RIBOSOMAL PROTEIN S12, 16S RRNA, 30S RIBOSOMAL PROTEIN S4 RIBOSOME RIBOSOME, ARFA, RF2, NONSTOP TRANSLATION

2MU    2',5-DIMETHYLURIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1ip8	prot-nuc model  	2',5-DIMETHYLURIDINE-5'-MONOPHOSPHATE C11 H17 N2 O9 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS IN THE PRE- TRANSLOCATIONAL STATE RIBOSOMAL PROTEIN L11, ELONGATION FACTOR G, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA RIBOSOME POSSIBLE INTERACTION BETWEEN SMALL AND LARGE RIBOSOMAL RNAS, MRNA AND TRNAS
1ipm	prot-nuc model  	2',5-DIMETHYLURIDINE-5'-MONOPHOSPHATE C11 H17 N2 O9 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR G, ELONGATION FACTOR TU, TRNAS BOUND TO A, P, AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-G, EF-TU
1ipu	prot-nuc model  	2',5-DIMETHYLURIDINE-5'-MONOPHOSPHATE C11 H17 N2 O9 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', TRNAS BOUND TO E, P, AND R SITES, NASCENT POLYPEPTIDE, 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA TRANSLATION/RNA PROOFREADING, GTP HYDROLYSIS, EF-TU, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA

2ON    2-SULFANYL-1,9-DIHYDRO-6H-PURIN-6-ONE

Code	Class Resolution	Description
4pdg	prot-nuc 2.40	2-SULFANYL-1,9-DIHYDRO-6H-PURIN-6-ONE C5 H4 N4 O S	CRYSTAL STRUCTURE OF A COMPLEX BETWEEN AN INHIBITED LLFPG AN CONTAINING DNA DNA (5'-D(*GP*CP*GP*AP*GP*AP*AP*AP*CP*AP*AP*AP*GP CHAIN: C, DNA (5'-D(*CP*TP*CP*TP*TP*TP*(3DR)P*TP*TP*TP*CP*T 3'), FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE HYDROLASE/DNA DNA GLYCOSYLASE, HYDROLASE-DNA COMPLEX
4pdi	prot-nuc 2.10	2-SULFANYL-1,9-DIHYDRO-6H-PURIN-6-ONE C5 H4 N4 O S	CRYSTAL STRUCTURE OF A COMPLEX BETWEEN AN INHIBITED LLFPG AN BENZYL-FAPY-DG CONTAINING DNA DNA (5'-D(*CP*TP*CP*TP*TP*TP*(SOS)P*TP*TP*TP*CP*T 3'), DNA (5'-D(*GP*CP*GP*AP*GP*AP*AP*AP*CP*AP*AP*AP*GP CHAIN: C, FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE HYDROLASE/DNA DNA GLYCOSYLASE, 2TX INHIBITOR, HYDROLASE-DNA COMPLEX

2OP    (2S)-2-HYDROXYPROPANOIC ACID

Code	Class Resolution	Description
1vq4	prot-nuc 2.70	(2S)-2-HYDROXYPROPANOIC ACID C3 H6 O3	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DAA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L2P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L21E, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3'), 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L3P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq5	prot-nuc 2.60	(2S)-2-HYDROXYPROPANOIC ACID C3 H6 O3	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "RAA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3' CHAIN: 4, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq7	prot-nuc 2.50	(2S)-2-HYDROXYPROPANOIC ACID C3 H6 O3	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DCA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3'), 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L14P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L5P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
3i55	prot-nuc 3.11	(2S)-2-HYDROXYPROPANOIC ACID C3 H6 O3	CO-CRYSTAL STRUCTURE OF MYCALAMIDE A BOUND TO THE LARGE RIBOSOMAL SUBUNIT 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L18P, DNA/RNA (5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2) P*AP*CP*C)-3'), 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L10E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L4P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L18E RIBOSOME/ANTIBIOTIC LARGE RIBOSOMAL SUBUNIT, MYCALAMIDE A, RIBONUCLEOPROTEIN, RIBOSOMAL PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METAL-BINDING, ZINC, ZINC-FINGER, ACETYLATION, RIBOSOME- ANTIBIOTIC COMPLEX

2PE    NONAETHYLENE GLYCOL

Code	Class Resolution	Description
3ubt	prot-nuc 2.50	NONAETHYLENE GLYCOL 3(C18 H38 O10)	CRYSTAL STRUCTURE OF C71S MUTANT OF DNA CYTOSINE-5 METHYLTRA M.HAEIII BOUND TO DNA 5'-D(*TP*GP*GP*CP*CP*A)-3', MODIFICATION METHYLASE HAEIII TRANSFERASE/DNA PROTEIN-DNA COMPLEX, DNA CYTOSINE-5 METHYLTRANSFERASE, DNA B S-ADENOSYL METHIONINE BINDING, CYTOSINE-5 DNA METHYLATION, TRANSFERASE-DNA COMPLEX
4ohy	prot-nuc 2.00	NONAETHYLENE GLYCOL C18 H38 O10	C. ELEGANS CLP1 BOUND TO SSRNA DINUCLEOTIDE GC, AMP-PNP, AND MG2+(INHIBITED SUBSTRATE BOUND STATE) PROTEIN CLPF-1, RNA (5'-R(*GP*C)-3') RNA BINDING PROTEIN/RNA POLYNUCLEOTIDE KINASE, RNA BINDING PROTEIN-RNA COMPLEX
4ohz	prot-nuc 2.40	NONAETHYLENE GLYCOL C18 H38 O10	BOUND TO SSRNA TETRANUCLEOTIDE GAAA, ADP, AND MG2+ RNA (5'-R(*GP*AP*AP*A)-3'), PROTEIN CLPF-1 RNA BINDING PROTEIN/RNA POLYNUCLEOTIDE KINASE, RNA BINDING PROTEIN-RNA COMPLEX
4oi0	prot-nuc 2.20	NONAETHYLENE GLYCOL C18 H38 O10	BOUND TO SSRNA DINUCLEOTIDE GC, ADP, ALF4-, AND MG2+(TRANSIT DATA SET I) PROTEIN CLPF-1, RNA (5'-R(*GP*C)-3') RNA BINDING PROTEIN/RNA POLYNUCLEOTIDE KINASE, RNA BINDING PROTEIN-RNA COMPLEX
4oi1	prot-nuc 2.30	NONAETHYLENE GLYCOL C18 H38 O10	CLP1 BOUND TO SSRNA DINUCLEOTIDE GC, ADP, ALF4-, AND MG2+(TR STATE, DATA SET II) RNA (5'-R(*GP*C)-3'), PROTEIN CLPF-1 RNA BINDING PROTEIN/RNA POLYNUCLEOTIDE KINASE, RNA BINDING PROTEIN-RNA COMPLEX

2PO    PHOSPHONATE

Code	Class Resolution	Description
1p4e	prot-nuc 2.70	PHOSPHONATE H O3 P 2-	FLPE W330F MUTANT-DNA HOLLIDAY JUNCTION COMPLEX 5'-D(*TP*AP*AP*GP*TP*TP*CP*CP*TP*AP*TP*TP*C)-3', RECOMBINASE FLP PROTEIN: FLPE, 5'-D(*TP*TP*TP*AP*AP*AP*AP*GP*AP*AP*TP*AP*GP*GP*A *TP*C)-3', 33-MER, RECOMBINASE FLP PROTEIN: FLPE DNA BINDING PROTEIN/RECOMBINATION/DNA FLP, HOLLIDAY JUNCTION, SITE-SPECIFIC RECOMBINATION, W330, F BINDING PROTEIN-RECOMBINATION-DNA COMPLEX

2PR    2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
1u1p	prot-nuc 1.90	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	CRYSTAL STRUCTURE OF UP1 COMPLEXED WITH D(TTAGGGTTA 2PR GG); A HUMAN TELOMERIC REPEAT CONTAINING 2-AMINOPURINE HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A1, 5'-D(*T*TP*AP*GP*GP*GP*TP*TP*AP*(2PR)P*GP*G)-3' TRANSPORT PROTEIN/DNA PROTEIN-DNA COMPLEX, UP1, HUMAN TELOMERIC REPEAT, HTR, TR2- G(10)2PR, RRM, RNA RECOGNITION MOTIF, 2PR, 2-AMINOPURINE, HNRNP A1, TRANSPORT PROTEIN/DNA COMPLEX
1u1r	prot-nuc 1.80	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	CRYSTAL STRUCTURE OF UP1 COMPLEXED WITH D(TTAGGGTTAG(2PR) G); A HUMAN TELOMERIC REPEAT CONTAINING 2-AMINOPURINE 5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*(2PR)P*G)-3', HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A1 TRANSPORT PROTEIN/DNA PROTEIN-DNA COMPLEX, UP1, HUMAN TELOMERIC REPEAT, HTR, TR2- G(11)2PR, RRM, RNA RECOGNITION MOTIF, 2PR, 2-AMINOPURINE, HNRNP A1, TRANSPORT PROTEIN/DNA COMPLEX
1u1y	prot-nuc 2.85	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE 2(C10 H14 N5 O6 P)	CRYSTAL STRUCTURE OF A COMPLEX BETWEEN WT BACTERIOPHAGE MS2 COAT PROTEIN AND AN F5 APTAMER RNA STEMLOOP WITH 2AMINOPURINE SUBSTITUTED AT THE-10 POSITION 5'-R(*CP*CP*GP*GP*(2PR) P*GP*GP*AP*UP*CP*AP*CP*CP*AP*CP*GP*G)-3', COAT PROTEIN VIRUS/RNA COMPLEX (CAPSID PROTEIN-RNA HAIRPIN), HAIRPIN, CAPSID, LEVIVIRUS, ICOSAHEDRAL VIRUS, VIRUS/RNA COMPLEX
2c7o	prot-nuc 1.90	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE- 5'-MONOPHOSPHATE C10 H14 N5 O6 P	HHAI DNA METHYLTRANSFERASE COMPLEX WITH 13MER OLIGONUCLEOTIDE CONTAINING 2-AMINOPURINE ADJACENT TO THE TARGET BASE (PCGC:GMGC) AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*T*GP*TP*CP*AP*(2PR)*CP*GP*CP*AP*TP*CP *C)-3', 5'-D(*T*GP*GP*AP*TP*GP*(5CM)*GP*CP*TP*GP*AP *C)-3' TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX, BASE FLIPPING, TRANSFERASE RESTRICTION SYSTEM
2c7p	prot-nuc 1.70	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE- 5'-MONOPHOSPHATE C10 H14 N5 O6 P	HHAI DNA METHYLTRANSFERASE COMPLEX WITH OLIGONUCLEOTIDE CONT 2-AMINOPURINE OPPOSITE TO THE TARGET BASE (GCGC:GMPC) AND S 5'-D(*G*GP*AP*TP*GP*(5CM*2PR)*CP*TP*GP*AP*C)-3', 5'-D(*G*TP*CP*AP*GP*CP*GP*CP*AP*TP*CP*C)-3', MODIFICATION METHYLASE HHAI TRANSFERASE/DNA BASE FLIPPING, RESTRICTION SYSTEM, TRANSFERASE-DNA COMPLEX
2c7q	prot-nuc 1.85	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE- 5'-MONOPHOSPHATE C10 H14 N5 O6 P	HHAI DNA METHYLTRANSFERASE COMPLEX WITH OLIGONUCLEOTIDE CONTAINING 2-AMINOPURINE OUTSIDE THE RECOGNITION SEQUENCE (PAIRED WITH G) AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*T*GP*TP*CP*AP*GP*CP*GP*CP*CP*GP*CP*C)-3', 5'-D(*T*GP*GP*(2PR)*GP*GP*(5CM)*GP*CP*TP*GP* AP*C)-3' TRANSFERASE/DNA BASE FLIPPING, RESTRICTION SYSTEM, TRANSFERASE-DNA COMPLEX
2c7r	prot-nuc 1.90	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE- 5'-MONOPHOSPHATE C10 H14 N5 O6 P	HHAI DNA METHYLTRANSFERASE (T250G MUTANT) COMPLEX WITH OLIGONUCLEOTIDE CONTAINING 2-AMINOPURINE AS A TARGET BASE (GPGC:GMGC) AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*G*TP*CP*AP*GP*(2PR)*GP*CP*AP*TP*CP*C)-3', 5'-D(*G*GP*AP*TP*GP*(5CM)*GP*CP*TP*GP*AP*C)-3' TRANSFERASE/DNA BASE FLIPPING, RESTRICTION SYSTEM, TRANSFERASE-DNA COMPLEX, TRANSFERASE
2ibs	prot-nuc 2.40	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE 2(C10 H14 N5 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFERASE M.TAQI COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CONTAINING 2-AMINOPURINE AT THE TARGET POSITION 5'-D(*GP*TP*TP*CP*GP*(2PR)P*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI, 5'-D(*GP*AP*CP*AP*TP*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, 2-AMINOPURINE, BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE/DNA COMPLEX
2ibt	prot-nuc 1.70	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE 2(C10 H14 N5 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON AMINOPURINE AT THE TARGET POSITION AND AN ABASIC SITE ANALO TARGET BASE PARTNER POSITION 5'-D(*GP*TP*TP*CP*GP*(2PR)P*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI, 5'-D(*GP*AP*CP*AP*(3DR)P*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, 2-AMINOPURINE, ABASIC SITE ANALO FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
3sq2	prot-nuc 2.10	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DTTP OPPOSITE 2AP ( SEQUENCE) 5'-D(*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP*TP*TP*(2DA))- CHAIN: P, 5'-D(P*CP*(2PR)P*TP*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP 3', DNA POLYMERASE TRANSFERASE/DNA 2-AMINOPURINE, AT RICH, TRANSFERASE-DNA COMPLEX
3sq4	prot-nuc 2.23	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DTTP OPPOSITE 2AP ( SEQUENCE) 5'-D(*CP*GP*CP*GP*CP*GP*GP*CP*GP*GP*CP*GP*(2DA))- CHAIN: P, 5'-D(P*CP*(2PR)P*TP*CP*GP*CP*CP*GP*CP*CP*GP*CP*GP 3', DNA POLYMERASE TRANSFERASE/DNA 2-AMINOPURINE, GC RICH, TRANSFERASE-DNA COMPLEX
3sun	prot-nuc 2.42	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	RB69 DNA POLYMERASE (Y567A) TERNARY COMPLEX WITH DTTP OPPOSI RICH SEQUENCE) 5'-D(*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP*TP*TP*(2DA))- CHAIN: P, 5'-D(P*CP*(2PR)P*TP*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP 3', DNA POLYMERASE TRANSFERASE/DNA 2-AMINOPURINE, AT RICH, RB69POL, TRANSFERASE-DNA COMPLEX
3suo	prot-nuc 2.23	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	RB69 DNA POLYMERASE (Y567A) TERNARY COMPLEX WITH DTTP OPPOSI RICH SEQUENCE) DNA POLYMERASE, 5'-D(*CP*GP*CP*GP*CP*GP*GP*CP*GP*GP*CP*GP*(2DA))- CHAIN: P, 5'-D(P*CP*(2PR)P*TP*CP*GP*CP*CP*GP*CP*CP*GP*CP*GP 3' TRANSFERASE/DNA 2-AMINOPURINE, GC RICH, RB69POL, TRANSFERASE-DNA COMPLEX
3sup	prot-nuc 2.32	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	RB69 DNA POLYMERASE (Y567A) TERNARY COMPLEX WITH DCTP OPPOSI RICH SEQUENCE) DNA POLYMERASE, 5'-D(P*CP*(2PR)P*TP*CP*GP*CP*CP*GP*CP*CP*GP*CP*GP 3', 5'-D(*CP*GP*CP*GP*CP*GP*GP*CP*GP*GP*CP*GP*(2DA))- CHAIN: P TRANSFERASE/DNA 2-AMINOPURINE, GC RICH, RB69POL, TRANSFERASE-DNA COMPLEX
3suq	prot-nuc 3.15	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	RB69 DNA POLYMERASE (Y567A) TERNARY COMPLEX WITH DCTP OPPOSI RICH SEQUENCE) 5'-D(P*CP*(2PR)P*TP*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP 3', 5'-D(*AP*AP*TP*TP*AP*AP*TP*TP*AP*AP*TP*TP*(2DA))- CHAIN: P, DNA POLYMERASE TRANSFERASE/DNA 2-AMINOPURINE, AT RICH, DCTP, RB69POL, Y567A, TRANSFERASE-DN
4hdu	prot-nuc 2.85	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	CRYSTAL STRUCTURE OF S. POMBE ATL1 IN COMPLEX WITH DAMAGED D CONTAINING 2-AMINOPURINE ALKYLTRANSFERASE-LIKE PROTEIN 1, 5'-D(*GP*CP*CP*AP*TP*GP*(2PR)P*CP*TP*AP*GP*TP*A)- CHAIN: B, 5'-D(*CP*TP*AP*CP*TP*AP*GP*CP*CP*AP*TP*GP*G)-3' DNA BINDING PROTEIN/DNA ALKYLTRANSFERASE, DNA REPAIR, NUCLEOTIDE EXCISION REPAIR, NE REPAIR, DNA DAMAGE, GUANINE, ALKYLATION, DNA BINDING PROTEI COMPLEX
4ihx	prot-nuc 2.80	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE 3(C10 H14 N5 O6 P)	CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP 2-AMINOPURINE SUBSTI F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT) 27-BP DNA STRAND A, 27-BP DNA STRAND B, DNA-BINDING PROTEIN FIS TRANSCRIPTION/DNA PROTEIN-DNA COMPLEX, HTH DOMAIN, MINOR GROOVE COMPRESSION, D BENDING, INDIRECT RECOGNITION, TRANSCRIPTION-DNA COMPLEX

2RA    3-AMINO-D-ALANINE

Code	Class Resolution	Description
4oin	prot-nuc 2.80	3-AMINO-D-ALANINE C3 H8 N2 O2	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077 DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A, 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP G)-3', GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, RNA POL DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCLEOTIDES, NUC TRANSCRIPTION, TRANSFERASE-ANTIBIOTIC COMPLEX
4oip	prot-nuc 3.40	3-AMINO-D-ALANINE C3 H8 N2 O2	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077, ATP, AND CMPCPP DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, GE23077, 5'-D(*CP*CP*TP*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*T *GP*GP*G)-3', 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, CMPCPP, POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCL NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIBIOTIC COMPLEX
4oiq	prot-nuc 3.62	3-AMINO-D-ALANINE C3 H8 N2 O2	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077 AND RIFAMPICIN 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP GP*GP*G)-3', DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, RIFAMPI RIFAMPIN, RNA POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATI RIBONUCLEOTIDES, NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIB COMPLEX
4oir	prot-nuc 3.10	3-AMINO-D-ALANINE C3 H8 N2 O2	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS RNA POLYMERASE TRA INITIATION COMPLEX SOAKED WITH GE23077 AND RIFAMYCIN SV 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP GP*GP*G)-3', 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, RIFAMYCIN SV, I SITE, I+1 RNA POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCLEOTIDES, NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIB COMPLEX

2RW    [(2R,3S,4R,5R)-5-(6-AMINO-9H-PURIN-9-YL)-3,4- DIHYDROXYTETRAHYDROFURAN-2-YL]METHYL [(2R,3S)-3- HYDROXYTETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN DIPHOSPHATE

Code	Class Resolution	Description
4o9m	prot-nuc 2.29	[(2R,3S,4R,5R)-5-(6-AMINO-9H-PURIN-9-YL)-3,4- DIHYDROXYTETRAHYDROFURAN-2-YL]METHYL [(2R,3S)-3- HYDROXYTETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN DIPHOSPHATE C15 H23 N5 O12 P2	HUMAN DNA POLYMERASE BETA COMPLEXED WITH ADENYLATED TETRAHYD (ABASIC SITE) CONTAINING DNA DNA (5'-D(*CP*CP*GP*AP*CP*AP*GP*CP*GP*CP*AP*TP*CP 3'), DNA POLYMERASE BETA, (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*CP*C)-3') TRANSFERASE/DNA LYASE, APRATAXIN, ADENYLATED TETRAHYDROFURAN, TRANSFERASE-DN

2TL    D-ALLOTHREONINE

Code	Class Resolution	Description
4oin	prot-nuc 2.80	D-ALLOTHREONINE C4 H9 N O3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077 DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A, 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP G)-3', GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, RNA POL DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCLEOTIDES, NUC TRANSCRIPTION, TRANSFERASE-ANTIBIOTIC COMPLEX
4oip	prot-nuc 3.40	D-ALLOTHREONINE C4 H9 N O3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077, ATP, AND CMPCPP DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, GE23077, 5'-D(*CP*CP*TP*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*T *GP*GP*G)-3', 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, CMPCPP, POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCL NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIBIOTIC COMPLEX
4oiq	prot-nuc 3.62	D-ALLOTHREONINE C4 H9 N O3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INIT COMPLEX SOAKED WITH GE23077 AND RIFAMPICIN 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP GP*GP*G)-3', DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, I SITE, I+1 SITE, RIFAMPI RIFAMPIN, RNA POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATI RIBONUCLEOTIDES, NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIB COMPLEX
4oir	prot-nuc 3.10	D-ALLOTHREONINE C4 H9 N O3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS RNA POLYMERASE TRA INITIATION COMPLEX SOAKED WITH GE23077 AND RIFAMYCIN SV 5'-D(*CP*CP*T*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP GP*GP*G)-3', 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3', GE23077, DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A TRANSCRIPTION, TRANSFERASE/ANTIBIOTIC GE23077, TRANSCRIPTION INHIBITOR, TRANSCRIPTION OPEN COMPLEX TRANSCRIPTION INITIATION COMPLEX, RIFAMYCIN SV, I SITE, I+1 RNA POLYMERASE, DNA/RNA/NTP BINDING, POLYMERIZATION OF RIBONUCLEOTIDES, NUCLEOID, TRANSCRIPTION, TRANSFERASE-ANTIB COMPLEX

2TM    5'-O-[(S)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}PHOSPHORYL]CYTIDINE

Code	Class Resolution	Description
4oio	prot-nuc 3.10	5'-O-[(S)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}PHOSPHORYL]CYTIDINE C10 H18 N3 O13 P3	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS PRE-INSERTION SUBS COMPLEX FOR DE NOVO TRANSCRIPTION INITIATION DNA DIRECTED RNA POLYMERASE SIGMA FACTOR A, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, 5'-D(*CP*CP*TP*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*T *GP*GP*G)-3', 5'-D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*T *GP*GP*AP*TP*GP*CP*AP*GP*G)-3' TRANSCRIPTION, TRANSFERASE DE NOVO TRANSCRIPTION INITIATION, SUBSTRATE COMPLEX, TRANSCR INITIATION, I SITE, I+1 SITE, RNA POLYMERASE, DNA/RNA/NTP B POLYMERIZATION OF RIBONUCLEOTIDES, NUCLEOID, TRANSCRIPTION, TRANSFERASE
4q4z	prot-nuc 2.90	5'-O-[(S)-HYDROXY{[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}PHOSPHORYL]CYTIDINE C10 H18 N3 O13 P3	THERMUS THERMOPHILUS RNA POLYMERASE DE NOVO TRANSCRIPTION IN COMPLEX DNA (5'- D(*CP*CP*TP*GP*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP*GP*CP*AP*GP 3'), DNA (25-MER), DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, RNA POLYMERASE SIGMA FACTOR SIGA TRANSCRIPTION/DNA TRANSCRIPTION, DNA AND NTP, TRANSCRIPTION-DNA COMPLEX

2UR    (2R)-5-FLUORO-2-METHYL-2,3-DIHYDRO-1-BENZOFURAN-7- CARBOXAMIDE

Code	Class Resolution	Description
4opx	prot-nuc 3.31	(2R)-5-FLUORO-2-METHYL-2,3-DIHYDRO-1-BENZOFURAN-7- CARBOXAMIDE C10 H10 F N O2	STRUCTURE OF HUMAN PARP-1 BOUND TO A DNA DOUBLE STRAND BREAK COMPLEX WITH (2R)-5-FLUORO-2-METHYL-2,3-DIHYDRO-1-BENZOFURA CARBOXAMIDE POLY [ADP-RIBOSE] POLYMERASE 1: C-TERMINUS (WGR-CAT, UNP RESIDUES 518-1014), DNA (26-MER), POLY [ADP-RIBOSE] POLYMERASE 1: N-TERMINUS (ZN1-ZN3, SEE REMARK 999) TRANSFERASE/DNA/TRANSFERASE INHIBITOR ZINC FINGER, DNA BINDING, PARP, POLYMERASE, DNA REPAIR, POLY RIBOSYL)ATION, TRANSFERASE-DNA-TRANSFERASE INHIBITOR COMPLE

2US    (2Z)-2-(2,4-DIHYDROXYBENZYLIDENE)-3-OXO-2,3-DIHYDRO-1- BENZOFURAN-7-CARBOXAMIDE

Code	Class Resolution	Description
4oqa	prot-nuc 3.65	(2Z)-2-(2,4-DIHYDROXYBENZYLIDENE)-3-OXO-2,3-DIHYDRO-1- BENZOFURAN-7-CARBOXAMIDE C16 H11 N O5	STRUCTURE OF HUMAN PARP-1 BOUND TO A DNA DOUBLE STRAND BREAK COMPLEX WITH (2Z)-2-(2,4-DIHYDROXYBENZYLIDENE)-3-OXO-2,3-DI BENZOFURAN-7-CARBOXAMIDE DNA (26-MER), POLY [ADP-RIBOSE] POLYMERASE 1: C-TERMINUS (WGR-CAT, UNP RESIDUES 518-1014), POLY [ADP-RIBOSE] POLYMERASE 1: N-TERMINUS (ZN1-ZN3, SEE REMARK 999) TRANSFERASE/DNA/TRANSFERASE INHIBITOR ZINC FINGER, DNA BINDING, PARP, POLYMERASE, DNA REPAIR, POLY RIBOSYL)ATION, TRANSFERASE-DNA-TRANSFERASE INHIBITOR COMPLE

2UT    (2Z)-2-{4-[2-(MORPHOLIN-4-YL)ETHOXY]BENZYLIDENE}-3-OXO- 2,3-DIHYDRO-1-BENZOFURAN-7-CARBOXAMIDE

Code	Class Resolution	Description
4oqb	prot-nuc 3.36	(2Z)-2-{4-[2-(MORPHOLIN-4-YL)ETHOXY]BENZYLIDENE}-3-OXO- 2,3-DIHYDRO-1-BENZOFURAN-7-CARBOXAMIDE C22 H22 N2 O5	STRUCTURE OF HUMAN PARP-1 BOUND TO A DNA DOUBLE STRAND BREAK COMPLEX WITH (2Z)-2-{4-[2-(MORPHOLIN-4-YL)ETHOXY]BENZYLIDEN 2,3-DIHYDRO-1-BENZOFURAN-7-CARBOXAMIDE POLY [ADP-RIBOSE] POLYMERASE 1: N-TERMINUS (ZN1-ZN3, SEE REMARK 999), DNA (26-MER), POLY [ADP-RIBOSE] POLYMERASE 1: C-TERMINUS (WGR-CAT, UNP RESIDUES 518-1014) TRANSFERASE/DNA/TRANSFERASE INHIBITOR ZINC FINGER, DNA BINDING, PARP, POLYMERASE, DNA REPAIR, POLY RIBOSYL)ATION, TRANSFERASE-DNA-TRANSFERASE INHIBITOR COMPLE

2YR    2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
3bi3	prot-nuc 1.90	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	X-RAY STRUCTURE OF ALKB PROTEIN BOUND TO DSDNA CONTAINING 1M COFACTORS ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: CATALYTIC REPAIR DOMAIN, DNA (5'- D(*DAP*DAP*DCP*DGP*DGP*DTP*DAP*DTP*DTP*DAP*DCP*DCP*DT)-3'), DNA (5'-D(*TP*AP*GP*GP*TP*AP*AP*(MA7)P*AP*(2YR)P* 3') OXIDOREDUCTASE/DNA DIOXYGENASE, PROTEIN DNA INTERACTION, ALKYLATION REPAIR, DNA DNA REPAIR, IRON, METAL-BINDING, OXIDOREDUCTASE, OXIDOREDUC COMPLEX
3bie	prot-nuc 1.68	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	X-RAY STRUCTURE OF E COLI ALKB BOUND TO DSDNA CONTAINING 1ME MN AND 2KG DNA (5'-D(P*DAP*DGP*DGP*DTP*DAP*DAP*(MA7) P*DAP*DCP*DCP*DGP*DT)-3'), DNA (5'- D(*DAP*DAP*DCP*DGP*DGP*DTP*DTP*DTP*DTP*DAP*DCP*DCP*DT)-3'), ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: CATALYTIC DOMAIN OXIDOREDUCTASE/DNA DIOXYGENASE, PROTEIN DNA INTERACTION, CROSS-LINKING, ALKYLAT REPAIR, OXIDOREDUCTASE-DNA COMPLEX
3bkz	prot-nuc 1.65	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	X-RAY STRUCTURE OF E COLI ALKB CROSSLINKED TO DSDNA IN THE A ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB, DNA (5'- D(*DTP*DAP*DGP*DGP*DTP*DAP*DAP*DCP*DAP*DTP*DCP*DGP*DT)-3'), DNA (5'- D(*DAP*DAP*DCP*DGP*DAP*DTP*DAP*DTP*DTP*DAP*DCP*DCP*DT)-3') DNA REPAIR,OXIDOREDUCTASE/DNA ALKYLATION REPAIR, PROTEIN DNA INTERACTION, CROSS-LINKING, DIOXYGENASE, DNA REPAIR, OXIDOREDUCTASE-DNA COMPLEX, DNA RE OXIDOREDUCTASE-DNA COMPLEX
3btx	prot-nuc 2.00	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	X-RAY STRUCTURE OF HUMAN ABH2 BOUND TO DSDNA THROUGH ACTIVE CROSS-LINKING ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A, DNA (5'-D(*CP*TP*GP*TP*AP*TP*(2YR)P*AP*TP*TP*GP*C CHAIN: B, DNA (5'- D(*DTP*DCP*DGP*DCP*DAP*DAP*DTP*DAP*DAP*DTP*DAP*DCP*DA)-3') OXIDOREDUCTASE/DNA PROTEIN/DNA INTERACTION, HUMAN DIOXYGENASE, DNA REPAIR, CROS LINKING, DNA DAMAGE, IRON, METAL-BINDING, NUCLEUS, OXIDORED OXIDOREDUCTASE-DNA COMPLEX
3btz	prot-nuc 3.00	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	CRYSTAL STRUCTURE OF HUMAN ABH2 CROSS-LINKED TO DSDNA DNA (5'- D(*DTP*DCP*DGP*DCP*DAP*DTP*DTP*DAP*DTP*DCP*DAP*DCP*DC)-3'), DNA (5'-D(*AP*GP*GP*TP*GP*AP*(2YR)P*AP*AP*TP*GP*C CHAIN: B, ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A OXIDOREDUCTASE/DNA PROTEIN/DNA INTERACTION, HUMAN DIOXYGENASE, CROSS-LINK, DNA DNA DAMAGE, IRON, METAL-BINDING, NUCLEUS, OXIDOREDUCTASE, OXIDOREDUCTASE-DNA COMPLEX
3bu0	prot-nuc 2.50	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	CRYSTAL STRUCTURE OF HUMAN ABH2 CROSS-LINKED TO DSDNA WITH C DNA (5'-D(*CP*TP*GP*TP*AP*TP*(2YR)P*AP*TP*TP*GP*C CHAIN: B, DNA (5'- D(*DTP*DCP*DGP*DCP*DAP*DAP*DTP*DAP*DAP*DTP*DAP*DCP*DA)-3'), ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A OXIDOREDUCTASE/DNA PROTEIN/DNA INTERACTION, HUMAN DIOXYGENASE, DNA REPAIR, CROS DNA DAMAGE, IRON, METAL-BINDING, NUCLEUS, OXIDOREDUCTASE, OXIDOREDUCTASE-DNA COMPLEX
3h8o	prot-nuc 2.00	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	STRUCTURE DETERMINATION OF DNA METHYLATION LESIONS N1-MEA AN IN DUPLEX DNA USING A CROSS-LINKED HOST-GUEST SYSTEM 5'-D(*CP*TP*GP*TP*AP*TP*(2YR)P*AP*TP*(MA7)P*GP*CP CHAIN: B, 5'-D(*TP*CP*GP*CP*TP*AP*TP*AP*AP*TP*AP*CP*A)-3', ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A: RESIDUES 56-261 OXIDOREDUCTASE/DNA PROTEIN-DNA COMPLEX, DIOXYGENASE, DNA DAMAGE, DNA REPAIR, IR METAL-BINDING, NUCLEUS, OXIDOREDUCTASE, OXIDOREDUCTASE-DNA
3h8r	prot-nuc 1.77	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	STRUCTURE DETERMINATION OF DNA METHYLATION LESIONS N1-MEA AN IN DUPLEX DNA USING A CROSS-LINKED HOST-GUEST SYSTEM 5'-D(*TP*CP*GP*CP*TP*AP*TP*AP*AP*TP*AP*CP*A)-3', 5'-D(*CP*TP*GP*TP*AP*TP*(2YR)P*AP*TP*(6MA)P*GP*CP CHAIN: B, ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A: TRUNCATION WITH N-TERMINAL 55 AMINO ACID DELETED OXIDOREDUCTASE/DNA PROTEIN-DNA COMPLEX, DIOXYGENASE, DNA DAMAGE, DNA REPAIR, IR METAL-BINDING, NUCLEUS, OXIDOREDUCTASE-DNA COMPLEX
3h8x	prot-nuc 1.95	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	STRUCTURE DETERMINATION OF DNA METHYLATION LESIONS N1-MEA AN IN DUPLEX DNA USING A CROSS-LINKED HOST-GUEST SYSTEM ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A: RESIDUES 56-261, 5'-D(*CP*TP*GP*TP*(ME6)P*TP*(2YR)P*AP*TP*TP*GP*CP CHAIN: B, 5'-D(*TP*CP*GP*CP*AP*AP*TP*AP*AP*GP*AP*CP*A)-3' OXIDOREDUCTASE/DNA PROTEIN-DNA COMPLEX, DIOXYGENASE, DNA DAMAGE, DNA REPAIR, IR METAL-BINDING, NUCLEUS, OXIDOREDUCTASE-DNA COMPLEX
3o1m	prot-nuc 1.75	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	IRON-CATALYZED OXIDATION INTERMEDIATES CAPTURED IN A DNA REP DIOXYGENASE DNA (5'-D(*T*AP*GP*GP*TP*AP*AP*(ME6)P*AP*CP*CP*GP CHAIN: B, DNA (5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T) CHAIN: C, ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: N-TERMINUS 11 TRUNCATED ALKB (UNP RESIDUES 12 TO SYNONYM: ALKYLATED DNA REPAIR PROTEIN ALKB OXIDOREDUCTASE JELLY-ROLL FOLD, DEMETHYLASE, OXIDOREDUCTASE
3o1o	prot-nuc 1.92	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	IRON-CATALYZED OXIDATION INTERMEDIATES CAPTURED IN A DNA REP DIOXYGENASE ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: N-TERMINUS 11 AMINO ACIDS TRUNCATED ALKB (UNP RES TO 216), DNA (5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T) CHAIN: C, DNA (5'-D(*T*AP*GP*GP*TP*AP*AP*(MFT)P*AP*CP*CP*GP CHAIN: B OXIDOREDUCTASE JELLY-ROLL FOLD., DEMETHYLASE, OXIDOREDUCTASE
3o1p	prot-nuc 1.51	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	IRON-CATALYZED OXIDATION INTERMEDIATES CAPTURED IN A DNA REP DIOXYGENASE ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: N-TERMINUS 11 AMINO ACID TRUNCATED ALKB (UNP RESI 216), DNA (5'-D(*T*AP*GP*GP*TP*AP*AP*(EDA)P*AP*CP*CP*GP CHAIN: B, DNA (5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T) CHAIN: C OXIDOREDUCTASE DEMETHYLASE, OXIDOREDUCTASE
3o1r	prot-nuc 1.77	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	IRON-CATALYZED OXIDATION INTERMEDIATES CAPTURED IN A DNA REP DIOXYGENASE ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: N-TERMINUS 11 AMINO ACID TRUNCATED ALKB (UNP RESI 216), DNA (5'-D(*AP*GP*GP*TP*AP*AP*(MDK)P*AP*CP*CP*GP*T CHAIN: B, DNA (5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T) CHAIN: C OXIDOREDUCTASE DEMETHYLASE, OXIDOREDUCTASE
3o1s	prot-nuc 1.58	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	IRON-CATALYZED OXIDATION INTERMEDIATES CAPTURED IN A DNA REP DIOXYGENASE DNA (5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T) CHAIN: C, DNA (5'-D(*AP*GP*GP*TP*AP*AP*(MDQ)P*AP*CP*CP*GP*T CHAIN: B, ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: N-TERMINUS 11 AMINO ACID TRUNCATED ALKB (UNP RESI 216) OXIDOREDUCTASE DEMETHYLASE, OXIDOREDUCTASE
3o1t	prot-nuc 1.48	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	IRON-CATALYZED OXIDATION INTERMEDIATES CAPTURED IN A DNA REP DIOXYGENASE ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: N-TERMINUS 11 AMINO ACIDS TRUNCATED ALKB (UNP RES TO 216), DNA (5'-D(*AP*GP*GP*TP*AP*AP*(MDU)P*AP*CP*CP*GP*T CHAIN: B, DNA (5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T) CHAIN: C OXIDOREDUCTASE DEMETHYALSE, OXIDOREDUCTASE
3o1u	prot-nuc 1.54	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	IRON-CATALYZED OXIDATION INTERMEDIATES CAPTURED IN A DNA REP DIOXYGENASE ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: N-TERMINUS 11 AMINO ACID TRUNCATED ALKB (UNP RESI 216), DNA (5'-D(*AP*GP*GP*TP*AP*AP*(MDV)P*AP*CP*CP*GP*T CHAIN: B, DNA (5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T) CHAIN: C OXIDOREDUCTASE DEMETHYLASE, OXIDOREDUCTASE
3o1v	prot-nuc 1.90	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	IRON-CATALYZED OXIDATION INTERMEDIATES CAPTURED IN A DNA REP DIOXYGENASE ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: N-TERMINUS 11 AMINO ACID TRUNCATED ALKB (UNP RESI 216), DNA (5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T) CHAIN: C, DNA (5'-D(*AP*GP*GP*TP*AP*AP*(MDJ)P*AP*CP*CP*GP*T CHAIN: B OXIDOREDUCTASE DEMETHYLASE, OXIDOREDUCTASE
4mg2	prot-nuc 2.30	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	ALKBH2 F102A CROSS-LINKED TO UNDAMAGED DSDNA DNA-2, DNA-1, ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A OXIDOREDUCTASE/DNA STRUCTURAL GENOMICS, ENZYME FUNCTION INITIATIVE, CENTER FOR EUKARYOTIC STRUCTURAL GENOMICS, CESG, ROSSMANN FOLD, OXIDOR DNA COMPLEX
4mgt	prot-nuc 2.60	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	ALKBH2 R110A CROSS-LINKED TO UNDAMAGED DSDNA ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A: UNP RESIDUES 56-258, DNA1, DNA2 OXIDOREDUCTASE/DNA PROTEIN-DNA COMPLEX, OXIDOREDUCTASE-DNA COMPLEX
4nid	prot-nuc 1.58	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	CRYSTAL STRUCTURE OF ALKB PROTEIN WITH COFACTORS BOUND TO DS CONTAINING M6A ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: UNP RESIDUES 12-214, 5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T)-3', 5'-D(*TP*AP*GP*GP*TP*AP*AP*(6MA)P*AP*CP*CP*GP*T)- CHAIN: B OXIDOREDUCTASE/DNA DNA/RNA DIRECT REPAIR, JELLY-ROLL FOLD, DNA/RNA DEMETHYLATIO FE(II), 2-KG, OXIDOREDUCTASE-DNA COMPLEX
4nig	prot-nuc 1.52	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	CRYSTAL STRUCTURE OF ALKB D135I/E136H MUTANT PROTEIN WITH CO BOUND TO DSDNA CONTAINING M6A/A 5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T)-3', 5'-D(*TP*AP*GP*GP*TP*AP*AP*(6MA)P*AP*CP*CP*GP*T)- CHAIN: B, ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: UNP RESIDUES 13-216 OXIDOREDUCTASE/DNA DNA/RNA DIRECT REPAIR, JELLY-ROLL FOLD, DNA/RNA DEMETHYLATIO FE(II), 2-KG, OXIDOREDUCTASE-DNA COMPLEX
4nih	prot-nuc 1.37	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	CRYSTAL STRUCTURE OF ALKB E136L MUTANT PROTEIN WITH COFACTOR DSDNA CONTAINING M6A/A 5'-D(*TP*AP*GP*GP*TP*AP*AP*(6MA)P*AP*CP*CP*GP*T)- CHAIN: B, 5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T)-3', ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: UNP RESIDUES 13-216 OXIDOREDUCTASE/DNA DNA/RNA DIRECT REPAIR, JELLY-ROLL FOLD, DNA/RNA DEMETHYLATIO FE(II), 2-KG, OXIDOREDUCTASE-DNA COMPLEX
4nii	prot-nuc 1.62	2'-DEOXY-N-(2-SULFANYLETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P S	CRYSTAL STRUCTURE OF ALKB D135I MUTANT PROTEIN WITH COFACTOR DSDNA CONTAINING M6A/A ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: UNP RESIDUES 12-215, 5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T)-3', 5'-D(*TP*AP*GP*GP*TP*AP*AP*(6MA)P*AP*CP*CP*GP*T)- CHAIN: B OXIDOREDUCTASE/DNA DNA/RNA DIRECT REPAIR, JELLY-ROLL FOLD, DNA/RNA DEMETHYLATIO FE(II), 2-KG, OXIDOREDUCTASE-DNA COMPLEX

2ZE    (3R,4R,4AR,6AS,8R,9R,11AS,11BS)-4,9-BIS(HYDROXYMETHYL)- 4,11B-DIMETHYLTETRADECAHYDRO-8,11A- METHANOCYCLOHEPTA[A]NAPHTHALENE-3,9-DIOL

Code	Class Resolution	Description
4q5v	prot-nuc 2.52	(3R,4R,4AR,6AS,8R,9R,11AS,11BS)-4,9-BIS(HYDROXYMETHYL)- 4,11B-DIMETHYLTETRADECAHYDRO-8,11A- METHANOCYCLOHEPTA[A]NAPHTHALENE-3,9-DIOL 2(C20 H34 O4)	CRYSTAL STRUCTURE OF THE CATALYTIC CORE OF HUMAN DNA POLYMER IN TERNARY COMPLEX WITH AN RNA-PRIMED DNA TEMPLATE AND APHI DNA POLYMERASE ALPHA CATALYTIC SUBUNIT: HUMAN DNA POLYMERASE APHA CATALYTIC CORE DOMAIN R 336-1257, RNA PRIMER, DNA TEMPLATE TRANSFERASE/DNA/RNA B-FAMILY DNA POLYMERASE, DNA REPLICATION, TRANSFERASE-DNA-RN

2ZY    (5Z)-5-(3,5-DIFLUORO-4-HYDROXYBENZYLIDENE)-2-METHYL-3- (2,2,2-TRIFLUOROETHYL)-3,5-DIHYDRO-4H-IMIDAZOL-4-ONE

Code	Class Resolution	Description
4q9r	prot-nuc 3.12	(5Z)-5-(3,5-DIFLUORO-4-HYDROXYBENZYLIDENE)-2-METHYL-3- (2,2,2-TRIFLUOROETHYL)-3,5-DIHYDRO-4H-IMIDAZOL-4-ONE C13 H9 F5 N2 O2	CRYSTAL STRUCTURE OF AN RNA APTAMER BOUND TO TRIFLUOROETHYL- ANALOG IN COMPLEX WITH FAB SPINACH RNA APTAMER, FAB BL3-6 RNA/IMMUNE SYSTEM G-QUADRUPLEX, FLUORESCENCE, FLUOROPHORE, RNA-IMMUNE SYSTEM C

2ZZ    (5Z)-5-(3-BROMOBENZYLIDENE)-2,3-DIMETHYL-3,5-DIHYDRO- 4H-IMIDAZOL-4-ONE

Code	Class Resolution	Description
4q9q	prot-nuc 2.45	(5Z)-5-(3-BROMOBENZYLIDENE)-2,3-DIMETHYL-3,5-DIHYDRO- 4H-IMIDAZOL-4-ONE C12 H11 BR N2 O	CRYSTAL STRUCTURE OF AN RNA APTAMER BOUND TO BROMO-LIGAND AN COMPLEX WITH FAB SPINACH RNA APTAMER, FAB BL3-6 RNA G-QUADRUPLEX, FLUORESCENCE, FLUOROPHORE, RNA

31N    6-[({(1R,4S)-1-[(1S)-2-(3-FLUORO-6-METHOXY-1,5- NAPHTHYRIDIN-4-YL)-1-HYDROXYETHYL]-2- OXABICYCLO[2.2.2]OCT-4-YL}AMINO)METHYL]-2H-PYRIDO[3,2- B][1,4]OXAZIN-3(4H)-ONE

Code	Class Resolution	Description
4plb	prot-nuc 2.69	6-[({(1R,4S)-1-[(1S)-2-(3-FLUORO-6-METHOXY-1,5- NAPHTHYRIDIN-4-YL)-1-HYDROXYETHYL]-2- OXABICYCLO[2.2.2]OCT-4-YL}AMINO)METHYL]-2H-PYRIDO[3,2- B][1,4]OXAZIN-3(4H)-ONE C26 H28 F N5 O5	CRYSTAL STRUCTURE OF S.A. GYRASE-AM8191 COMPLEX DNA (5'- D(P*AP*GP*CP*CP*GP*TP*AP*GP*GP*GP*CP*CP*CP*TP*AP*CP*GP*GP*C CHAIN: E, F, CHIMERA PROTEIN OF DNA GYRASE SUBUNITS B AND A: DNA GYRASE SUBUNIT B (UNP P0A0K8 RESIDUES 410-543 644), DNA GYRASE SUBUNIT A (UNP P20831 RESIDUES 2-491) ISOMERASE/ISOMERASE INHIBITOR/DNA GYASE INHIBITOR COMPLEX, ISOMERASE-ISOMERASE INHIBITOR-DNA C

34G    EMETINE

Code	Class Resolution	Description
3j7a	prot-nuc 3.20	EMETINE C29 H40 N2 O4	CRYO-EM STRUCTURE OF THE PLASMODIUM FALCIPARUM 80S RIBOSOME THE ANTI-PROTOZOAN DRUG EMETINE, SMALL SUBUNIT 40S RIBOSOMAL PROTEIN US11, 40S RIBOSOMAL PROTEIN US19, 40S RIBOSOMAL PROTEIN ES7, 40S RIBOSOMAL PROTEIN US4, 40S RIBOSOMAL PROTEIN ES21, 40S RIBOSOMAL PROTEIN ES17, 40S RIBOSOMAL PROTEIN US17, 40S RIBOSOMAL PROTEIN US8, 40S RIBOSOMAL PROTEIN ES25, TRNA, 40S RIBOSOMAL PROTEIN US12, 40S RIBOSOMAL PROTEIN ES24, 40S RIBOSOMAL PROTEIN US14, 40S RIBOSOMAL PROTEIN US15, 40S RIBOSOMAL PROTEIN US2, 40S RIBOSOMAL PROTEIN US13, 40S RIBOSOMAL PROTEIN US10, 40S RIBOSOMAL PROTEIN ES1, 40S RIBOSOMAL PROTEIN ES8, 40S RIBOSOMAL PROTEIN US7, 40S RIBOSOMAL PROTEIN US9, 40S RIBOSOMAL PROTEIN ES27, 40S RIBOSOMAL PROTEIN ES26, 18S RIBOSOMAL RNA, 40S RIBOSOMAL PROTEIN US3, 40S RIBOSOMAL PROTEIN ES28, 40S RIBOSOMAL PROTEIN ES19, 40S RIBOSOMAL PROTEIN ES6, 40S RIBOSOMAL PROTEIN ES12, 40S RIBOSOMAL PROTEIN ES4, 40S RIBOSOMAL PROTEIN ES30, 40S RIBOSOMAL PROTEIN US5, 40S RIBOSOMAL PROTEIN ES10 RIBOSOME/INHIBITOR EMETINE, RIBOSOME-INHIBITOR COMPLEX

365    [(1S,5R,6R,7'S,8R)-7'-(AMINOMETHYL)-6-(6- AMINOPURIN-9-YL)-2'-(3-OXIDANYLPROPOXY)SPIRO[2,4, 7-TRIOXA-3-BORANUIDABICYCLO[3.3.0]OCTANE-3, 9'-8-OXA-9-BORANUIDABICYCLO[4.3.0]NONA-1(6),2, 4-TRIENE]-8-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
3zjv	prot-nuc 2.31	[(1S,5R,6R,7'S,8R)-7'-(AMINOMETHYL)-6-(6- AMINOPURIN-9-YL)-2'-(3-OXIDANYLPROPOXY)SPIRO[2,4, 7-TRIOXA-3-BORANUIDABICYCLO[3.3.0]OCTANE-3, 9'-8-OXA-9-BORANUIDABICYCLO[4.3.0]NONA-1(6),2, 4-TRIENE]-8-YL]METHYL DIHYDROGEN PHOSPHATE C21 H27 B N6 O10 P 1-	TERNARY COMPLEX OF E .COLI LEUCYL-TRNA SYNTHETASE, TRNA(LEU) AND THE BENZOXABOROLE AN3213 IN THE EDITING CONFORMATION TRNALEU5 UAA ISOACCEPTOR, LEUCINE--TRNA LIGASE LIGASE/RNA LIGASE-RNA COMPLEX, LIGASE, PROTEIN BIOSYNTHESIS, CLASS I AMINOACYL-TRNA SYNTHETASE, AMINOACYL TRNA SYNTHETASE, ATP B EDITING SYNTHETASE

3AT    3'-DEOXYADENOSINE-5'-TRIPHOSPHATE

Code	Class Resolution	Description
3er9	prot-nuc 2.06	3'-DEOXYADENOSINE-5'-TRIPHOSPHATE C10 H16 N5 O12 P3	CRYSTAL STRUCTURE OF THE HETERODIMERIC VACCINIA VIRUS MRNA POLYADENYLATE POLYMERASE COMPLEX WITH UU AND 3'-DEOXY ATP CAP-SPECIFIC MRNA (NUCLEOSIDE-2'-O-)-METHYLTRANSF CHAIN: A, 5'-R(UP*U)-3', POLY(A) POLYMERASE CATALYTIC SUBUNIT TRANSCRIPTION, TRANSFERASE/RNA POLYADENYLATE POLYMERASE, TRANSLOCATION, SINGLE TRANDED RNA POLYMERASE, RNA PROTEIN COMPLEX, PROCESSIVITY, HETERODIMER, NUCLEOTIDYLTRANSFERASE, POXVIRUS; METHYLTRANSFERASE, MRNA C MRNA PROCESSING, S-ADENOSYL-L-METHIONINE, TRANSCRIPTION, TRANSFERASE, TRANSFERASE-RNA COMPLEX
3erc	prot-nuc 3.21	3'-DEOXYADENOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O12 P3)	CRYSTAL STRUCTURE OF THE HETERODIMERIC VACCINIA VIRUS MRNA POLYADENYLATE POLYMERASE WITH THREE FRAGMENTS OF RNA AND 3'-DEOXY ATP RNA/DNA CHIMERA (5'-D(CP*CP*)R(UP*UP*)D(C)-3'), RNA/DNA CHIMERA (5'-D(CP*)R(UP*UP*)D(CP*C)-3'), POLY(A) POLYMERASE CATALYTIC SUBUNIT, RNA/DNA CHIMERA (5'-D(CP*)R(UP*UP*)-D(C)-3'), CAP-SPECIFIC MRNA (NUCLEOSIDE-2'-O-)- METHYLTRANSFERASE TRANSCRIPTION, TRANSFERASE/DNA, RNA POLYADENYLATE POLYMERASE, TRANSLOCATION, SINGLE TRANDED RNA POLY(A) POLYMERASE, RNA PROTEIN COMPLEX, PROCESSIVITY, HETERODIMER, NUCLEOTIDYLTRANSFERASE, POXVIRUS; METHYLTRANSFERASE, MRNA CAPPING, MRNA PROCESSING, S- ADENOSYL-L-METHIONINE, TRANSCRIPTION, TRANSFERASE, TRANSFERASE/DNA, RNA COMPLEX

3C4    (3-CHLORO-4-HYDROXYPHENYL)ACETIC ACID

Code	Class Resolution	Description
3e6c	prot-nuc 1.80	(3-CHLORO-4-HYDROXYPHENYL)ACETIC ACID C8 H7 CL O3	CPRK OCPA DNA COMPLEX CYCLIC NUCLEOTIDE-BINDING PROTEIN, DNA (5'- D(P*DGP*DCP*DAP*DTP*DTP*DAP*DAP*DCP*DAP*DTP*DGP*DCP*DC)-3') CHAIN: B, DNA (5'- D(P*DGP*DGP*DCP*DAP*DTP*DGP*DTP*DTP*DAP*DAP*DTP*DGP*DC)-3') CHAIN: A TRANSCRIPTION REGULATION/DNA CPRK, HALORESPIRATION, TRANSCRIPTIONAL REGULATOR, TRANSCRIPT REGULATION-DNA COMPLEX

3CO    COBALT (III) ION

Code	Class Resolution	Description
1y39	prot-nuc 2.80	COBALT (III) ION 2(CO 3+)	CO-EVOLUTION OF PROTEIN AND RNA STRUCTURES WITHIN A HIGHLY C RIBOSOMAL DOMAIN 50S RIBOSOMAL PROTEIN L11: C-TERMINAL DOMAIN OF RIBOSOMAL PROTEIN L11, 58 NUCLEOTIDE RIBOSOMAL 23S RNA DOMAIN STRUCTURAL PROTEIN/RNA X-RAY CRYSTAL STRUCTURE, CHOROPLAST-LIKE L11 COMPLEX, RRNA, STRUCTURAL PROTEIN-RNA COMPLEX
2r2s	prot-nuc 2.80	COBALT (III) ION CO 3+	CO(III)BLEOMYCINB2 BOUND TO D(ATTAGTTATAACTAAT) COMPLEXED WITH MMLV RT CATALYTIC FRAGMENT DNA (5'-D(P*DTP*DAP*DAP*DCP*DTP*DAP*DAP*DT)-3'), DNA (5'-D(*DAP*DTP*DTP*DAP*DGP*DTP*DT)-3'), REVERSE TRANSCRIPTASE: RESIDUES 144-398 TRANSFERASE/DNA BLEOMYCIN, DRUG-DNA COMPLEX, PROTEIN-DNA COMPLEX, MMLV RT, DNA INTEGRATION, DNA RECOMBINATION, ENDONUCLEASE, MULTIFUNCTIONAL ENZYME, NUCLEASE, NUCLEOTIDYLTRANSFERASE, RNA-DIRECTED DNA POLYMERASE, TRANSFERASE, TRANSFERASE/DNA COMPLEX

3D1    (2R,3S,5R)-5-(6-AMINO-9H-PURIN-9-YL)-TETRAHYDRO-2- (HYDROXYMETHYL)FURAN-3-OL

Code	Class Resolution	Description
3si8	prot-nuc 2.15	(2R,3S,5R)-5-(6-AMINO-9H-PURIN-9-YL)-TETRAHYDRO-2- (HYDROXYMETHYL)FURAN-3-OL C10 H13 N5 O3	HUMAN DNA POLYMERASE ETA - DNA TERNARY COMPLEX WITH THE 5'T IN THE ACTIVE SITE (TT2) DNA POLYMERASE ETA: UNP RESIDUES 1-432, DNA (5'-D(*TP*A*AP*CP*(TTD)P*AP*TP*GP*AP*CP*GP*C) CHAIN: T, DNA (5'-D(*TP*GP*CP*GP*TP*CP*AP*TP*A)-3') TRANSFERASE/DNA PROTEIN-DNA COMPLEX, MULTIPLE DOMAINS, THREE ARE ALPHA/BETA ONE OF THE FOUR IS HELICAL FOLD, DNA POLYMERASE, DNA BINDIN AND DNTP BINDING, AFFINITY TAG IS ADDED AND PARTIALLY REMOV N-TERMINAL END, NUCLEUS, TRANSFERASE-DNA COMPLEX

3DA    3'-DEOXYADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1s77	prot-nuc 2.69	3'-DEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O6 P	T7 RNAP PRODUCT PYROPHOSPHATE ELONGATION COMPLEX DNA (5'- D(*TP*TP*TP*AP*CP*GP*TP*TP*GP*CP*GP*CP*AP*CP*GP*GP*C)-3'), RNA (5'-R(*AP*CP*AP*CP*GP*GP*CP*GP*AP*(3DA))-3'), DNA (5'- D(*GP*CP*CP*GP*TP*GP*CP*GP*CP*AP*TP*TP*CP*GP*CP*CP*GP*TP*GP *TP*T)-3'), DNA-DIRECTED RNA POLYMERASE TRANSFERASE T7 RNA POLYMERASE, TRANSFERASE

3DR    1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE

Code	Class Resolution	Description
1de8	prot-nuc 2.95	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	HUMAN APURINIC/APYRIMIDINIC ENDONUCLEASE-1 (APE1) BOUND TO ABASIC DNA DNA (5'-D(*CP*GP*AP*TP*CP*GP*GP*TP*AP*GP*C)-3'), MAJOR APURINIC/APYRIMIDINIC ENDONUCLEASE: APE1, DNA (5'-D(*GP*CP*TP*AP*CP*(3DR)P*GP*AP*TP*CP*G)- 3') LYASE/DNA ENZYME:DNA COMPLEX, DNA REPAIR, ABASIC SITE, LYASE/DNA COMPLEX
1de9	prot-nuc 3.00	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	HUMAN APE1 ENDONUCLEASE WITH BOUND ABASIC DNA AND MN2+ ION MAJOR APURINIC/APYRIMIDINIC ENDONUCLEASE: APE1, 5'-D(*CP*TP*AP*C)-3', 5'-D(P*(3DR)P*GP*AP*TP*C)-3', 5'-D(*GP*AP*TP*CP*GP*GP*TP*AP*G)-3' LYASE/DNA ENZYME:DNA COMPLEX, DNA REPAIR ABASIC SITE, AP ENDONUCLEASE, LYASE/DNA COMPLEX
1dew	prot-nuc 2.65	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CRYSTAL STRUCTURE OF HUMAN APE1 BOUND TO ABASIC DNA 5'-D(*GP*CP*GP*TP*CP*CP*(3DR) P*CP*GP*AP*CP*GP*AP*CP*G)-3', 5'-D(*GP*TP*CP*GP*TP*CP*GP*GP*GP*GP*AP*CP*GP*C)- 3', MAJOR APURINIC/APYRIMIDINIC ENDONUCLEASE: APE1 LYASE/DNA ENZYME:DNA COMPLEX, DNA REPAIR, ABASIC SITE, LYASE/DNA COMPLEX
1fn7	prot-nuc 2.60	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	COUPLING OF DAMAGE RECOGNITION AND CATALYSIS BY A HUMAN BASE-EXCISION DNA REPAIR PROTEIN DNA (5'-D(*GP*CP*GP*TP*CP*CP*AP*(3DR) P*GP*TP*CP*TP*AP*CP*C)-3'), 8-OXOGUANINE DNA GLYCOSYLASE 1, DNA (5'- D(*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3') HYDROLASE/DNA DNA REPAIR, DNA GLYCOSYLASE, PROTEIN/DNA, HELIX HAIRPIN HELIX, BASE RECOGNITION, OXOGUANINE, HYDROXYGUANINE, BASE FLIPPING, FLIPPED-OUT BASE, EXTRAHELICAL DNA, MECHANISM- BASED INHIBITOR, BASE-EXICISION REPAIR, AP LYASE, DNA GLYCOSIDASE, HYDROLASE/DNA COMPLEX
1ixy	prot-nuc 2.50	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	TERNARY COMPLEX OF T4 PHAGE BGT WITH UDP AND A 13 MER DNA DUPLEX 5'-D(*GP*AP*TP*AP*CP*TP*3DRP*AP*GP*AP*TP*AP*G)- 3', 5'-D(*CP*TP*AP*TP*CP*TP*GP*AP*GP*TP*AP*TP*C)-3', DNA BETA-GLUCOSYLTRANSFERASE TRANSFERASE/DNA PROTEIN-DNA COMPLEX, BASE-FLIPPING, ABASIC SITE, TRANSFERASE/DNA COMPLEX
1lyr	prot-nuc model  	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	THEORETICAL MODEL OF BOVINE AP LYASE, BAP1 DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, 5'-D(*GP*CP*GP*TP*CP*CP*(3DR) P*CP*GP*AP*CP*GP*AP*CP*G)-3', 5'-D(*GP*TP*CP*GP*TP*CP*GP*GP*GP*GP*AP*CP*GP*C)- 3' LYASE/DNA THEORETICAL MODEL, ENDONUCLEASE, AP LYASE, DNA REPAIR ENZYME
1m5r	prot-nuc 1.80	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	TERNARY COMPLEX OF T4 PHAGE BGT WITH UDP AND A 13 MER DNA DUPLEX 5'-D(*GP*AP*TP*AP*CP*TP*3DRP*AP*GP*AP*TP*AP*G)- 3', DNA BETA-GLUCOSYLTRANSFERASE, 5'-D(*CP*TP*AP*TP*CP*TP*GP*AP*GP*TP*AP*TP*C)-3' TRANSFERASE/DNA PROTEIN-DNA COMPLEX, BASE-FLIPPING, ABASIC SITE, TRANSFERASE/DNA COMPLEX
1n39	prot-nuc 2.20	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURAL AND BIOCHEMICAL EXPLORATION OF A CRITICAL AMINO ACID IN HUMAN 8-OXOGUANINE GLYCOSYLASE DNA INHIBITOR STRAND, N-GLYCOSYLASE/DNA LYASE, DNA COMPLEMENT STRAND HYDROLASE, LYASE/DNA HHH-GPD, DNA-REPAIR, GLYCOSYLASE, OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
1n3a	prot-nuc 2.20	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURAL AND BIOCHEMICAL EXPLORATION OF A CRITICAL AMINO ACID IN HUMAN 8-OXOGUANINE GLYCOSYLASE DNA COMPLEMENT STRAND, DNA INHIBITOR STRAND, N-GLYCOSYLASE/DNA LYASE HYDROLASE, LYASE/DNA HHH-GPD, GLYCOSYLASE, DNA-REPAIR, OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
1n48	prot-nuc 2.20	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	Y-FAMILY DNA POLYMERASE DPO4 IN COMPLEX WITH DNA CONTAINING LESION DNA POLYMERASE IV, 5'-D(*CP*AP*(3DR)P*TP*AP*GP*TP*CP*CP*TP*TP*CP*CP* 3', 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*CP*TP*A)-3' TRANSFERASE/DNA Y-FAMILY, DNA POLYMERASE, DNA LESION BYPASS, PROTEIN-DNA COM TRANSFERASE-DNA COMPLEX
1n56	prot-nuc 2.40	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	Y-FAMILY DNA POLYMERASE DPO4 IN COMPLEX WITH DNA CONTAINING ABASIC LESION 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*CP*TP*AP*A)- 3', DNA POLYMERASE IV, 5'-D(*TP*CP*AP*TP*(3DR) P*AP*GP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3' TRANSFERASE/DNA Y-FAMILY, DNA POLYMERASE, DNA LESION BYPASS, PROTEIN-DNA COMPLEX, TRANSFERASE/DNA COMPLEX
1oe4	prot-nuc 2.00	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	XENOPUS SMUG1, AN ANTI-MUTATOR URACIL-DNA GLYCOSYLASE SINGLE-STRAND SELECTIVE MONOFUNCTIONAL URACIL DNA GLYCOSYLASE: RESIDUES 1-247, 5'-D(*CP*GP*GP*AP*CP*TP*3DR*AP*CP*GP*GP*G)-3', 5'-D(*CP*CP*CP*GP*TP*GP*AP*GP*TP*CP*CP*G)-3' HYDROLASE/DNA HYDROLASE-DNA COMPLEX, HYDROLASE, DNA GLYCOSYLASE, SINGLE ST
1oe5	prot-nuc 2.30	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	XENOPUS SMUG1, AN ANTI-MUTATOR URACIL-DNA GLYCOSYLASE 5'-D(*CP*CP*CP*GP*TP*GP*AP*GP*TP*CP*CP*G)-3', 5'-D(*CP*3DRP*GP*GP*AP*CP*TP*3DRP*AP*CP*GP*GP*GP) CHAIN: F, SINGLE-STRAND SELECTIVE MONOFUNCTIONAL URACIL DNA GLYCOSYLASE: RESIDUES 1-247 HYDROLASE/DNA HYDROLASE-DNA COMPLEX, DNA GLYCOSYLASE, SINGLE STRANDED
1oe6	prot-nuc 2.65	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	XENOPUS SMUG1, AN ANTI-MUTATOR URACIL-DNA GLYCOSYLASE 5'-D(*CP*GP*GP*AP*CP*TP*3DRP*AP*CP*GP*GP*G)-3', 5'-D(*CP*CP*CP*GP*TP*GP*AP*GP*TP*CP*CP*G)-3', SINGLE-STRAND SELECTIVE MONOFUNCTIONAL URACIL DNA GLYCOSYLASE: RESIDUES 1-247 HYDROLASE/DNA HYDROLASE-DNA COMPLEX, HYDROLASE, DNA GLYCOSYLASE, SINGLE ST
1p59	prot-nuc 2.50	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURE OF A NON-COVALENT ENDONUCLEASE III-DNA COMPLEX 5'-D(*AP*AP*GP*AP*CP*GP*(5IU)P*GP*GP*AP*C)-3', ENDONUCLEASE III, 5'-D(TP*GP*(5IU)P*CP*CP*AP*(3DR)P*GP*(5IU) P*CP*T)-3' HYDROLASE/DNA DNA REPAIR, DNA GLYCOSYLASE, [4FE-4S] CLUSTER, IRON-SULFUR CLUSTER, HYDROLASE/DNA COMPLEX
1p5w	prot-nuc 3.30	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	THE STRUCTURES OF HOST RANGE CONTROLLING REGIONS OF THE CAPSIDS OF CANINE AND FELINE PARVOVIRUSES AND MUTANTS COAT PROTEIN VP2: SEQUENCE DATABASE RESIDUES 190-737, 5'-D(P*(3DR)P*TP*AP*CP*CP*TP*CP*TP*TP*GP*C)-3' VIRUS/DNA PARVOVIRADE, CANINE PARVOVIRUS, ICOSAHEDRAL VIRUS, VIRUS/DNA COMPLEX
1ph5	prot-nuc 2.30	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END- BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GGGGTTTTG(3DR)GG TELOMERE-BINDING PROTEIN BETA SUBUNIT: RESIDUES 6-224, 5'-D(*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*T)-3', TELOMERE-BINDING PROTEIN ALPHA SUBUNIT, 5'-D(*GP*GP*GP*GP*TP*TP*TP*TP*GP*(3DR)P*GP*G)-3' DNA BINDING PROTEIN/DNA SINGLE STRAND DNA BINDING PROTEIN, PROTEIN DNA INTERACTIONS, SEQUENCE SPECIFICITY, NONCOGNATE, OLIGONUCLEOTIDE AND OLIGOSACCHARIDE BINDING FOLD, OB FOLD, TELOMERES, PROTEIN/DNA, DNA BINDING PROTEIN/DNA COMPLEX
1phj	prot-nuc 2.50	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF THE OXYTRICHA NOVA TELOMERE END- BINDING PROTEIN COMPLEXED WITH NONCOGNATE SSDNA GG(3DR) GTTTTGGGG TELOMERE-BINDING PROTEIN ALPHA SUBUNIT, 5'-D(*GP*GP*(3DR)P*GP*TP*TP*TP*TP*GP*GP*GP*G)-3', 5'-D(*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*T)-3', TELOMERE-BINDING PROTEIN BETA SUBUNIT: RESIDUES 9-224 DNA BINDING PROTEIN/DNA SINGLE STRAND DNA BINDING PROTEIN, PROTEIN DNA INTERACTIONS, SEQUENCE SPECIFICITY, NONCOGNATE, OLIGONUCLEOTIDE AND OLIGOSACCHARIDE BINDING FOLD, OB FOLD, TELOMERES, PROTEIN/DNA, DNA BINDING PROTEIN/DNA COMPLEX
1pjj	prot-nuc 1.90	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	COMPLEX BETWEEN THE LACTOCOCCUS LACTIS FPG AND AN ABASIC SIT CONTAINING DNA. FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE, DNA (5'-D(*GP*CP*GP*AP*GP*AP*AP*AP*CP*AP*AP*AP*GP CHAIN: E, DNA (5'-D(*CP*TP*CP*TP*TP*TP*(3DR)P*TP*TP*TP*CP*T 3') HYDROLASE/DNA DNA REPAIR, FPG, MUTM, ABASIC SITE, HYDROLASE-DNA COMPLEX
1pm5	prot-nuc 1.95	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF WILD TYPE LACTOCOCCUS LACTIS FPG COMPLE TETRAHYDROFURAN CONTAINING DNA FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE: FPG, DNA (5'-D(*GP*CP*GP*AP*GP*AP*AP*AP*CP*AP*AP*AP*GP CHAIN: E, DNA (5'-D(*CP*TP*CP*TP*TP*TP*(3DR)P*TP*TP*TP*CP*T 3') HYDROLASE/DNA DNA REPAIR, FPG, MUTM, ABASIC SITE, HYDROLASE-DNA COMPLEX
1q9x	prot-nuc 2.69	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 4(C5 H11 O6 P)	CRYSTAL STRUCTURE OF ENTEROBACTERIA PHAGE RB69 GP43 DNA POLY COMPLEXED WITH TETRAHYDROFURAN CONTAINING DNA 5'-GCGGACTGCTTAC(DIDEOXYCYTIDINE)-3', DNA POLYMERASE, 5'-AC(TETRAHYDROFURAN)GGTAAGCAGTCCGCGG-3' TRANSFERASE,REPLICATION/DNA PROTEIN-DNA COMPLEX, TRANSFERASE,REPLICATION-DNA COMPLEX
1qum	prot-nuc 1.55	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF ESCHERICHIA COLI ENDONUCLEASE IV IN COM DAMAGED DNA ENDONUCLEASE IV, 5'-D(*CP*GP*TP*CP*C)-3', 5'-D(*(3DR)P*CP*GP*AP*CP*GP*A)-3', 5'-D(*TP*CP*GP*TP*CP*GP*GP*GP*GP*AP*CP*G)-3' HYDROLASE/DNA ENZYME:DNA COMPLEX, TRINUCLEAR ZN CLUSTER, DNA REPAIR ENZYME BARREL, HYDROLASE-DNA COMPLEX
1xzr	prot-nuc model  	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	THEORETICAL MODEL OF BOVINE AP LYASE, BAP1 MUTANT: 176 ARG TO ALA DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, 5'-D(*GP*CP*GP*TP*CP*CP*(3DR) P*CP*GP*AP*CP*GP*AP*CP*G)-3', 5'-D(*GP*TP*CP*GP*TP*CP*GP*GP*GP*GP*AP*CP*GP*C)- 3' LYASE/DNA THEORETICAL MODEL, ENDONUCLEASE, AP LYASE, DNA REPAIR ENZYME
1xzs	prot-nuc model  	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	THEORETICAL MODEL OF BOVINE AP LYASE, BAP1 MUTANT: 282 ASP TO ALA DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE: AP LYASE, 5'-D(*GP*TP*CP*GP*TP*CP*GP*GP*GP*GP*AP*CP*GP*C)- 3', 5'-D(*GP*CP*GP*TP*CP*CP*(3DR) P*CP*GP*AP*CP*GP*AP*CP*G)-3' LYASE/DNA THEORETICAL MODEL, ENDONUCLEASE, AP LYASE, DNA REPAIR ENZYME
1xzt	prot-nuc model  	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	THEORETICAL MODEL OF BOVINE AP LYASE, BAP1 MUTANT: 308 HIS TO ASN DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, 5'-D(*GP*CP*GP*TP*CP*CP*(3DR) P*CP*GP*AP*CP*GP*AP*CP*G)-3', 5'-D(*GP*TP*CP*GP*TP*CP*GP*GP*GP*GP*AP*CP*GP*C)- 3' LYASE/DNA THEORETICAL MODEL, ENDONUCLEASE, AP LYASE, DNA REPAIR ENZYME
1y6f	prot-nuc 2.40	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	ALPHA-GLUCOSYLTRANSFERASE IN COMPLEX WITH UDP-GLUCOSE AND DN CONTAINING AN ABASIC SITE DNA ALPHA-GLUCOSYLTRANSFERASE, 5'-D(*CP*TP*AP*TP*CP*TP*GP*AP*GP*TP*AP*TP*C)-3', 5'-D(*GP*AP*TP*AP*CP*TP*(3DR)P*AP*GP*AP*TP*AP*G)- CHAIN: C TRANSFERASE/DNA TRANSFERASE, TRANSFERASE-DNA COMPLEX
2dtu	prot-nuc 2.37	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 4(C5 H11 O6 P)	CRYSTAL STRUCTURE OF THE BETA HAIRPIN LOOP DELETION VARIANT OF RB69 GP43 IN COMPLEX WITH DNA CONTAINING AN ABASIC SITE ANALOG DNA POLYMERASE, 5'- D(*GP*CP*GP*GP*CP*TP*GP*TP*CP*AP*TP*AP*AP*GP*A)-3', 5'-D(*CP*GP*(3DR) P*CP*TP*TP*AP*TP*GP*AP*CP*AP*GP*CP*CP*GP*CP*G)-3' TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, DNA LESION, BETA HAIRPIN DELETION, TRANSFERASE/DNA COMPLEX
2ibt	prot-nuc 1.70	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON AMINOPURINE AT THE TARGET POSITION AND AN ABASIC SITE ANALO TARGET BASE PARTNER POSITION 5'-D(*GP*TP*TP*CP*GP*(2PR)P*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI, 5'-D(*GP*AP*CP*AP*(3DR)P*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, 2-AMINOPURINE, ABASIC SITE ANALO FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
2ih5	prot-nuc 1.80	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON ABASIC SITE ANALOG AT THE TARGET BASE PARTNER POSITION MODIFICATION METHYLASE TAQI, 5'-D(*GP*TP*TP*CP*GP*AP*TP*GP*TP*C)-3', 5'-D(*GP*AP*CP*AP*(3DR)P*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, ABASIC SITE BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
2np6	prot-nuc 2.10	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON ABASIC SITE ANALOG AT THE TARGET POSITION MODIFICATION METHYLASE TAQI, 5'-D(*GP*AP*CP*AP*TP*CP*GP*(6MA)P*AP*C)-3', 5'-D(*GP*TP*TP*CP*GP*(3DR)P*TP*GP*TP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, ABASIC SITE ANALOG, BASE FLIPPIN NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
2np7	prot-nuc 1.90	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON ABASIC SITE ANALOG AT THE TARGET POSITION AND PYRROLO-DC AT TARGET BASE PARTNER POSITION MODIFICATION METHYLASE TAQI, 5'-D(*GP*TP*TP*CP*GP*(3DR)P*TP*GP*TP*C)-3', 5'-D(*GP*AP*CP*AP*(4PC)P*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, PYRROLO-DC, SITE ANALOG, BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERAS COMPLEX
2nq9	prot-nuc 1.45	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	HIGH RESOLUTION CRYSTAL STRUCTURE OF ESCHERICHIA COLI ENDONUCLEASE IV (ENDO IV) Y72A MUTANT BOUND TO DAMAGED DNA 5'-D(P*(3DR)P*AP*GP*AP*T)-3', 5'-D(*AP*TP*CP*TP*GP*AP*AP*GP*TP*AP*T)-3', 5'-D(*AP*TP*AP*TP*CP*T)-3', ENDONUCLEASE 4 HYDROLASE/DNA TIM-BARREL, TRINUCLEAR ZN ACTIVE SITE, HYDROLASE/DNA COMPLEX
2nqj	prot-nuc 2.45	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF ESCHERICHIA COLI ENDONUCLEASE IV (ENDO IV) E261Q MUTANT BOUND TO DAMAGED DNA 5'-D(*GP*CP*GP*TP*CP*CP*(3DR) P*CP*GP*AP*CP*GP*AP*CP*G)-3', 5'- D(*CP*GP*TP*CP*GP*TP*CP*GP*GP*GP*GP*AP*CP*GP*C)-3', ENDONUCLEASE 4 HYDROLASE TIM_BARREL, TRINUCLEAR ZINC SITE, HYDROLASE
2ofi	prot-nuc 1.85	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF 3-METHYLADENINE DNA GLYCOSYLASE I (TAG) DNA/3MA 5'-D(*CP*CP*GP*TP*TP*AP*GP*TP*CP*CP*GP*C)-3', 3-METHYLADENINE DNA GLYCOSYLASE I, CONSTITUTIVE, 5'-D(*CP*GP*GP*AP*CP*TP*(3DR)P*AP*CP*GP*GP*G)-3' 3-METHYLADENINE DNA GLYCOSYLASE I/DNA 3-METHYLADENINE, DNA REPAIR, GLYCOSYLASE, BASE EXCISION, HEL HAIRPIN-HELIX, 3-METHYLADENINE DNA GLYCOSYLASE I-DNA COMPLE
2oyq	prot-nuc 2.86	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CRYSTAL STRUCTURE OF RB69 GP43 IN COMPLEX WITH DNA WITH 5- NIMP OPPOSITE AN ABASIC SITE ANALOG DNA POLYMERASE, PRIMER DNA, TEMPLATE DNA TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, DNA LESION, NUCLEOTIDE BINDING, 5-NITP, TRANSFERASE/DNA COMPLEX
2ozm	prot-nuc 2.86	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF RB69 GP43 IN COMPLEX WITH DNA WITH 5- NITP OPPOSITE AN ABASIC SITE ANALOG PRIMER DNA, TEMPLATE DNA, DNA POLYMERASE TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, DNA LESION, 5-NITP, TRANSFERASE/DNA COMPLEX
2p5g	prot-nuc 2.80	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF RB69 GP43 IN COMPLEX WITH DNA WITH DAMP OPPOSITE AN ABASIC SITE ANALOG IN A 21MER TEMPLATE DNA POLYMERASE, PRIMER DNA, TEMPLATE DNA TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, DNA LESION, DAMP, TRANSFERASE/DNA COMPLEX
2p5o	prot-nuc 2.80	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CRYSTAL STRUCTURE OF RB69 GP43 IN COMPLEX WITH DNA CONTAININ ABASIC SITE ANALOG PRIMER DNA, DNA POLYMERASE, TEMPLATE DNA TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, DNA LESION, EXONUCLEASE SWITCH, TRANSFERASE-DNA COMPLEX
2p66	prot-nuc 2.50	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	HUMAN DNA POLYMERASE BETA COMPLEXED WITH TETRAHYDROFURAN (ABASIC SITE) CONTAINING DNA DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*CP*C)-3'), DNA (5'-D(P*(3DR)P*GP*TP*CP*GP*G)-3'), DNA (5'- D(*CP*CP*GP*AP*CP*AP*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'), DNA POLYMERASE BETA TRANSFERASE, LYASE/DNA DNA REPAIR, BASE EXCISION REPAIR, DRP LYASE, TRANSFERASE, LYASE/DNA COMPLEX
2rba	prot-nuc 2.79	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURE OF HUMAN THYMINE DNA GLYCOSYLASE BOUND TO ABASIC A UNDAMAGED DNA DNA (5'-D(*DCP*DCP*DAP*DCP*DTP*DGP*DCP*DTP*DCP*DA P*DGP*DTP*DAP*DCP*DAP*DGP*DAP*DGP*DCP*DTP*DGP*DT)-3'), DNA (5'- D(*DCP*DAP*DGP*DCP*DTP*DCP*DTP*DGP*DTP*DAP*DCP*DGP*DTP*DGP* P*DAP*DGP*DTP*DGP*DGP*DA)-3'), G/T MISMATCH-SPECIFIC THYMINE DNA GLYCOSYLASE: CORE DOMAIN HYDROLASE/DNA PROTEIN-DNA COMPLEX, DNA DAMAGE, DNA REPAIR, GLYCOSIDASE, HY NUCLEUS, HYDROLASE-DNA COMPLEX
3a46	prot-nuc 2.20	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CRYSTAL STRUCTURE OF MVNEI1/THF COMPLEX DNA, DNA, FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE HYDROLASE HELIX TWO TURNS HELIX, ZINC-LESS FINGER, HYDROLASE, THF, DNA DNA REPAIR, DNA-BINDING, GLYCOSIDASE, LYASE, MULTIFUNCTIONA
3ei2	prot-nuc 2.60	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURE OF HSDDB1-DRDDB2 BOUND TO A 16 BP ABASIC SITE CONTAINING DNA-DUPLEX DNA DAMAGE-BINDING PROTEIN 2: RESIDUES (-8)-427, 5'-D(*DAP*DAP*DAP*DTP*DGP*DAP*DAP*DTP*(3DR) P*DAP*DAP*DGP*DCP*DAP*DGP*DG)-3', DNA DAMAGE-BINDING PROTEIN 1, 5'- D(*DCP*DCP*DTP*DGP*DCP*DTP*DTP*DTP*DAP*DTP*DTP*DCP*DAP*DTP* DTP*DT)-3' DNA BINDING PROTEIN/DNA UV-DAMAGE, DDB, NUCLEOTIDE EXCISION REPAIR, XERODERMA PIGMENTOSUM, ALTERNATIVE SPLICING, DISEASE MUTATION, DNA DAMAGE, DNA REPAIR, DNA-BINDING, NUCLEUS, PHOSPHOPROTEIN, POLYMORPHISM, WD REPEAT, UBL CONJUGATION PATHWAY, DNA BINDING PROTEIN/DNA COMPLEX
3g6v	prot-nuc 2.20	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	DNA SYNTHESIS ACROSS AN ABASIC LESION BY HUMAN DNA POLYMERAS PRIMER DNA STRAND, TEMPLATE DNA STRAND, DNA POLYMERASE IOTA REPLICATION/DNA DNA POLYMERASE, Y-FAMILY, LESION BYPASS, ABASIC SITE, TERNAR COMPLEX, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA SYNTH DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, METAL- MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, NUCLEUS, SCHIFF BA TRANSFERASE, REPLICATION-DNA COMPLEX
3g6x	prot-nuc 2.08	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	TERNARY COMPLEX OF DNA POLYMERASE IOTA:DNA:DGTP WITH AN ABAS THE TEMPLATING POSITION TEMPLATE DNA STRAND, PRIMER DNA STRAND, DNA POLYMERASE IOTA REPLICATION/DNA DNA POLYMERASE, Y-FAMILY, LESION BYPASS, ABASIC SITE, TERNAR COMPLEX, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA SYNTH DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, METAL- MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, NUCLEUS, SCHIFF BA TRANSFERASE, REPLICATION-DNA COMPLEX
3g6y	prot-nuc 2.10	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	TERNARY COMPLEX OF DNA POLYMERASE IOTA:DNA:DTTP WITH AN ABAS THE TEMPLATING POSITION TEMPLATE DNA STRAND, PRIMER DNA STRAND, DNA POLYMERASE IOTA REPLICATION/DNA DNA POLYMERASE, Y-FAMILY, LESION BYPASS, ABASIC SITE, TERNAR COMPLEX, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA SYNTH DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, METAL- MUTATOR PROTEIN, NUCLEOTIDYLTRANSFERASE, NUCLEUS, SCHIFF BA TRANSFERASE, REPLICATION-DNA COMPLEX
3isc	prot-nuc 2.00	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	BINARY COMPLEX OF HUMAN DNA POLYMERASE BETA WITH AN ABASIC SITE (THF) IN THE GAPPED DNA DNA POLYMERASE BETA, 5'-D(*CP*CP*GP*AP*CP*(3DR) P*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3', 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3', 5'-D(P*GP*TP*CP*GP*G)-3' TRANSFERASE/DNA NUCLEOTIDYL TRANSFERASE, DNA POLYMERASE BETA, ABASIC SITE, TETRAHYDROFURAN, BINARY COMPLEX, GAPPED DNA, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA SYNTHESIS, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, LYASE, MAGNESIUM, METAL- BINDING, METHYLATION, NUCLEOTIDYLTRANSFERASE, NUCLEUS, POLYMORPHISM, SODIUM, TRANSFERASE, TRANSFERASE/DNA COMPLEX
3isd	prot-nuc 2.60	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA WITH AN ABASIC SITE (THF): DAPCPP MISMATCH DNA POLYMERASE BETA, 5'-D(*CP*CP*GP*AP*CP*(3DR) P*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3', 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3', 5'-D(P*GP*TP*CP*GP*G)-3' TRANSFERASE/DNA NUCLEOTIDYL TRANSFERASE, DNA POLYMERASE BETA, ABASIC SITE, TETRAHYDROFURAN, TERNARY COMPLEX, GAPPED DNA, 'A-RULE', DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA SYNTHESIS, DNA- BINDING, DNA-DIRECTED DNA POLYMERASE, LYASE, MAGNESIUM, METAL-BINDING, METHYLATION, NUCLEOTIDYLTRANSFERASE, NUCLEUS, POLYMORPHISM, SODIUM, TRANSFERASE, TRANSFERASE/DNA COMPLEX
3jxz	prot-nuc 1.75	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	BACILLUS CEREUS ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DN CONTAINING AN ABASIC SITE (ACROSS FROM T) ALKYLPURINE DNA GLYCOSYLASE ALKD, DNA (5'-D(*AP*AP*AP*GP*CP*CP*TP*CP*CP*C)-3'), DNA (5'-D(*TP*GP*GP*GP*(3DR)P*GP*GP*CP*TP*T)-3') HYDROLASE/DNA HEAT REPEAT, DNA BINDING, DNA GLYCOSYLASE, DNA ALKYLATION, L COMPLEX, HYDROLASE-DNA COMPLEX
3jy1	prot-nuc 1.75	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	BACILLUS CEREUS ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DN CONTAINING AN ABASIC SITE (ACROSS FROM C) DNA (5'-D(*TP*GP*GP*GP*(3DR)P*GP*GP*CP*TP*T)-3'), DNA (5'-D(*AP*AP*AP*GP*CP*CP*CP*CP*CP*C)-3'), ALKYLPURINE DNA GLYCOSYLASE ALKD HYDROLASE/DNA HEAT REPEAT, DNA BINDING, DNA GLYCOSYLASE, DNA ALKYLATION, L COMPLEX, HYDROLASE-DNA COMPLEX
3k5l	prot-nuc 2.70	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF E.COLI POL II-ABASIC DNA-DATP LT(0, 3) TERNARY COMPLEX DNA (5'- D(*GP*TP*GP*CP*CP*TP*AP*GP*CP*GP*TP*AP*(DOC))-3'), DNA (5'-D(*TP*AP*TP*(3DR) P*GP*TP*AP*CP*GP*CP*TP*AP*GP*GP*CP*AP*CP*A)-3'), DNA POLYMERASE II TRANSFERASE/DNA DNA DAMAGE, DNA REPAIR, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, NUCLEOTIDYLTRANSFERASE, SOS RESPONSE, TRANSFERASE
3k5m	prot-nuc 2.04	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF E.COLI POL II-ABASIC DNA-DDGTP LT(-2, 2) TERNARY COMPLEX DNA (5'- D(*GP*TP*GP*CP*CP*TP*AP*GP*CP*GP*TP*AP*G)-3'), DNA (5'-D(*AP*GP*TP*CP*CP*TP*GP*(3DR) P*AP*CP*GP*CP*TP*AP*GP*GP*CP*AP*CP*A)-3'), DNA POLYMERASE II TRANSFERASE/DNA DNA DAMAGE, DNA REPAIR, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, NUCLEOTIDYLTRANSFERASE, SOS RESPONSE, TRANSFERASE
3lwl	prot-nuc 2.25	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURE OF KLENOW FRAGMENT OF TAQ POLYMERASE IN COMPLEX WI ABASIC SITE DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, UNP RESIDUES 293-832, DNA (5'-D(*AP*AP*AP*(3DR) P*TP*GP*CP*GP*CP*CP*GP*TP*GP*GP*TP*C)-3'), DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DA) CHAIN: B TRANSFERASE/DNA DNA REPLICATION, DNA REPAIR, DNA POLYMERASES, ABASIC SITES, TRANSLESION SYNTHESIS, DNA DAMAGE, DNA-BINDING, DNA-DIRECTE POLYMERASE, AMINO ACID-TEMPLATING MECHANISM, TRANSFERASE-DN
3osp	prot-nuc 2.50	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURE OF REV1 DNA REPAIR PROTEIN REV1: REV1 (UNP RESIDUES 305-738, 5'-D(*TP*AP*AP*(3DR)P*GP*TP*AP*GP*GP*GP*GP*AP*GP* 3', 5'-D(*AP*TP*CP*CP*TP*CP*CP*CP*CP*TP*AP*(DOC))-3' TRANSFERASE/DNA DNA POLYMERASE, DAMAGE BYPASS, DNA, ABASIC SITE, NUCLEUS, TRANSFERASE-DNA COMPLEX
3po5	prot-nuc 2.39	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURE OF A MUTANT OF THE LARGE FRAGMENT OF DNA POLYMERAS THERMUS AUQATICUS IN COMPLEX WITH AN ABASIC SITE AND DDATP DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DA) CHAIN: B: DNA PRIMER, DNA (5'-D(P*(3DR)P*TP*GP*CP*GP*CP*CP*GP*TP*GP*GP* CHAIN: C: DNA TEMPLATE, DNA POLYMERASE I: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, LESION BYPASS, APSITE, ABASIC SITE, TRANSFER COMPLEX
3rr7	prot-nuc 1.95	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	BINARY STRUCTURE OF THE LARGE FRAGMENT OF TAQ DNA POLYMERASE AN ABASIC SITE (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC))-3' CHAIN: B: DNA PRIMER, (5'-D(*AP*AP*AP*(3DR)P*GP*GP*CP*GP*CP*CP*GP*TP*GP 3'): DNA TEMPLATE, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, TRANSLESION SYNTHESIS, TRANSFER COMPLEX
3rr8	prot-nuc 2.40	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	TERNARY STRUCTURE OF THE LARGE FRAGMENT OF TAQ DNA POLYMERAS AN ABASIC SITE AND A DDGTP (5'-D(*AP*AP*AP*(3DR)P*CP*GP*CP*GP*CP*CP*GP*TP*GP 3'): DNA TEMPLATE, (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DDG))-3' CHAIN: B: DNA PRIMER, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, TRANSLESION SYNTHESIS, A-RULE, TRANSFERASE-DNA COMPLEX
3rrg	prot-nuc 2.30	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	TERNARY STRUCTURE OF THE LARGE FRAGMENT OF TAQ DNA POLYMERAS AN ABASIC SITE AND A DDGTP DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, (5'-D(*AP*AP*AP*(3DR)P*CP*GP*CP*GP*CP*CP*GP*TP*GP 3'): DNA TEMPLATE, (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DDG))-3' CHAIN: B: DNA PRIMER TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, TRANSLESION SYNTHESIS, A-RULE, TRANSFERASE-DNA COMPLEX
3rrh	prot-nuc 1.80	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	TERNARY STRUCTURE OF THE LARGE FRAGMENT OF TAQ DNA POLYMERAS AN ABASIC SITE AND A DDTTP (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(2DT))-3' CHAIN: B: DNA PRIMER, (5'-D(*AP*AP*AP*(3DR)P*AP*GP*CP*GP*CP*CP*GP*TP*GP 3'): DNA TEMPLATE, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, TRANSLESION SYNTHESIS, A-RULE, TRANSFERASE-DNA COMPLEX
3s6i	prot-nuc 2.28	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	SCHIZOSACCAROMYCES POMBE 3-METHYLADENINE DNA GLYCOSYLASE (MA COMPLEX WITH ABASIC-DNA. (5'-D(*TP*GP*TP*CP*CP*AP*(3DR)P*GP*TP*CP*T)-3'), (5'-D(*AP*AP*GP*AP*CP*TP*TP*GP*GP*AP*C)-3'), DNA-3-METHYLADENINE GLYCOSYLASE 1 HYDROLASE/DNA DNA GLYCOSYLASE, DNA REPAIR, HELIX-HAIRPIN-HELIX (HHH), ABAS TETRAHYDROFURAN (THF), HYDROLASE-DNA COMPLEX
3t3f	prot-nuc 1.90	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	TERNARY STRUCTURE OF THE LARGE FRAGMENT OF TAQ DNA POLYMERAS AN ABASIC SITE AND DNITP DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT (UNP RESIDUES 293-832), 5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC))-3', 5'-D(*AP*AP*AP*(3DR)P*GP*GP*CP*GP*CP*CP*GP*TP*GP* 3' TRANSFERASE/DNA DNA POLYMERASE, ABASIC SITE, TRANSLESION SYNTHESIS, A-RULE, STACKING, DNITP, NITROINDOL TRIPHOSPHATE, BASE ANALOGUE, TRANSFERASE-DNA COMPLEX
3twm	prot-nuc 2.80	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CRYSTAL STRUCTURE OF ARABIDOPSIS THALIANA FPG 5'-D(*TP*GP*GP*TP*AP*GP*AP*CP*GP*TP*GP*GP*AP*CP*G CHAIN: D, F, 5'-D(*AP*GP*CP*GP*TP*CP*CP*AP*(3DR)P*GP*TP*CP*TP* 3', FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE 1 HYDROLASE/DNA HELIX TWO TURNS HELIX, ZINC-LESS FINGER, HYDROLASE, DNA DAMA REPAIR, DNA-BINDING, GLYCOSIDASE, LYASE, MULTIFUNCTIONAL EN CONTAINING STABLE ANALOG OF ABASIC SITE, TETRAHYDRO FURAN, HYDROLASE-DNA COMPLEX
4a0k	prot-nuc 5.93	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURE OF DDB1-DDB2-CUL4A-RBX1 BOUND TO A 12 BP ABASIC SITE CONTAINING DNA-DUPLEX 12 BP DNA, DNA DAMAGE-BINDING PROTEIN 2: RESIDUES 60-423, CULLIN-4A: RESIDUES 38-759, DNA DAMAGE-BINDING PROTEIN 1, E3 UBIQUITIN-PROTEIN LIGASE RBX1: RESIDUES 12-108, 12 BP THF CONTAINING DNA LIGASE/DNA-BINDING PROTEIN/DNA LIGASE-DNA-BINDING PROTEIN-DNA COMPLEX, DNA-BINDING PROTEIN- COMPLEX
4a0l	prot-nuc 7.40	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	STRUCTURE OF DDB1-DDB2-CUL4B-RBX1 BOUND TO A 12 BP ABASIC SITE CONTAINING DNA-DUPLEX DNA DAMAGE-BINDING PROTEIN 1, E3 UBIQUITIN-PROTEIN LIGASE RBX1: RESIDUES 12-108, 12 BP DNA DUPLEX, 12 BP THF CONTAINING DNA DUPLEX, DNA DAMAGE-BINDING PROTEIN 2: RESIDUES 60-423, CULLIN-4B: RESIDUES 193-913 LIGASE/DNA-BINDING PROTEIN/DNA LIGASE-DNA-BINDING PROTEIN-DNA COMPLEX
4b21	prot-nuc 1.45	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	UNPRECEDENTED SCULPTING OF DNA AT ABASIC SITES BY DNA GLYCOSYLASE HOMOLOG MAG2 PROBABLE DNA-3-METHYLADENINE GLYCOSYLASE 2, 5'-D(*CP*GP*AP*TP*CP*GP*GP*TP*AP*GP)-3', 5'-D(*GP*CP*TP*AP*CP*3DRP*GP*AP*TP*CP*GP)-3' HYDROLASE/DNA HYDROLASE-DNA COMPLEX, HELIX-HAIRPIN-HELIX
4b22	prot-nuc 1.90	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	UNPRECEDENTED SCULPTING OF DNA AT ABASIC SITES BY DNA GLYCOSYLASE HOMOLOG MAG2 5'-D(*GP*CP*TP*AP*CP*(3DR)P*CP*AP*TP*CP*GP)-3', 5'-D(*CP*GP*AP*TP*GP*GP*GP*TP*AP*GP*CP)-3', MAG2, DNA-3-METHYLADENINE GLYCOSYLASE 2 HYDROLASE HYDROLASE, HELIX-HAIRPIN-HELIX DNA GLYCOSYLASE HOMOLOGUE
4b23	prot-nuc 2.00	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	UNPRECEDENTED SCULPTING OF DNA AT ABASIC SITES BY DNA GLYCOSLASE HOMOLOG MAG2 5'-D(*CP*GP*AP*TP*TP*GP*GP*TP*AP*GP*CP)-3', 5'-D(*GP*CP*TP*AP*CP*(3DR)P*AP*AP*TP*CP*GP)-3', MAG2, DNA-3-METHYLADENINE GLYCOSYLASE 2 HYDROLASE/DNA HYDROLASE-DNA COMPLEX, HYDROLASE, HELIX-HAIRPIN-HELIX DNA GLYCOSYLASE HOMOLOGUE
4b24	prot-nuc 2.30	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	UNPRECEDENTED SCULPTING OF DNA AT ABASIC SITES BY DNA GLYCOS HOMOLOG MAG2 PROBABLE DNA-3-METHYLADENINE GLYCOSYLASE 2, 5'-D(*CP*GP*AP*TP*AP*GP*GP*TP*AP*GP)-3', 5'-D(*GP*CP*TP*AP*CP*3DRP*TP*AP*TP*CP*GP)-3' HYDROLASE/DNA HYDROLASE-DNA COMPLEX, HELIX-HAIRPIN-HELIX
4b3o	prot-nuc 3.30	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURES OF HIV-1 RT AND RNA-DNA COMPLEX REVEAL A UNIQUE RT CONFORMATION AND SUBSTRATE INTERFACE REVERSE TRANSCRIPTASE/RIBONUCLEASE H, 5'-R(*AP*UP*GP*AP*3DRP*GP*GP*CP*CP*AP*CP*AP*AP*UP *AP*CP*UP*AP*UP*AP*GP*GP*CP*AP*UP*A)-3', 5'-D(*CP*GP*TP*AP*TP*GP*CP*CP*TP*AP*TP*AP*GP*TP *TP*AP*TP*TP*GP*TP*GP*GP*CP*C)-3', P51 RT HYDROLASE/DNA/RNA HYDROLASE-DNA-RNA COMPLEX, RNASE H, SUBUNIT INTERFACE
4b5f	prot-nuc 2.00	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	SUBSTRATE BOUND NEISSERIA AP ENDONUCLEASE IN ABSENCE OF METAL IONS (CRYSTAL FORM 1) PUTATIVE EXODEOXYRIBONUCLEASE, 5'-D(*GP*CP*TP*AP*CP*3DRP*GP*AP*TP*CP*GP)-3', 5'-D(*CP*GP*AP*TP*CP*GP*GP*TP*AP*GP*CP)-3' HYDROLASE/DNA HYDROLASE-DNA COMPLEX
4b5g	prot-nuc 2.75	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 3(C5 H11 O6 P)	SUBSTRATE BOUND NEISSERIA AP ENDONUCLEASE IN ABSENCE OF METAL IONS (CRYSTAL FORM 2) EXODEOXYRIBONUCLEASE, 5'-D(*GP*CP*TP*AP*CP*(3DR)P*CP*AP*TP*CP*GP)-3', 5'-D(*CP*GP*AP*TP*GP*GP*GP*TP*AP*GP*CP)-3' HYDROLASE/DNA HYDROLASE-DNA COMPLEX
4b5h	prot-nuc 3.05	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	SUBSTATE BOUND INACTIVE MUTANT OF NEISSERIA AP ENDONUCLEASE IN PRESENCE OF METAL IONS 5'-D(*CP*GP*AP*TP*GP*GP*GP*TP*AP*GP*CP)-3', 5'-D(*GP*CP*TP*AP*CP*3DRP*CP*AP*TP*CP*GP)-3', PUTATIVE EXODEOXYRIBONUCLEASE HYDROLASE/DNA HYDROLASE-DNA COMPLEX
4b5i	prot-nuc 2.56	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	PRODUCT COMPLEX OF NEISSERIA AP ENDONUCLEASE IN PRESENCE OF METAL IONS 5'-D(*3DRP*CP*AP*TP*CP*GP)-3', PUTATIVE EXODEOXYRIBONUCLEASE, 5'-D(*CP*GP*AP*TP*GP*GP*GP*TP*AP*GP*CP)-3', 5'-D(*GP*CP*TP*AP*CP)-3' HYDROLASE/DNA HYDROLASE-DNA COMPLEX
4b5j	prot-nuc 2.10	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	NEISSERIA AP ENDONUCLEASE BOUND TO THE SUBSTRATE WITH AN ORPHAN ADENINE BASE PUTATIVE EXODEOXYRIBONUCLEASE, 5'-D(*GP*CP*TP*AP*CP*(3DR)P*CP*AP*TP*CP*GP)-3', 5'-D(*CP*GP*AP*TP*GP*AP*GP*TP*AP*GP*CP)-3' HYDROLASE/DNA HYDROLASE-DNA COMPLEX
4b5m	prot-nuc 2.76	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 3(C5 H11 O6 P)	NEISSERIA AP ENDONUCLEASE BOUND TO THE SUBSTRATE WITH A CYTOSINE ORPHAN BASE 5'-D(*3DRP*CP*AP*TP*CP*GP)-3', PUTATIVE EXODEOXYRIBONUCLEASE, 5'-D(*GP*CP*TP*AP*CP)-3', 5'-D(*CP*GP*AP*TP*GP*CP*GP*TP*AP*GP*CP)-3' HYDROLASE/DNA HYDROLASE-DNA COMPLEX
4dk9	prot-nuc 2.76	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF MBD4 CATALYTIC DOMAIN BOUND TO ABASIC D 5'-D(*TP*GP*TP*CP*CP*AP*(3DR)P*GP*TP*CP*T)-3', METHYL-CPG-BINDING DOMAIN PROTEIN 4: CATALYTIC DOMAIN (UNP RESIDUES 426-580), 5'-D(*AP*AP*GP*AP*CP*GP*TP*GP*GP*AP*C)-3' HYDROLASE/DNA PROTEIN-DNA COMPLEX, HYDROLASE-DNA COMPLEX
4dtj	prot-nuc 1.90	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DTTP OPPOSITE AN AB AND DDT/DA AS THE PENULTIMATE BASE-PAIR DNA POLYMERASE, DNA PRIMER, DNA TEMPLATE TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DTTP, TRANSFERASE-DNA COMPLEX
4dtm	prot-nuc 1.95	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DCTP OPPOSITE AN AB AND DDG/DC AS THE PENULTIMATE BASE-PAIR DNA PRIMER, DNA TEMPLATE, DNA POLYMERASE TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DCTP, TRANSFERASE-DNA COMPLEX
4dtn	prot-nuc 1.96	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DATP OPPOSITE AN AB AND DDA/DT AS THE PENULTIMATE BASE-PAIR DNA PRIMER, DNA TEMPLATE, DNA POLYMERASE TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DATP, TRANSFERASE-DNA COMPLEX
4dto	prot-nuc 2.05	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DCTP OPPOSITE AN AB AND DDA/DT AS THE PENULTIMATE BASE-PAIR DNA PRIMER, DNA TEMPLATE, DNA POLYMERASE TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DATP, TRANSFERASE-DNA COMPLEX
4dtp	prot-nuc 2.05	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DGTP OPPOSITE AN AB AND DDA/DT AS THE PENULTIMATE BASE-PAIR DNA POLYMERASE, DNA PRIMER, DNA TEMPLATE TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DGTP, TRANSFERASE-DNA COMPLEX
4dtr	prot-nuc 2.04	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DATP OPPOSITE AN AB AND DDC/DG AS THE PENULTIMATE BASE-PAIR DNA TEMPLATE, DNA PRIMER, DNA POLYMERASE TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DTTP, TRANSFERASE-DNA COMPLEX
4dts	prot-nuc 1.96	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DCTP OPPOSITE AN AB AND DDC/DG AS THE PENULTIMATE BASE-PAIR DNA POLYMERASE, DNA TEMPLATE, DNA PRIMER TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DCTP, TRANSFERASE-DNA COMPLEX
4dtu	prot-nuc 1.86	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DGTP OPPOSITE AN AB AND DDC/DG AS THE PENULTIMATE BASE-PAIR DNA PRIMER, DNA TEMPALTE, DNA POLYMERASE TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DGTP, TRANSFERASE-DNA COMPLEX
4dtx	prot-nuc 1.84	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DTTP OPPOSITE AN AB AND DDC/DG AS THE PENULTIMATE BASE-PAIR DNA POLYMERASE, DNA TEMPALTE, DNA PRIMER TRANSFERASE/DNA ABASIC SITE, THF, RB69POL, DTTP, TRANSFERASE-DNA COMPLEX
4e54	prot-nuc 2.85	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	DAMAGED DNA INDUCED UV-DAMAGED DNA-BINDING PROTEIN (UV-DDB) DIMERIZATION AND ITS ROLES IN CHROMATINIZED DNA REPAIR DNA DAMAGE-BINDING PROTEIN 2: DNA DAMAGE-BINDING PROTEIN 2 (DDB2, AP24 DNA STRAND: AP24 DNA STRAND, DNA DAMAGE-BINDING PROTEIN 1: DNA DAMAGE-BINDING PROTEIN 1 (DDB1, AP24 DNA COMPLEMENTARY STRAND: AP24 DNA COMPLEMENTARY STRAND DNA BINDING PROTEIN/DNA BETA BARREL, DOUBLE HELIX, DDB1:WD40 BETA-BARREL FOLD, DNA D DNA REPAIR, HOST-VIRUS INTERACTIONS, PROTEIN UBIQUITINATION PROTEOSOMAL DEGRADATION, DNA BINDING PROTEIN-DNA COMPLEX
4e5z	prot-nuc 3.22	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	DAMAGED DNA INDUCED UV-DAMAGED DNA-BINDING PROTEIN (UV-DDB) DIMERIZATION AND ITS ROLES IN CHROMATINIZED DNA REPAIR DNA DAMAGE-BINDING PROTEIN 1, AP24 DNA COMPLEMENTARY STRAND, DNA DAMAGE-BINDING PROTEIN 2, AP24 DNA STRAND DNA BINDING PROTEIN/DNA BETA BARREL, PROTEIN-DNA COMPLEX, DOUBLE HELIX, DAMAGE, DNA HOST-VIRUS INTERACTIONS, PROTEIN UBIQUITINATION, PROTEOSOMA DEGRADATION,, DNA BINDING PROTEIN-DNA COMPLEX
4e9f	prot-nuc 1.79	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURE OF THE GLYCOSYLASE DOMAIN OF MBD4 BOUND TO AP SITE CONTAINING DNA METHYL-CPG-BINDING DOMAIN PROTEIN 4: GLYCOSYLASE DOMAIN OF MBD4 (RESIDUES 426-580), DNA (5'-D(*GP*CP*TP*GP*CP*GP*CP*GP*CP*TP*GP*G)-3' CHAIN: D, DNA (5'-D(*CP*CP*AP*GP*CP*GP*(3DR)P*GP*CP*AP*GP*C CHAIN: C HYDROLASE/DNA HHH DNA GLYCOSYLASE FAMILY, HYDROLASE-DNA COMPLEX
4ejy	prot-nuc 2.00	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	STRUCTURE OF MBOGG1 IN COMPLEX WITH HIGH AFFINITY DNA LIGAND 3-METHYLADENINE DNA GLYCOSYLASE, DNA (5'-D(*AP*GP*CP*GP*TP*CP*CP*AP*(3DR) P*GP*TP*CP*TP*AP*CP*C)-3'), DNA (5'-D(*T*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP* 3') HYDROLASE/DNA 8-OXOGUANINE DNA GLYCOSYLASE, HYDROLASE-DNA COMPLEX
4ejz	prot-nuc 3.05	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	STRUCTURE OF MBOGG1 IN COMPLEX WITH LOW AFFINITY DNA LIGAND DNA (5'-D(*T*GP*GP*TP*AP*GP*AP*CP*TP*TP*GP*GP*AP* 3'), DNA (5'-D(*AP*GP*CP*GP*TP*CP*CP*AP*(3DR) P*GP*TP*CP*TP*AP*CP*C)-3'), 3-METHYLADENINE DNA GLYCOSYLASE HYDROLASE/DNA 8-OXOGUANINE DNA GLYCOSYLASE, DNA, HYDROLASE-DNA COMPLEX
4ew4	prot-nuc 2.79	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	MOUSE MBD4 GLYCOSYLASE DOMAIN IN COMPLEX WITH DNA CONTAINING SUGAR DNA (5'-D(*TP*CP*AP*GP*CP*GP*CP*AP*TP*GP*G)-3'), DNA (5'-D(*CP*CP*AP*TP*GP*(3DR)P*GP*CP*TP*GP*A)-3 CHAIN: C, METHYL-CPG-BINDING DOMAIN PROTEIN 4: GLYCOSYLASE DOMAIN, UNP RESIDUES 411-554 HYDROLASE/DNA STABLE INTERMEDIATE, N-GLYCOSIDIC BOND, HELIX-HAIRPIN-HELIX, GLYCOSYLASE, HYDROLASE-DNA COMPLEX
4hsb	prot-nuc 1.90	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	S. POMBE 3-METHYLADENINE DNA GLYCOSYLASE-LIKE PROTEIN MAG2 B DAMAGED DNA PROBABLE DNA-3-METHYLADENINE GLYCOSYLASE 2, DNA (5'-D(P*CP*CP*CP*GP*TP*TP*AP*GP*TP*CP*C)-3'), DNA (5'-D(P*GP*GP*AP*CP*TP*(3DR)P*AP*CP*GP*GP*G)- CHAIN: B HYDROLASE/DNA HELIX-HAIRPIN-HELIX, NON-SPECIFIC DNA-BINDING MOTIF, HYDROLA COMPLEX
4iem	prot-nuc 2.39	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 4(C5 H11 O6 P)	HUMAN APURINIC/APYRIMIDINIC ENDONUCLEASE (APE1) WITH PRODUCT MG2+ DNA (5'-D(*GP*CP*TP*AP*C)-3'), DNA (5'-D(P*(3DR)P*GP*AP*TP*CP*G)-3'), DNA (5'-D(*CP*GP*AP*TP*CP*GP*GP*TP*AP*GP*C)-3'), DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE HYDROLASE, LYASE/DNA METALLOPROTEIN, DNA DAMAGE, DNA REPAIR, BASE EXCISION REPAIR PROTEIN-DNA, REF1, NUCLEASE, HYDROLASE, LYASE-DNA COMPLEX
4lz1	prot-nuc 1.65	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN THROMBIN AND TH DELETION MUTANT LACKING THYMINE 12 NUCLEOBASE THROMBIN BINDING APTAMER, THROMBIN HEAVY CHAIN, THROMBIN LIGHT CHAIN HYDROLASE/HYDROLASE INHIBITOR/DNA PROTEIN-DNA COMPLEX, BLOOD COAGULATION, APTAMER, INHIBITOR-D COMPLEX, DNA APTAMER, G-QUADRUPLEX, SERINE PROTEASE, HYDROL ABASIC FURAN, DNA THYMINE NUCLEOBASE DELETION, BLOOD, HYDRO COMPLEX, HYDROLASE-HYDROLASE INHIBITOR-DNA COMPLEX
4lz4	prot-nuc 2.56	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN THROMBIN AND TH DELETION MUTANT LACKING THYMINE 3 NUCLEOBASE THROMBIN HEAVY CHAIN, THROMBIN BINDING APTAMER (TBA), THROMBIN LIGHT CHAIN HYDROLASE/HYDROLASE INHIBITOR/DNA PROTEIN-DNA COMPLEX, DNA APTAMER, G-QUADRUPLEX, TBA DELETION SERINE PROTEASE, HYDROLASE, BLOOD COAGULATION, BLOOD, HYDRO COMPLEX, HYDROLASE-HYDROLASE INHIBITOR-DNA COMPLEX
4nrw	prot-nuc 2.85	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	MVNEI1-G86D 5'-D(*CP*GP*TP*CP*CP*AP*(3DR)P*GP*TP*CP*TP*AP*C)- CHAIN: D, F, 5'-D(*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*G)-3', FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE HYDROLASE, LYASE/DNA ZINC-LESS FINGER DOMAIN, DNA GLYCOSYLASE, HELIX TWO-TURNS HE MOTIF, THF, DNA LYASE, HYDROLASE, LYASE-DNA COMPLEX
4pcz	prot-nuc 1.70	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF A COMPLEX BETWEEN R247G LLFPG MUTANT AN CONTAINING DNA DNA (5'-D(*CP*TP*CP*TP*TP*TP*(3DR)P*TP*TP*TP*CP*T 3'), DNA (5'-D(*GP*CP*GP*AP*GP*AP*AP*AP*CP*AP*AP*AP*GP CHAIN: C, FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE HYDROLASE/DNA DNA GLYCOSYLASE, THF, HYDROLASE-DNA COMPLEX
4pd2	prot-nuc 1.65	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF A COMPLEX BETWEEN A C248GH LLFPG MUTANT CONTAINING DNA FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE, DNA (5'-D(*CP*TP*CP*TP*TP*TP*(3DR)P*TP*TP*TP*CP*T 3'), DNA (5'-D(*GP*CP*GP*AP*GP*AP*AP*AP*CP*AP*AP*AP*GP CHAIN: C HYDROLASE/DNA DNA GLYCOSYLASE, HYDROLASE-DNA COMPLEX
4pdg	prot-nuc 2.40	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF A COMPLEX BETWEEN AN INHIBITED LLFPG AN CONTAINING DNA DNA (5'-D(*GP*CP*GP*AP*GP*AP*AP*AP*CP*AP*AP*AP*GP CHAIN: C, DNA (5'-D(*CP*TP*CP*TP*TP*TP*(3DR)P*TP*TP*TP*CP*T 3'), FORMAMIDOPYRIMIDINE-DNA GLYCOSYLASE HYDROLASE/DNA DNA GLYCOSYLASE, HYDROLASE-DNA COMPLEX
4rnm	prot-nuc 2.14	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF HUMAN POLYMERASE ETA INSERTING DAMPNPP DNA TEMPLATE CONTAINING AN ABASIC SITE DNA PRIMAR: AGCGTCAT, DNA TEMPLATE: CAT(3DR)ATGACGCT, DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA PROTEIN, DNA, DNA DAMAGE DNA-DIRECTED DNA POLYMERASE, ADENOS TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SYNTHESIS ( BINDING, ABASIC SITE LESION BYPASS, TRANSFERASE-DNA COMPLEX
4rnn	prot-nuc 1.81	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF HUMAN POLYMERASE ETA INSERTING DGMPNPP DNA TEMPLATE CONTAINING AN ABASIC SITE NUCLEIC ACIDS PRIMAR: AGCGTCAT, NUCLEIC ACIDS TEMPLATE: CAT(3DR)ATGACGCT, DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA PROTEIN, DNA, DNA DAMAGE DNA-DIRECTED DNA POLYMERASE, ADENOS TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SYNTHESIS ( BINDING, ABASIC SITE LESION BYPASS, TRANSFERASE-DNA COMPLEX
4rno	prot-nuc 2.82	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CRYSTAL STRUCTURE OF HUMAN POLYMERASE ETA EXTENDING AN ABASI PAIR BY INSERTING DCTP OPPOSITE TEMPLATE G NUCLEIC ACIDS PRIMAR: AGCGTCAA, NUCLEIC ACIDS TEMPLATE: CATG(3DR)TGACGCT, DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA PROTEIN, DNA, DNA DAMAGE DNA-DIRECTED DNA POLYMERASE, ADENOS TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SYNTHESIS ( BINDING, ABASIC SITE LESION BYPASS, TRANSFERASE-DNA COMPLEX
5ciy	prot-nuc 1.59	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	STRUCTURAL BASIS OF THE RECOGNITION OF H3K36ME3 BY DNMT3B PW DNA (5'-D(P*CP*CP*AP*TP*GP*CP*GP*CP*TP*GP*AP*C)-3 CHAIN: C, DNA (5'-D(P*GP*TP*CP*AP*GP*(3DR)P*GP*CP*AP*TP*GP* CHAIN: D, MODIFICATION METHYLASE HHAI TRANSFERASE/DNA CG-SPECIFICITY, CPG SEQUENCE, C5-METHYLCYTOSINE, NUCLEOTIDE S-ADENOSYL-L-HOMOCYSTEINE, COMPLEX (METHYLTRANSFERASE- DNA) TRANSFERASE-DNA COMPLEX
5cle	prot-nuc 1.73	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DNA CONTAINING AN SITE ANALOG AND A FREE 3-METHYLADENINE NUCLEOBASE DNA (5'-D(*CP*GP*GP*AP*CP*TP*TP*TP*CP*GP*GP*G)-3' CHAIN: C, DNA (5'-D(*CP*CP*CP*GP*AP*(3DR)P*AP*GP*TP*CP*CP*G CHAIN: B, ALKD HYDROLASE/DNA DNA GLYCOSYLASE, HEAT-LIKE REPEAT, PROTEIN-DNA COMPLEX, HYDR COMPLEX
5dff	prot-nuc 1.57	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	HUMAN APE1 PRODUCT COMPLEX DNA (5'-D(P*(3DR)P*CP*GP*AP*CP*GP*GP*AP*TP*CP*C)- CHAIN: D, DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3'), DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, DNA (5'- D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP 3') LYASE/DNA HYDROLASE, LYASE/DNA, LYASE-DNA COMPLEX
5dfh	prot-nuc 1.95	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	HUMAN APE1 MISMATCH PRODUCT COMPLEX DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*T)-3'), DNA (5'-D(P*(3DR)P*CP*GP*AP*CP*GP*GP*AP*TP*CP*C)- CHAIN: D, DNA (5'- D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP 3') LYASE/DNA HYDROLASE, LYASE/DNA, LYASE-DNA COMPLEX
5dfj	prot-nuc 1.85	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	HUMAN APE1 E96Q/D210N MISMATCH SUBSTRATE COMPLEX DNA (5'- D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP 3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*TP*(3DR) P*CP*GP*AP*CP*GP*GP*AP*TP*CP*C)-3'), DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE LYASE/DNA HYDROLASE, LYASE/DNA, LYASE-DNA COMPLEX
5ew1	prot-nuc 2.95	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	HUMAN THROMBIN SANDWICHED BETWEEN TWO DNA APTAMERS: HD22 AND DELTAT3 HD22 (27MER), THROMBIN HEAVY CHAIN, THROMBIN LIGHT CHAIN, HD1-DELTAT3 PROTEIN/DNA PROTEIN-DNA COMPLEX, BLOOD COAGULATION, DNA APTAMER, DNA-INH G-QUADRUPLEX, DUPLEX-QUADRUPLEX JUNCTION, SERINE PROTEASE, HYDROLASE, ABASIC FURAN, HYDROLASE-DNA COMPLEX
5ew2	prot-nuc 3.59	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	HUMAN THROMBIN SANDWICHED BETWEEN TWO DNA APTAMERS: HD22 AND DELTAT12 THROMBIN HEAVY CHAIN, HD22 (27MER), HD1-DELTAT12, THROMBIN LIGHT CHAIN PROTEIN/DNA PROTEIN-DNA COMPLEX, BLOOD COAGULATION, DNA APTAMER, DNA-INH G-QUADRUPLEX, DUPLEX-QUADRUPLEX JUNCTION, SERINE PROTEASE, HYDROLASE, ABASIC FURAN, HYDROLASE-DNA COMPLEX
5ink	prot-nuc 2.15	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	MOUSE TDP2 REACTION PRODUCT (5'-PHOSPHORYLATED DNA)-ABASIC/T COMPLEX DNA (5'-D(P*(3DR)P*CP*GP*AP*AP*TP*TP*CP*G)-3'), TYROSYL-DNA PHOSPHODIESTERASE 2: UNP RESIDUES 118-370 HYDROLASE/DNA HYDROLASE, DNA REPAIR, ENDONUCLEASE/EXONUCLEASE/PHOSPHATASE DOMAIN, HYDROLASE-DNA COMPLEX
5jrg	prot-nuc 2.50	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CRYSTAL STRUCTURE OF THE NUCLEOSOME CONTAINING THE DNA WITH TETRAHYDROFURAN (THF) DNA (145-MER), HISTONE H2B TYPE 1-J, HISTONE H3.1, HISTONE H4, HISTONE H2A TYPE 1-B/E, DNA (145-MER) DNA BINDING PROTEIN/DNA HISTONE FOLD, DNA BINDING, NUCLEUS, CHROMATIN FORMATION, NUC AP-SITE, DNA BINDING PROTEIN-DNA COMPLEX
9mht	prot-nuc 2.39	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	CYTOSINE-SPECIFIC METHYLTRANSFERASE HHAI/DNA COMPLEX CYTOSINE-SPECIFIC METHYLTRANSFERASE HHAI, 5'-D(P*GP*TP*CP*AP*GP*(3DR)P*GP*CP*AP*TP*GP*G)- 3', 5'-D(P*CP*CP*AP*TP*GP*CP*GP*CP*TP*GP*AP*C)-3' TRANSFERASE/DNA TRANSFERASE, METHYLTRANSFERASE, RESTRICTION SYSTEM, COMPLEX (METHYLTRANSFERASE/ DNA), TRANSFERASE/DNA COMPLEX

3GL    (2S,4S)-2-AMINO-4-HYDROXY-PENTANEDIOIC ACID

Code	Class Resolution	Description
2zjp	prot-nuc 3.70	(2S,4S)-2-AMINO-4-HYDROXY-PENTANEDIOIC ACID C5 H9 N O5	THIOPEPTIDE ANTIBIOTIC NOSIHEPTIDE BOUND TO THE LARGE RIBOSO SUBUNIT OF DEINOCOCCUS RADIODURANS 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L19, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L32, RIBOSOMAL 23S RNA, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L27, RIBOSOMAL 5S RNA, 50S RIBOSOMAL PROTEIN L33, 50S RIBOSOMAL PROTEIN L36, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L18, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L21, NOSIHEPTIDE, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L17, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L23 RIBOSOME/ANTIBIOTIC NOSIHEPTIDE, THIOPEPTIDE, THIAZOLE, ANTIBIOTIC, L11, S50, ANTIBACTERIAL, RIBOSOME-ANTIBIOTIC COMPLEX, RIBOSOME, ZINC- TRANSLATION REGULATION, RNA-BINDING

3JY    [(1R)-2-METHOXY-1-{[(1S,3R)-3-(5-METHYL-2,4-DIOXO-3,4- DIHYDROPYRIMIDIN-1(2H)-YL)CYCLOPENTYL]OXY}-2- OXOETHYL]PHOSPHONIC ACID

Code	Class Resolution	Description
4r5p	prot-nuc 2.89	[(1R)-2-METHOXY-1-{[(1S,3R)-3-(5-METHYL-2,4-DIOXO-3,4- DIHYDROPYRIMIDIN-1(2H)-YL)CYCLOPENTYL]OXY}-2- OXOETHYL]PHOSPHONIC ACID 2(C13 H19 N2 O8 P)	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTASE (RT) WITH D NUCLEOSIDE TRIPHOSPHATE MIMIC ALPHA-CARBOXY NUCLEOSIDE PHOS INHIBITOR HIV-1 REVERSE TRANSCRIPTASE, P51 SUBUNIT: UNP RESIDUES 600-1027, 5'-D(*TP*GP*GP*AP*CP*GP*GP*CP*GP*CP*CP*CP*GP*AP*A *GP*GP*AP*CP*TP*G)-3', HIV-1 REVERSE TRANSCRIPTASE, P66 SUBUNIT: UNP RESIDUES 600-1153, 5'-D(*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*( P*CP*GP*CP*CP*G)-3' TRANSFERASE, HYDROLASE/DNA/INHIBITOR ZIDOVUDINE, RT-DNA COMPLEX, AIDS, DNA-DIRECTED DNA POLYMERAS LIPOPROTEIN, HIV, METAL-BINDING, ALPHA-CNP, RIBONUCLEASE H, A-CNP, MULTIFUNCTIONAL ENZYME, NUCLEOTIDYLTRANSFERASE, RNA- POLYMERASE, TRANSFERASE, HYDROLASE-DNA-INHIBITOR COMPLEX
5hro	prot-nuc 2.75	[(1R)-2-METHOXY-1-{[(1S,3R)-3-(5-METHYL-2,4-DIOXO-3,4- DIHYDROPYRIMIDIN-1(2H)-YL)CYCLOPENTYL]OXY}-2- OXOETHYL]PHOSPHONIC ACID 2(C13 H19 N2 O8 P)	STRUCTURE OF HIV-1 REVERSE TRANSCRIPTASE IN COMPLEX WITH A D AND AN ALPHA-CARBOXY NUCLEOSIDE PHOSPHONATE INHIBITOR (ALPH HIV-1 REVERSE TRANSCRIPTASE P51 SUBUNIT, DNA (38-MER), HIV-1 REVERSE TRANSCRIPTASE P66 SUBUNIT TRANSFERASE/TRANSFERASE INHIBITOR RT, DNA APTAMER, NCRTI, NUCLEOTIDE-COMPETING RT INHIBITOR, 2 METHYLCYTIDINE, P51, P66, TRANSFERASE, TRANSFERASE-TRANSFER INHIBITOR COMPLEX

3LK    BC-3205

Code	Class Resolution	Description
4wfb	prot-nuc 3.43	BC-3205 C32 H54 N2 O5 S	THE CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT OF STAP AUREUS IN COMPLEX WITH BC-3205 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L17, 50S RIBOSOMAL PROTEIN L19, 5S RRNA, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L27, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L36, 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L3, 23S RRNA, 50S RIBOSOMAL PROTEIN L18 RIBOSOME RIBOSOME, RNA, BACTERIA

3MO    3-METHYL-1,3-OXAZOLIDIN-2-ONE

Code	Class Resolution	Description
2hos	prot-nuc 1.90	3-METHYL-1,3-OXAZOLIDIN-2-ONE C4 H7 N O2	PHAGE-SELECTED HOMEODOMAIN BOUND TO UNMODIFIED DNA 5'-D(*AP*TP*CP*CP*GP*GP*GP*GP*AP*TP*TP*AP*CP*AP*T *AP*AP*A)-3', SEGMENTATION POLARITY HOMEOBOX PROTEIN ENGRAILED: ENGRAILED HOMEODOMAIN, 5'-D(*TP*TP*TP*TP*GP*CP*CP*AP*TP*GP*TP*AP*AP*TP*C *GP*GP*A)-3' TRANSCRIPTION/DNA HOMEODOMAIN, PHAGE DISPLAY, TRANSCRIPTION-DNA COMPLEX

3QB    LINCOMYCIN

Code	Class Resolution	Description
5hkv	prot-nuc 3.66	LINCOMYCIN C18 H34 N2 O6 S	THE CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT OF STAP AUREUS IN COMPLEX WITH LINCOMYCIN 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L27, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L17, 50S RIBOSOMAL PROTEIN L19, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L22, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L18, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L5 RIBOSOME RIBOSOME, RNA, LINCOMYCIN, ANTIBIOTICS

3TS    (2S,3S,4R,5R,6R)-2-(AMINOMETHYL)-5-AZANYL-6-

Code	Class Resolution	Description
4b3t	prot-nuc 3.00	(2S,3S,4R,5R,6R)-2-(AMINOMETHYL)-5-AZANYL-6- C30 H50 N5 O15 CL1	CRYSTAL STRUCTURE OF THE 30S RIBOSOME IN COMPLEX WITH COMPOU 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*CP*AP*AP*AP)-3', 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: Z, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8 RIBOSOME RIBOSOME, AMINOGLYCOSIDE, ANTIBIOTIC

3TT    [[[[(2R,5S)-5-(4-AZANYL-2-OXIDANYLIDENE-PYRIMIDIN-1- YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL]OXY-OXIDANYL-PHOSPHORYL]AMINO]PHOSPHONIC ACID

Code	Class Resolution	Description
4qwd	prot-nuc 2.05	[[[[(2R,5S)-5-(4-AZANYL-2-OXIDANYLIDENE-PYRIMIDIN-1- YL)-1,3-OXATHIOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL]OXY-OXIDANYL-PHOSPHORYL]AMINO]PHOSPHONIC ACID C8 H15 N4 O11 P3 S	TERNARY CRYSTAL STRUCTURES OF A Y-FAMILY DNA POLYMERASE DPO4 SULFOLOBUS SOLFATARICUS IN COMPLEX WITH DNA AND (-)3TC-PPNP DNA (5'-D(P*GP*GP*CP*TP*AP*CP*AP*GP*GP*AP*CP*TP*C CHAIN: C, DNA (5'- D(P*CP*AP*GP*GP*AP*GP*TP*CP*CP*TP*GP*TP*AP*GP*CP*C)-3'), DNA POLYMERASE IV: DPO4 TRANSFERASE/DNA Y-FAMILY DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

40A    N-[(2S)-2-AMINOPROPYL]-N-[(6-AMINO-9H-PURIN-9-YL) ACETYL]GLYCINE

Code	Class Resolution	Description
3pa0	prot-nuc 1.60	N-[(2S)-2-AMINOPROPYL]-N-[(6-AMINO-9H-PURIN-9-YL) ACETYL]GLYCINE 8(C12 H17 N7 O3)	CRYSTAL STRUCTURE OF CHIRAL GAMMA-PNA WITH COMPLEMENTARY DNA INSIGHT INTO THE STABILITY AND SPECIFICITY OF RECOGNITION A CONFORMATIONAL PREORGANIZATION PEPTIDE NUCLEIC ACID, DNA 5'-D(*AP*TP*CP*TP*GP*TP*GP*GP*TP*C)-3' PEPTIDE NUCLEIC ACID/DNA GAMMA-PNA, DNA, PEPTIDE NUCLEIC ACID-DNA COMPLEX

40C    N-[(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)ACETYL]-N-[(2S)-2- AMINOPROPYL]GLYCINE

Code	Class Resolution	Description
3pa0	prot-nuc 1.60	N-[(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)ACETYL]-N-[(2S)-2- AMINOPROPYL]GLYCINE 6(C11 H17 N5 O4)	CRYSTAL STRUCTURE OF CHIRAL GAMMA-PNA WITH COMPLEMENTARY DNA INSIGHT INTO THE STABILITY AND SPECIFICITY OF RECOGNITION A CONFORMATIONAL PREORGANIZATION PEPTIDE NUCLEIC ACID, DNA 5'-D(*AP*TP*CP*TP*GP*TP*GP*GP*TP*C)-3' PEPTIDE NUCLEIC ACID/DNA GAMMA-PNA, DNA, PEPTIDE NUCLEIC ACID-DNA COMPLEX

40G    N-[(2-AMINO-6-OXO-1,6-DIHYDRO-9H-PURIN-9-YL)ACETYL]-N- [(2S)-2-AMINOPROPYL]GLYCINE

Code	Class Resolution	Description
3pa0	prot-nuc 1.60	N-[(2-AMINO-6-OXO-1,6-DIHYDRO-9H-PURIN-9-YL)ACETYL]-N- [(2S)-2-AMINOPROPYL]GLYCINE 4(C12 H17 N7 O4)	CRYSTAL STRUCTURE OF CHIRAL GAMMA-PNA WITH COMPLEMENTARY DNA INSIGHT INTO THE STABILITY AND SPECIFICITY OF RECOGNITION A CONFORMATIONAL PREORGANIZATION PEPTIDE NUCLEIC ACID, DNA 5'-D(*AP*TP*CP*TP*GP*TP*GP*GP*TP*C)-3' PEPTIDE NUCLEIC ACID/DNA GAMMA-PNA, DNA, PEPTIDE NUCLEIC ACID-DNA COMPLEX

40T    N-[(2S)-2-AMINOPROPYL]-N-[(5-METHYL-2,4-DIOXO-3,4- DIHYDROPYRIMIDIN-1(2H)-YL)ACETYL]GLYCINE

Code	Class Resolution	Description
3pa0	prot-nuc 1.60	N-[(2S)-2-AMINOPROPYL]-N-[(5-METHYL-2,4-DIOXO-3,4- DIHYDROPYRIMIDIN-1(2H)-YL)ACETYL]GLYCINE 2(C12 H18 N4 O5)	CRYSTAL STRUCTURE OF CHIRAL GAMMA-PNA WITH COMPLEMENTARY DNA INSIGHT INTO THE STABILITY AND SPECIFICITY OF RECOGNITION A CONFORMATIONAL PREORGANIZATION PEPTIDE NUCLEIC ACID, DNA 5'-D(*AP*TP*CP*TP*GP*TP*GP*GP*TP*C)-3' PEPTIDE NUCLEIC ACID/DNA GAMMA-PNA, DNA, PEPTIDE NUCLEIC ACID-DNA COMPLEX

42E    [(2R,5S)-5-(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)-1,3- OXATHIOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
5tba	prot-nuc 2.49	[(2R,5S)-5-(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)-1,3- OXATHIOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE C8 H12 N3 O6 P S	POSTCATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA W DNA SUBSTRATE, INCORPORATED (-)3TC AND PPI. DNA POLYMERASE BETA, 16-MER TEMPLATE, 10-MER PRIMER, 5-MER PHOSPHORYLATED DOWNSTREAM PRIMER TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM
5tbc	prot-nuc 1.85	[(2R,5S)-5-(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)-1,3- OXATHIOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE C8 H12 N3 O6 P S	PRECATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA WI DNA SUBSTRATE, INCORPORATED (-)3TC-MP AND AN ANOTHER INCOMI TP NUCLEOTIDE. DNA POLYMERASE BETA, 16- MER TEMPLATE, 10- MER PRIMER, 5-MER PHOSPHORYLATED DOWNSTREAM PRIMER TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM

43X    [(2R,5S)-5-(4-AMINO-5-FLUORO-2-OXOPYRIMIDIN-1(2H)-YL)- 1,3-OXATHIOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
5tbb	prot-nuc 2.39	[(2R,5S)-5-(4-AMINO-5-FLUORO-2-OXOPYRIMIDIN-1(2H)-YL)- 1,3-OXATHIOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE C8 H11 F N3 O6 P S	POSTCATALYTIC TERNARY COMPLEX OF HUMAN DNA POLYMERASE BETA W DNA SUBSTRATE, INCORPORATED (-)FTC AND PPI. 16- MER TEMPLATE, DNA POLYMERASE BETA, 5-MER PHOSPHORYLATED DOWNSTREAM PRIMER, 10- MER PRIMER TRANSFERASE/DNA X-FAMILY, POL BETA, DNA POLYMERASE BETA, TRANSFERASE-DNA COM

47C    2'-DEOXY-N-(PROP-2-EN-1-YLOXY)CYTIDINE 5'- (DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2xo7	prot-nuc 2.85	2'-DEOXY-N-(PROP-2-EN-1-YLOXY)CYTIDINE 5'- (DIHYDROGEN PHOSPHATE) C12 H18 N3 O8 P	CRYSTAL STRUCTURE OF A DA:O-ALLYLHYDROXYLAMINE-DC BASEPAIR I WITH FRAGMENT DNA POLYMERASE I FROM BACILLUS STEAROTHERMOPH DNA POLYMERASE I: RESIDUES 297-876, 5'-D(*GP*AP*CP*CP*AP*TP*47C*CP*CP*T)-3', 5'-D(*AP*GP*GP*AP*AP*TP*GP*GP*TP*CP*A)-3' TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX, EPIGENETICS, PYROSEQUENCING

48Z    2-DEOXY-2-FLUORO-5-O-THIOPHOSPHONO-ALPHA-D- ARABINOFURANOSE

Code	Class Resolution	Description
5dfi	prot-nuc 1.63	2-DEOXY-2-FLUORO-5-O-THIOPHOSPHONO-ALPHA-D- ARABINOFURANOSE C5 H10 F O6 P S	HUMAN APE1 PHOSPHOROTHIOATE SUBSTRATE COMPLEX DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(OMC)P*(48Z P*CP*GP*AP*CP*GP*GP*AP*TP*CP*C)-3'), DNA (5'- D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP 3'), DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE LYASE/DNA HYDROLASE, LYASE/DNA, LYASE-DNA COMPLEX
5dg0	prot-nuc 1.80	2-DEOXY-2-FLUORO-5-O-THIOPHOSPHONO-ALPHA-D- ARABINOFURANOSE C5 H10 F O6 P S	HUMAN APE1 PHOSPHOROTHIOATE SUBSTRATE COMPLEX WITH MN2+ DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(OMC)P*(48Z P*CP*GP*AP*CP*GP*GP*AP*TP*CP*C)-3'), DNA (5'- D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP 3'), DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE: UNP RESIDUES 43-318 HYDROLASE,LYASE/DNA HYDROLASE AND LYASE - DNA COMPLEX, HYDROLASE, LYASE-DNA COMP

4A6    [(1,2,3,4,5,6-ETA)-1-METHYL-4-(PROPAN-2-YL) BENZENE]RUTHENIUM

Code	Class Resolution	Description
4xuj	prot-nuc 3.18	[(1,2,3,4,5,6-ETA)-1-METHYL-4-(PROPAN-2-YL) BENZENE]RUTHENIUM 3(C10 H14 RU)	NUCLEOSOME CORE PARTICLE CONTAINING ADDUCTS FROM TREATMENT W THIOMORPHOLINE-SUBSTITUTED [(ETA-6-P-CYMENE)RU(3-HYDROXY-2- CL] COMPOUND DNA (145-MER), HISTONE H3.2: UNP RESIDUES 2-136, HISTONE H2B 1.1: UNP RESIDUES 2-126, HISTONE H4: UNP RESIDUES 2-103, HISTONE H2A: UNP RESIDUES 2-126, DNA (145-MER) DNA-BINDING PROTEIN/DNA NUCLEOSOME, RUTHENIUM AGENT, DNA-BINDIG PROTEIN-DNA COMPLEX, BINDING PROTEIN-DNA COMPLEX

4BD    5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]THYMIDINE

Code	Class Resolution	Description
3gdx	prot-nuc 2.20	5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]THYMIDINE C11 H17 F2 N2 O13 P3	DNA POLYMERASE BETA WITH A GAPPED DND SUBSTRATE AND DTMP(CF2)PP 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3', 5'- D(*CP*CP*GP*AP*CP*AP*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3', DNA POLYMERASE BETA, 5'-D(P*GP*TP*CP*GP*G)-3' TRANSFERASE/DNA NUCLOETIDYL TRANSFERASE, DNA POLYMERASE, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA SYNTHESIS, DNA-BINDING, DNA- DIRECTED DNA POLYMERASE, LYASE, MAGNESIUM, METAL-BINDING, NUCLEOTIDYLTRANSFERASE, NUCLEUS, POLYMORPHISM, SODIUM, TRANSFERASE, TRANSFERASE/DNA COMPLEX

4BW    2-AMINO-9-[(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-9- (6-AMINO-9H-PURIN-9-YL)-3,5,10,12-TETRAHYDROXY-5,12- DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3,2-D:3',2'-J][1,3,7,9, 2,8]TETRAOXADIPHOSPHACYCLODODECIN-2-YL]-1,9-DIHYDRO- 6H-PURIN-6-ONE

Code	Class Resolution	Description
4yb1	prot-nuc 2.08	2-AMINO-9-[(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-9- (6-AMINO-9H-PURIN-9-YL)-3,5,10,12-TETRAHYDROXY-5,12- DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3,2-D:3',2'-J][1,3,7,9, 2,8]TETRAOXADIPHOSPHACYCLODODECIN-2-YL]-1,9-DIHYDRO- 6H-PURIN-6-ONE C20 H24 N10 O13 P2	20A MUTANT C-DI-GMP VC2 RIBOSWITCH BOUND WITH 3',3'-CGAMP U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A: UNP RESIDUES 7-97, RNA (91-MER) RNA/RNA BINDING PROTEIN RIBOSWITCH, 3', 3'-CGAMP, SPINACH, RNA STRUCTURE, C-DI-GMP, BINDING PROTEIN COMPLEX

4DG    2-[(2-AMINO-6-OXO-1,6-DIHYDRO-9H-PURIN-9-YL) METHOXY]ETHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
3kd1	prot-nuc 2.66	2-[(2-AMINO-6-OXO-1,6-DIHYDRO-9H-PURIN-9-YL) METHOXY]ETHYL DIHYDROGEN PHOSPHATE C8 H12 N5 O6 P	CLOSED BINARY COMPLEX OF AN RB69 GP43 FINGERS DOMAIN MUTANT WITH AN ACYCLIC GMP TERMINATED PRIMER TEMPLATE PAIR. DNA (5'- D(*CP*GP*TP*CP*TP*TP*AP*TP*GP*AP*CP*AP*GP*CP*CP*GP*CP*G)-3' CHAIN: T, DNA POLYMERASE: RB69 GP43 EXO- CHIMERA CONTAINING ELEMENTS FROM T DOMAIN OF THE HUMAN CYTOMEGALOVIRUS DNA POLYMERASE., DNA (5'-D(*GP*CP*GP*GP*CP*TP*GP*TP*CP*AP*TP*AP*AP 3'): ACYCLIC GMP TERMINATED PRIMER DNA TRANSFERASE/DNA GP43, POLYMERASE, HCMV, HUMAN CYTOMEGALOVIRUS, ACYCLOVIR, AC GUANOSINE, FOSCAVIR, FOSCARNET, PHOSPHONOFORMIC ACID, DNA REPLICATION, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, EXON HYDROLASE, NUCLEASE, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, TRANSFERASE-DNA COMPLEX
3kd5	prot-nuc 2.69	2-[(2-AMINO-6-OXO-1,6-DIHYDRO-9H-PURIN-9-YL) METHOXY]ETHYL DIHYDROGEN PHOSPHATE C8 H12 N5 O6 P	CLOSED TERNARY COMPLEX OF AN RB69 GP43 FINGERS DOMAIN MUTANT WITH AN ACYCLIC GMP TERMINATED PRIMER TEMPLATE PAIR AND PHOSPHONOFORMIC ACID. DNA (5'- D(*CP*GP*TP*CP*TP*TP*AP*TP*GP*AP*CP*AP*GP*CP*CP*GP*CP*G)-3' CHAIN: T, DNA POLYMERASE: RB69 GP43 EXO- CHIMERA CONTAINING ELEMENTS FROM T DOMAIN OF THE HUMAN CYTOMEGALOVIRUS DNA POLYMERASE., DNA (5'-D(*GP*CP*GP*GP*CP*TP*GP*TP*CP*AP*TP*AP*AP 3'): ACYCLIC GMP TERMINATED PRIMER DNA TRANSFERASE/DNA POLYMERASE, GP43, HUMAN CYTOMEGALOVIRUS, HCMV, ACYCLIC GUANO ACYCLOVIR, PHOSPHONOFORMIC ACID, FOSCARNET, FOSCAVIR, ANTIV REPLICATION, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, EXON HYDROLASE, NUCLEASE, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, TRANSFERASE-DNA COMPLEX

4DU    1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE

Code	Class Resolution	Description
4du3	prot-nuc 2.02	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C11 H15 N4 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DDTP OPPOSITE DT WI DEAZA-ADENINE AT THE N-1 POSITION OF TEMPLATE STRAND DNA POLYMERASE, DNA TEMPLATE, DNA PRIMER TRANSFERASE/DNA DATP, 3-DEAZAADENINE, TRANSFERASE-DNA COMPLEX
4du4	prot-nuc 2.28	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C11 H15 N4 O6 P	RB69 DNA POLYMERASE TERNARY COMPLEX WITH DATP OPPOSITE DT WI DEAZA-ADENINE AT THE N-3 POSITION OF PRIMER STRAND DNA PRIMER, DNA TEMPLATE, DNA POLYMERASE TRANSFERASE/DNA DATP/DT, 3-DEAZA-ADENINE, TRANSFERASE-DNA COMPLEX

4E9    2'-DEOXY-8-[(7-OXO-7H-BENZO[DE]ANTHRACEN-3-YL) AMINO]GUANOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
5jum	prot-nuc 2.60	2'-DEOXY-8-[(7-OXO-7H-BENZO[DE]ANTHRACEN-3-YL) AMINO]GUANOSINE 5'-(DIHYDROGEN PHOSPHATE) C27 H23 N6 O8 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DCTP N-(2'-DEOXYGUANOSIN-8- YL)-3-AMINOBENZANTHRONE (C8-DG-ABA) DNA POLYMERASE ETA, DNA (5'-D(*C*AP*TP*(4E9)P*AP*TP*GP*AP*CP*GP*CP*T) CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3') TRANSFERASE/DNA ENVIRONMENTAL CARCINOGEN, CATALYTIC DOMAIN, PROTEIN, DNA, DN DNA-DIRECTED DNA POLYMERASE, GUANOSINE TRIPHOSPHATE, Y-FAMI POLYMERASE, TRANS-LESION SYNTHESIS (TLS), POLYMERASE ETA, D BINDING, 3-NITROBENZANTHRONE, N-(2'-DEOXYGUANOSIN-8- YL)-3- AMINOBENZANTHRONE (C8-DG-ABA)., TRANSFERASE-DNA COMPLEX

4MF    1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-METHYL-1H-INDOLE

Code	Class Resolution	Description
2oxm	prot-nuc 2.50	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-METHYL-1H-INDOLE C14 H18 N O6 P	CRYSTAL STRUCTURE OF A UNG2/MODIFIED DNA COMPLEX THAT REPRESENT A STABILIZED SHORT-LIVED EXTRAHELICAL STATE IN EZYMATIC DNA BASE FLIPPING DNA (5'-D(*TP*GP*TP*TP*AP*TP*CP*TP*T)-3'), DNA (5'-D(*AP*AP*AP*GP*AP*TP*(4MF)P*AP*CP*A)-3'), URACIL-DNA GLYCOSYLASE HYDROLASE/DNA ENZYME DNA COMPLEX, UNG2, URACIL DNA GLYCOSYLASE, HYDROLASE/DNA COMPLEX
2oyt	prot-nuc 2.00	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-METHYL-1H-INDOLE C14 H18 N O6 P	CRYSTAL STRUCTURE OF UNG2/DNA(TM) URACIL-DNA GLYCOSYLASE, DNA STRAND1, DNA STRAND2 HYDROLASE/DNA ENZYME-DNA COMPLEX, UNG2, HYDROLASE-DNA COMPLEX

4OC    4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
4dr1	prot-nuc 3.60	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE APO 30S RIBOSOMAL SUBUNIT FROM THER THERMOPHILUS (HB8) 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dr2	prot-nuc 3.25	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr3	prot-nuc 3.35	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr4	prot-nuc 3.97	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, COGNATE TRANSFER RNA ANTICODON STEM-LOO MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr5	prot-nuc 3.45	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED COGNATE RNA ANTICODON STEM-LOOP AND STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*U)-3', 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr6	prot-nuc 3.30	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, NEAR-COGNATE TRANSFER RNA ANTICODON STE MISMATCHED AT THE FIRST CODON POSITION AND STREPTOMYCIN BOU 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*UP*U)-3', 5'-R(P*UP*UP*GP*AP*GP*GP*(PSU)P*GP*G)-3', 30S RIBOSOMAL PROTEIN S10, 5'-R(P*CP*UP*UP*GP*AP*GP*GP*(PSU)P*GP*GP*U)-3', 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr7	prot-nuc 3.75	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED NEAR-CO TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE SECOND C POSITION, AND STREPTOMYCIN BOUND 5'-R(P*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*GP*CP*CP*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 5'-R(*UP*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 5'-R(P*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4duy	prot-nuc 3.39	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4duz	prot-nuc 3.65	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv0	prot-nuc 3.85	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv1	prot-nuc 3.85	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv2	prot-nuc 3.65	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv3	prot-nuc 3.55	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv4	prot-nuc 3.65	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv5	prot-nuc 3.68	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv6	prot-nuc 3.30	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv7	prot-nuc 3.29	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4ji0	prot-nuc 3.49	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji1	prot-nuc 3.14	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji2	prot-nuc 3.64	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji3	prot-nuc 3.35	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji4	prot-nuc 3.69	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji5	prot-nuc 3.85	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji6	prot-nuc 3.55	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji7	prot-nuc 3.50	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji8	prot-nuc 3.74	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4kvb	prot-nuc 4.20	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	THERMUS THERMOPHILUS HB27 30S RIBOSOMAL SUBUNIT LACKING RIBO PROTEIN S17 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, TRANSLATION, 50S RIBOSOMAL SUBUNIT, R
4lf4	prot-nuc 3.34	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf5	prot-nuc 3.75	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf6	prot-nuc 3.31	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf7	prot-nuc 3.15	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf8	prot-nuc 3.15	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf9	prot-nuc 3.28	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfa	prot-nuc 3.65	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfb	prot-nuc 3.01	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfc	prot-nuc 3.60	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4nxm	prot-nuc 3.65	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM A GIDB ( MUTANT OF THERMUS THERMOPHILUS (HB8) RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17 RIBOSOME STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE, DECODING RIBOSOME
4nxn	prot-nuc 3.54	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM A GIDB ( MUTANT OF THERMUS THERMOPHILUS (HB8), BOUND WITH STREPTOMYC RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE, DECODING RIBOSOME-ANTIBIOTIC COMPLEX
4x62	prot-nuc 3.45	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), RNA (5'-D(*AP*AP*AP*UP*UP*U)-3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x64	prot-nuc 3.35	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, RNA (5'-D(*(MA6)P*AP*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x65	prot-nuc 3.35	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, RNA (5'-D(*AP*(MA6)P*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x66	prot-nuc 3.45	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(*AP*AP*(MA6)P*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
5br8	prot-nuc 3.40	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	AMBIENT-TEMPERATURE CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUN THERMUS THERMOPHILUS IN COMPLEX WITH PAROMOMYCIN 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME 30S RIBOSOMAL SUBUNIT, PAROMOMYCIN, AMBIENT TEMPERATURE, SFX ELECTROSPINNING, RIBOSOME
5me0	prot-nuc 13.50	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 1 (30S IC-1) STA GE81112 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, FMET-TRNA, 30S RIBOSOMAL PROTEIN S5 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION
5me1	prot-nuc 13.50	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 2 (30S IC-2) STA GE81112 FMET-TRNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION
5no2	prot-nuc 5.16	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE) 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S6, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME
5no3	prot-nuc 5.16	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE WITHOUT US3) 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S18, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S5, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S16 RIBOSOME RIBOSOME
5no4	prot-nuc 5.16	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE WITH US3) 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S6, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S5, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME
5u4j	prot-nuc 3.70	4N,O2'-METHYLCYTIDINE-5'-MONOPHOSPHATE C11 H18 N3 O8 P	STRUCTURAL BASIS OF CO-TRANSLATIONAL QUALITY CONTROL BY ARFA BOUND TO RIBOSOME 23S RRNA, PEPTIDE CHAIN RELEASE FACTOR 2, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S5, ALTERNATIVE RIBOSOME-RESCUE FACTOR A, P-SITE TRNA FMET, MRNA, 30S RIBOSOMAL PROTEIN S12, 16S RRNA, 30S RIBOSOMAL PROTEIN S4 RIBOSOME RIBOSOME, ARFA, RF2, NONSTOP TRANSLATION

4PC    3-(2'-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-3,7-DIHYDRO-2H-PYRROLO[2,3- D]PYRIMIDIN-2-ONE

Code	Class Resolution	Description
2ih4	prot-nuc 2.10	3-(2'-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-3,7-DIHYDRO-2H-PYRROLO[2,3- D]PYRIMIDIN-2-ONE 2(C12 H16 N3 O7 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON PYRROLO-DC AT THE TARGET BASE PARTNER POSITION 5'-D(*GP*AP*CP*AP*(4PC)P*CP*GP*(6MA)P*AP*C)-3', 5'-D(*GP*TP*TP*CP*GP*AP*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, PYRROLO-DC, FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
2np7	prot-nuc 1.90	3-(2'-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-3,7-DIHYDRO-2H-PYRROLO[2,3- D]PYRIMIDIN-2-ONE C12 H16 N3 O7 P	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON ABASIC SITE ANALOG AT THE TARGET POSITION AND PYRROLO-DC AT TARGET BASE PARTNER POSITION MODIFICATION METHYLASE TAQI, 5'-D(*GP*TP*TP*CP*GP*(3DR)P*TP*GP*TP*C)-3', 5'-D(*GP*AP*CP*AP*(4PC)P*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, PYRROLO-DC, SITE ANALOG, BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERAS COMPLEX

4RT    (1R,2S,5R)-8'-(3-CHLORO-4-FLUOROBENZYL)-6'-HYDROXY-1- (HYDROXYMETHYL)-2'-METHYL-9',10'-DIHYDRO-2'H- SPIRO[BICYCLO[3.1.0]HEXANE-2,3'-IMIDAZO[5,1-A][2, 6]NAPHTHYRIDINE]-1',5',7'(8'H)-TRIONE

Code	Class Resolution	Description
4ztj	prot-nuc 2.67	(1R,2S,5R)-8'-(3-CHLORO-4-FLUOROBENZYL)-6'-HYDROXY-1- (HYDROXYMETHYL)-2'-METHYL-9',10'-DIHYDRO-2'H- SPIRO[BICYCLO[3.1.0]HEXANE-2,3'-IMIDAZO[5,1-A][2, 6]NAPHTHYRIDINE]-1',5',7'(8'H)-TRIONE C24 H23 CL F N3 O5	CRYSTAL STRUCTURE OF THE PROTOTYPE FOAMY VIRUS INTASOME WITH PYRIDINONE AMINAL INHIBITOR PFV INTEGRASE: UNP RESIDUES 752-1143, DNA (5'- D(*TP*GP*CP*GP*AP*AP*AP*TP*TP*CP*CP*AP*TP*GP*AP*CP*A)-3'), DNA (5'- D(*AP*TP*TP*GP*TP*CP*AP*TP*GP*GP*AP*AP*TP*TP*TP*CP*GP*CP*A) CHAIN: C TRANSFERASE/DNA/INHIBITOR TRANSFERASE-DNA COMPLEX, DNA INTEGRATION, VIRAL PROTEIN, RECOMBINATION-INHIBITOR-DNA COMPLEX, TRANSFERASE-DNA-INHIBI COMPLEX

4SC    4'-THIO-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE GROUP

Code	Class Resolution	Description
6mht	prot-nuc 2.05	4'-THIO-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE GROUP C10 H16 N3 O5 P S	TERNARY STRUCTURE OF HHAI METHYLTRANSFERASE WITH ADOHCY AND DNA CONTAINING 4'-THIO-2'DEOXYCYTIDINE AT THE TARGET DNA (5'-D(P*CP*CP*AP*TP*GP*(5CM) P*GP*CP*TP*GP*AP*C)-3'), DNA (5'-D(P*GP*TP*CP*AP*GP*(4SC) P*GP*CP*AP*TP*GP*G)-3'), CYTOSINE-SPECIFIC METHYLTRANSFERASE HHAI TRANSFERASE/DNA TRANSFERASE, METHYLTRANSFERASE, RESTRICTION SYSTEM, COMPLEX (METHYLTRANSFERASE/DNA)

4SU    4-THIOURIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1b23	prot-nuc 2.60	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	E. COLI CYSTEINYL-TRNA AND T. AQUATICUS ELONGATION FACTOR EF TERNARY COMPLEX ELONGATION FACTOR TU, CYSTEINYL TRNA GENE REGULATION/RNA TRANSLATION ELONGATION FACTOR, TRANSFER RNA, PROTEIN SYNTHES REGULATION-RNA COMPLEX
1c0a	prot-nuc 2.40	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	CRYSTAL STRUCTURE OF THE E. COLI ASPARTYL-TRNA SYNTHETASE : TRNAASP : ASPARTYL-ADENYLATE COMPLEX ASPARTYL TRNA, ASPARTYL TRNA SYNTHETASE LIGASE/RNA PROTEIN-RNA COMPLEX, LIGASE/RNA COMPLEX
1efw	prot-nuc 3.00	4-THIOURIDINE-5'-MONOPHOSPHATE 2(C9 H13 N2 O8 P S)	CRYSTAL STRUCTURE OF ASPARTYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS COMPLEXED TO TRNAASP FROM ESCHERICHIA COLI ASPARTYL-TRNA SYNTHETASE, ASPARTYL-TRNA LIGASE/RNA ASPARTYL-TRNA SYNTHETASE, TRNA, PROTEIN/RNA COMPLEX, LIGASE/RNA
1eg0	prot-nuc 11.50	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	FITTING OF COMPONENTS WITH KNOWN STRUCTURE INTO AN 11.5 A CRYO-EM MAP OF THE E.COLI 70S RIBOSOME PROTEIN (S5 RIBOSOMAL PROTEIN), PROTEIN (S4 RIBOSOMAL PROTEIN), PROTEIN (S15 RIBOSOMAL PROTEIN), PROTEIN (RIBOSOMAL PROTEIN L1), PROTEIN (S20 RIBOSOMAL PROTEIN), PROTEIN (RIBOSOMAL PROTEIN L6), FRAGMENT OF 23S RRNA: RESIDUES 1051-1108, PROTEIN (S7 RIBOSOMAL PROTEIN), PROTEIN (S8 RIBOSOMAL PROTEIN), HELIX 95 OF 23S RRNA, PROTEIN (S6 RIBOSOMAL PROTEIN), PROTEIN (RIBOSOMAL PROTEIN L11), PROTEIN (S17 RIBOSOMAL PROTEIN), FRAGMENT OF 16S RRNA HELIX 23: RESIDUES 673-713, FORMYL-METHIONYL-TRNA RIBOSOME 70S RIBOSOME, LOW RESOLUTION MODEL
1gsg	prot-nuc 2.80	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF E.COLI GLUTAMINYL-TRNA SYNTHETASE COMPLEXED WIT AND ATP AT 2.8 ANGSTROMS RESOLUTION TRNAGLN, GLUTAMINYL-TRNA SYNTHETASE LIGASE/RNA PROTEIN-T-RNA COMPLEX, SINGLE STRAND, PROTEIN/RNA, LIGASE-RN
1jgo	prot-nuc 5.60	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, MESSENGER RNA MK27, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S11, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgp	prot-nuc 7.00	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S8, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MV36, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S2 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgq	prot-nuc 5.00	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MF36, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S4, TRNA(PHE), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
2fmt	prot-nuc 2.80	4-THIOURIDINE-5'-MONOPHOSPHATE 2(C9 H13 N2 O8 P S)	METHIONYL-TRNAFMET FORMYLTRANSFERASE COMPLEXED WITH FORMYL- METHIONYL-TRNAFMET METHIONYL-TRNA FMET FORMYLTRANSFERASE, FORMYL-METHIONYL-TRNAFMET2 COMPLEX (METHYLTRANSFERASE/TRNA) COMPLEX (METHYLTRANSFERASE/TRNA), FORMYLTRANSFERASE, INITIATION OF TRANSLATION
2om7	prot-nuc 7.30	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURAL BASIS FOR INTERACTION OF THE RIBOSOME WITH THE SW REGIONS OF GTP-BOUND ELONGATION FACTORS 30S RIBOSOMAL PROTEIN S12, P/E-TRNA, FRAGMENT OF23S RRNA (H95), FRAGMENT OF 16S RRNA (H44), FRAGMENT OF23S RRNA (H76), 30S RIBOSOMAL PROTEIN S2, 50S RIBOSOMAL PROTEIN L1, FRAGMENT OF 16S RRNA (H15), 16S RIBOSOMAL RNA (H5), FRAGMENT OF 16S RRNA (H14), FRAGMENT OF23S RRNA (H42-44), ELONGATION FACTOR G, FRAGMENT OF23S RRNA (H89), FRAGMENT OF23S RRNA (H68) RIBOSOME RNA-PROTEIN COMPLEX, RIBOSOME
3v11	prot-nuc 5.00	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF THE TERNARY INITIATION COMPLEX AIF2:GDPNP:METHI INITIATOR TRNA INITIATOR TRNA, TRANSLATION INITIATION FACTOR 2 SUBUNIT GAMMA, TRANSLATION INITIATION FACTOR 2 SUBUNIT ALPHA, TRANSLATION INITIATION FACTOR 2 SUBUNIT BETA TRANSLATION/RNA GTP BINDING MODULE, INITIATOR TRNA CARRIER, GTP AND TRNA, TRANSLATION-RNA COMPLEX
4jyz	prot-nuc 2.50	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	CRYSTAL STRUCTURE OF E. COLI GLUTAMINYL-TRNA SYNTHETASE BOUN AND NATIVE TRNA(GLN) CONTAINING THE CMNM5S2U34 ANTICODON WO RNA (72-MER), GLUTAMINE--TRNA LIGASE LIGASE/RNA ROSSMANN FOLD, PROTEIN-RNA COMPLEX, AMINOACYL-TRNA SYNTHETAS LIGASE, LIGASE-RNA COMPLEX
5lmq	prot-nuc 4.20	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF BACTERIAL 30S-IF1-IF3-MRNA-TRNA TRANSLATION PRE INITIATION COMPLEX, OPEN FORM (STATE-2A) 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S10, MRNA, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, TRNA, 30S RIBOSOMAL PROTEIN S13 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lmr	prot-nuc 4.45	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF BACTERIAL 30S-IF1-IF3-MRNA-TRNA TRANSLATION PRE INITIATION COMPLEX(STATE-2B) TRNAI, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, MRNA, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S17 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lms	prot-nuc 5.10	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF BACTERIAL 30S-IF1-IF3-MRNA-TRNA TRANSLATION PRE INITIATION COMPLEX(STATE-2C) 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, TRNAI, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S17, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, MRNA RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lmt	prot-nuc 4.15	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF BACTERIAL 30S-IF1-IF3-MRNA-TRNA TRANSLATION PRE INITIATION COMPLEX(STATE-3) 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, TRNAI, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S10, MRNA, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-3 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lmu	prot-nuc 4.00	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF BACTERIAL 30S-IF3-MRNA-TRNA TRANSLATION PRE-INI COMPLEX, CLOSED FORM (STATE-4) 30S RIBOSOMAL PROTEIN S13, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, TRNAI, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, MRNA, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lmv	prot-nuc 4.90	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF BACTERIAL 30S-IF1-IF2-IF3-MRNA-TRNA TRANSLATION INITIATION COMPLEX(STATE-III) 30S RIBOSOMAL PROTEIN S8, TRNAI, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-3, TRANSLATION INITIATION FACTOR IF-1, 30S RIBOSOMAL PROTEIN S5, TRANSLATION INITIATION FACTOR IF-2, MRNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF2, IF PIC, THERMUS THERMOPHILUS
5me0	prot-nuc 13.50	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 1 (30S IC-1) STA GE81112 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, FMET-TRNA, 30S RIBOSOMAL PROTEIN S5 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION
5me1	prot-nuc 13.50	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 2 (30S IC-2) STA GE81112 FMET-TRNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION

4U3    5-CHLORO-2'-DEOXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
5bol	prot-nuc 1.98	5-CHLORO-2'-DEOXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 CL N3 O7 P	DNA POLYMERASE BETA TERNARY COMPLEX WITH A TEMPLATING 5CLC A INCOMING DGTP ANALOG DNA (5'-D(*CP*CP*GP*AP*CP*(CDO) P*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3')DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3'), DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3') TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX
5bom	prot-nuc 2.00	5-CHLORO-2'-DEOXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 CL N3 O7 P	DNA POLYMERASE BETA BINARY COMPLEX WITH A TEMPLATING 5CLC DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3'), DNA POLYMERASE BETA, DNA (5'-D(*CP*CP*GP*AP*CP*(4U3) P*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') TRANSFERASE, LYASE/DNA TRANSFERASE, LYASE/DNA, LYASE-DNA COMPLEX
5bpc	prot-nuc 2.00	5-CHLORO-2'-DEOXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 CL N3 O7 P	DNA POLYMERASE BETA TERNARY COMPLEX WITH A TEMPLATING 5CLC A INCOMING DATP ANALOG DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3'), DNA POLYMERASE BETA, DNA (5'-D(*CP*CP*GP*AP*CP*(CDO) P*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') TRANSFERASE, LIGASE/DNA TRANSFERASE, LYASE/DNA, LIGASE-DNA COMPLEX

4Y3    [[(2S,5R)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)OXOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE

Code	Class Resolution	Description
5c53	prot-nuc 3.57	[[(2S,5R)-5-(4-AZANYL-5-FLUORANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)OXOLAN-2-YL]METHOXY-OXIDANYL- PHOSPHORYL] PHOSPHONO HYDROGEN PHOSPHATE C9 H15 F N3 O12 P3	PROBING THE STRUCTURAL AND MOLECULAR BASIS OF NUCLEOTIDE SEL BY HUMAN MITOCHONDRIAL DNA POLYMERASE GAMMA DNA (26-MER), POL GAMMA B, DNA (5'- D(*AP*AP*AP*AP*CP*GP*AP*GP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*GP 3'), DNA POLYMERASE SUBUNIT GAMMA-1 TRANSFERASE/DNA NUCLEOSIDE REVERSE TRANSCRIPTASE INHIBITORS (NRTIS), HIV REV TRANSCRIPTASE (RT), HUMAN MITOCHONDRIAL DNA POLYMERASE, MITOCHONDRIAL TOXICITY, DRUG EFFICACY AND TOXICITY, TRANSFE TRANSFERASE-DNA COMPLEX

50M    (2R,4S,4AS,5R)-6'-HYDROXY-2,4-DIMETHYL-8-NITRO-1,2,4, 4A-TETRAHYDRO-2'H,6H-SPIRO[1,4-OXAZINO[4,3- A]QUINOLINE-5,5'-PYRIMIDINE]-2',4'(3'H)-DIONE

Code	Class Resolution	Description
5cdo	prot-nuc 3.15	(2R,4S,4AS,5R)-6'-HYDROXY-2,4-DIMETHYL-8-NITRO-1,2,4, 4A-TETRAHYDRO-2'H,6H-SPIRO[1,4-OXAZINO[4,3- A]QUINOLINE-5,5'-PYRIMIDINE]-2',4'(3'H)-DIONE C17 H18 N4 O6	3.15A STRUCTURE OF QPT-1 WITH S.AUREUS DNA GYRASE AND DNA DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B: RESIDUES 417-638,RESIDUES 417-638, DNA (5'- D(P*GP*AP*GP*CP*GP*TP*AP*C*GP*GP*CP*CP*GP*TP*AP*CP*GP*CP*TP CHAIN: E, F, V, W, DNA GYRASE SUBUNIT A ISOMERASE TYPE IIA TOPOISOMERASE, ANTIBACTERIAL, INHIBITOR, ISOMERASE

53L    (2R,4S,4AS,5S)-6'-HYDROXY-2,4-DIMETHYL-8-NITRO-1,2,4, 4A-TETRAHYDRO-2'H,6H-SPIRO[1,4-OXAZINO[4,3- A]QUINOLINE-5,5'-PYRIMIDINE]-2',4'(3'H)-DIONE

Code	Class Resolution	Description
5cdo	prot-nuc 3.15	(2R,4S,4AS,5S)-6'-HYDROXY-2,4-DIMETHYL-8-NITRO-1,2,4, 4A-TETRAHYDRO-2'H,6H-SPIRO[1,4-OXAZINO[4,3- A]QUINOLINE-5,5'-PYRIMIDINE]-2',4'(3'H)-DIONE C17 H18 N4 O6	3.15A STRUCTURE OF QPT-1 WITH S.AUREUS DNA GYRASE AND DNA DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B: RESIDUES 417-638,RESIDUES 417-638, DNA (5'- D(P*GP*AP*GP*CP*GP*TP*AP*C*GP*GP*CP*CP*GP*TP*AP*CP*GP*CP*TP CHAIN: E, F, V, W, DNA GYRASE SUBUNIT A ISOMERASE TYPE IIA TOPOISOMERASE, ANTIBACTERIAL, INHIBITOR, ISOMERASE

53M    (2R,4S,4AS)-4',6'-DIHYDROXY-2,4-DIMETHYL-8-NITRO-1,2,4, 4A-TETRAHYDRO-2'H,6H-SPIRO[1,4-OXAZINO[4,3- A]QUINOLINE-5,5'-PYRIMIDIN]-2'-ONE

Code	Class Resolution	Description
5cdo	prot-nuc 3.15	(2R,4S,4AS)-4',6'-DIHYDROXY-2,4-DIMETHYL-8-NITRO-1,2,4, 4A-TETRAHYDRO-2'H,6H-SPIRO[1,4-OXAZINO[4,3- A]QUINOLINE-5,5'-PYRIMIDIN]-2'-ONE 2(C17 H18 N4 O6)	3.15A STRUCTURE OF QPT-1 WITH S.AUREUS DNA GYRASE AND DNA DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B: RESIDUES 417-638,RESIDUES 417-638, DNA (5'- D(P*GP*AP*GP*CP*GP*TP*AP*C*GP*GP*CP*CP*GP*TP*AP*CP*GP*CP*TP CHAIN: E, F, V, W, DNA GYRASE SUBUNIT A ISOMERASE TYPE IIA TOPOISOMERASE, ANTIBACTERIAL, INHIBITOR, ISOMERASE

54K    7-METHYL-3H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE

Code	Class Resolution	Description
5cl4	prot-nuc 1.87	7-METHYL-3H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C7 H8 N4	ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DNA CONTAINING A 3 METHYLADENINE ANALOG OR DNA CONTAINING AN ABASIC SITE AND A NUCLEOBASE (71% SUBSTRATE/29% PRODUCT AT 24 HOURS) DNA (5'-D(*CP*CP*CP*GP*AP*(DZM)P*AP*GP*TP*CP*CP*G CHAIN: B, DNA (5'-D(*CP*GP*GP*AP*CP*TP*TP*TP*CP*GP*GP*G)-3' CHAIN: C, ALKD HYDROLASE/DNA DNA GLYCOSYLASE, HEAT-LIKE REPEAT, PROTEIN-DNA COMPLEX, HYDR COMPLEX
5cl5	prot-nuc 1.57	7-METHYL-3H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C7 H8 N4	ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DNA CONTAINING A 3 METHYLADENINE ANALOG OR DNA CONTAINING AN ABASIC SITE AND A NUCLEOBASE (51% SUBSTRATE/49% PRODUCT AT 48 HOURS) ALKD, DNA (5'-D(*CP*CP*CP*GP*AP*(DZM)P*AP*GP*TP*CP*CP*G CHAIN: B: SEE SEQUENCE DETAILS, DNA (5'-D(*CP*GP*GP*AP*CP*TP*TP*TP*CP*GP*GP*G)-3' CHAIN: C HYDROLASE/DNA DNA GLYCOSYLASE, HEAT-LIKE REPEAT, PROTEIN-DNA COMPLEX, HYDR COMPLEX
5cl6	prot-nuc 1.54	7-METHYL-3H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C7 H8 N4	ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DNA CONTAINING A 3 METHYLADENINE ANALOG OR DNA CONTAINING AN ABASIC SITE AND A NUCLEOBASE (33% SUBSTRATE/67% PRODUCT AT 72 HOURS) ALKD, DNA (5'-D(*CP*GP*GP*AP*CP*TP*TP*TP*CP*GP*GP*G)-3' CHAIN: C, DNA (5'-D(*CP*CP*CP*GP*AP*(DZM)P*AP*GP*TP*CP*CP*G CHAIN: B HYDROLASE/DNA DNA GLYCOSYLASE, HEAT-LIKE REPEAT, PROTEIN-DNA COMPLEX, HYDR COMPLEX
5cl7	prot-nuc 1.44	7-METHYL-3H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C7 H8 N4	ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DNA CONTAINING A 3 METHYLADENINE ANALOG OR DNA CONTAINING AN ABASIC SITE AND A NUCLEOBASE (18% SUBSTRATE/82% PRODUCT AT 96 HOURS) ALKD, DNA (5'-D(*CP*CP*CP*GP*AP*(DZM)P*AP*GP*TP*CP*CP*G CHAIN: B, DNA (5'-D(*CP*GP*GP*AP*CP*TP*TP*TP*CP*GP*GP*G)-3' CHAIN: C HYDROLASE/DNA DNA GLYCOSYLASE, HEAT-LIKE REPEAT, PROTEIN-DNA COMPLEX, HYDR COMPLEX
5cl8	prot-nuc 1.38	7-METHYL-3H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C7 H8 N4	ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DNA CONTAINING AN SITE AND A FREE NUCLEOBASE (100% PRODUCT AT 144 HOURS) DNA (5'-D(*CP*GP*GP*AP*CP*TP*TP*TP*CP*GP*GP*G)-3' CHAIN: C, DNA (5'-D(*CP*CP*CP*GP*AP*(ORP)P*AP*GP*TP*CP*CP*G CHAIN: B, ALKD HYDROLASE/DNA DNA GLYCOSYLASE, HEAT-LIKE REPEAT, PROTEIN-DNA COMPLEX, HYDR COMPLEX
5cl9	prot-nuc 1.54	7-METHYL-3H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C7 H8 N4	ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DNA CONTAINING AN SITE AND A FREE NUCLEOBASE (100% PRODUCT AT 240 HOURS) ALKD, DNA (5'-D(*CP*CP*CP*GP*AP*(ORP)P*AP*GP*TP*CP*CP*G CHAIN: B, DNA (5'-D(*CP*GP*GP*AP*CP*TP*TP*TP*CP*GP*GP*G)-3' CHAIN: C HYDROLASE/DNA DNA GLYCOSYLASE, HEAT-LIKE REPEAT, PROTEIN-DNA COMPLEX, HYDR COMPLEX
5cla	prot-nuc 1.54	7-METHYL-3H-IMIDAZO[4,5-C]PYRIDIN-4-AMINE C7 H8 N4	ALKYLPURINE DNA GLYCOSYLASE ALKD BOUND TO DNA CONTAINING AN SITE AND A FREE NUCLEOBASE (100% PRODUCT AT 360 HOURS) DNA (5'-D(*CP*GP*GP*AP*CP*TP*TP*TP*CP*GP*GP*G)-3' CHAIN: C, DNA (5'-D(*CP*CP*CP*GP*AP*(ORP)P*AP*GP*TP*CP*CP*G CHAIN: B, ALKD HYDROLASE/DNA DNA GLYCOSYLASE, HEAT-LIKE REPEAT, PROTEIN-DNA COMPLEX, HYDR COMPLEX

54Q    (2R,4S,4AS)-2,4-DIMETHYL-8-NITRO-1,2,4,4A-TETRAHYDRO- 2'H,6H-SPIRO[1,4-OXAZINO[4,3-A]QUINOLINE-5,5'- PYRIMIDINE]-2',4',6'(1'H,3'H)-TRIONE

Code	Class Resolution	Description
5cdm	prot-nuc 2.50	(2R,4S,4AS)-2,4-DIMETHYL-8-NITRO-1,2,4,4A-TETRAHYDRO- 2'H,6H-SPIRO[1,4-OXAZINO[4,3-A]QUINOLINE-5,5'- PYRIMIDINE]-2',4',6'(1'H,3'H)-TRIONE 2(C17 H18 N4 O6)	2.5A STRUCTURE OF QPT-1 WITH S.AUREUS DNA GYRASE AND DNA DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B, DNA (5'- D(P*GP*AP*GP*CP*GP*TP*AP*C*GP*GP*CP*CP*GP*TP*AP*CP*GP*CP*TP CHAIN: I, N, DNA (5'- D(P*GP*AP*GP*CP*GP*TP*AP*C*GP*GP*CP*CP*GP*TP*AP*CP*GP*CP*TP CHAIN: E, F, DNA GYRASE SUBUNIT A ISOMERASE TYPE IIA TOPOISOMERASE, ANTIBACTERIAL, INHIBITOR, ISOMERASE

56B    2-AMINO-5-({[(1S,4S,5R)-4,5-DIHYDROXYCYCLOPENT-2-EN-1- YL]AMINO}METHYL)-7-(5-O-PHOSPHONO-BETA-D- RIBOFURANOSYL)-3,7-DIHYDRO-4H-PYRROLO[2,3-D]PYRIMIDIN- 4-ONE

Code	Class Resolution	Description
5d0b	prot-nuc 2.65	2-AMINO-5-({[(1S,4S,5R)-4,5-DIHYDROXYCYCLOPENT-2-EN-1- YL]AMINO}METHYL)-7-(5-O-PHOSPHONO-BETA-D- RIBOFURANOSYL)-3,7-DIHYDRO-4H-PYRROLO[2,3-D]PYRIMIDIN- 4-ONE C17 H24 N5 O10 P	CRYSTAL STRUCTURE OF EPOXYQUEUOSINE REDUCTASE WITH A TRNA-TY EPOXYQUEUOSINE-MODIFIED TRNA STEM LOOP EPOXYQUEUOSINE REDUCTASE, RNA (5'-D(*GP*CP*AP*GP*AP*CP*UP*(56B) P*UP*AP*AP*AP*UP*CP*UP*GP*C)-3') OXIDOREDUCTASE/RNA B12, TRNA MODIFICATION, HEAT-DOMAIN, QUEUOSINE, OXIDOREDUCTA COMPLEX

574    [(3AS,4R,6R,6AR)-2-{2-[(1S)-2-AMINO-1- HYDROXYETHYL]PHENYL}-6-(6-AMINO-9H-PURIN-9-YL) TETRAHYDROFURO[3,4-D][1,3,2]DIOXABOROL-4-YL]METHYL DIHYDROGEN PHOSPHITE

Code	Class Resolution	Description
3zjt	prot-nuc 2.20	[(3AS,4R,6R,6AR)-2-{2-[(1S)-2-AMINO-1- HYDROXYETHYL]PHENYL}-6-(6-AMINO-9H-PURIN-9-YL) TETRAHYDROFURO[3,4-D][1,3,2]DIOXABOROL-4-YL]METHYL DIHYDROGEN PHOSPHITE C18 H22 B N6 O8 P	TERNARY COMPLEX OF E .COLI LEUCYL-TRNA SYNTHETASE, TRNA(LEU) 574 THE BENZOXABOROLE AN3017 IN THE EDITING CONFORMATION TRNALEU5 UAA ISOACCEPTOR, LEUCYL-TRNA SYNTHETASE LIGASE/RNA LIGASE-RNA COMPLEX, NUCLEOTIDE (ATP) -BINDING, PROTEIN BIOSY CLASS I AMINOACYL-TRNA SYNTHETASE, AMINOACYL TRNA SYNTHETAS BINDING, EDITING SYNTHETASE

5AA    N6-DIMETHYL-3'-AMINO-ADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1vq4	prot-nuc 2.70	N6-DIMETHYL-3'-AMINO-ADENOSINE-5'-MONOPHOSPHATE C12 H19 N6 O6 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DAA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L2P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L15P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L21E, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3'), 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L3P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq5	prot-nuc 2.60	N6-DIMETHYL-3'-AMINO-ADENOSINE-5'-MONOPHOSPHATE C12 H19 N6 O6 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "RAA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L23P, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3' CHAIN: 4, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq6	prot-nuc 2.70	N6-DIMETHYL-3'-AMINO-ADENOSINE-5'-MONOPHOSPHATE C12 H19 N6 O6 P	THE STRUCTURE OF C-HPMN AND CCA-PHE-CAP-BIO BOUND TO THE LAR RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L15E, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L14P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L19E, 5'-R(*CP*(5AA)*(HFA))-3', 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L39E, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3', 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L44E RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
1vq7	prot-nuc 2.50	N6-DIMETHYL-3'-AMINO-ADENOSINE-5'-MONOPHOSPHATE C12 H19 N6 O6 P	THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DCA" BOUND T LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L29P, ACIDIC RIBOSOMAL PROTEIN P0 HOMOLOG, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L13P, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L7AE, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3'), 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L14P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L4E, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L5P RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL TRANSFERASE REACTION, RIBOSOME
3i55	prot-nuc 3.11	N6-DIMETHYL-3'-AMINO-ADENOSINE-5'-MONOPHOSPHATE C12 H19 N6 O6 P	CO-CRYSTAL STRUCTURE OF MYCALAMIDE A BOUND TO THE LARGE RIBOSOMAL SUBUNIT 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L18P, DNA/RNA (5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2) P*AP*CP*C)-3'), 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L10E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L4P, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L39E, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L18E RIBOSOME/ANTIBIOTIC LARGE RIBOSOMAL SUBUNIT, MYCALAMIDE A, RIBONUCLEOPROTEIN, RIBOSOMAL PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METAL-BINDING, ZINC, ZINC-FINGER, ACETYLATION, RIBOSOME- ANTIBIOTIC COMPLEX

5AD    5'-DEOXYADENOSINE

Code	Class Resolution	Description
5c8e	prot-nuc 3.89	5'-DEOXYADENOSINE 8(C10 H13 N5 O3)	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS CARH BOUND TO ADENOSYLCOBALAMIN AND A 26-BP DNA SEGMENT LIGHT-DEPENDENT TRANSCRIPTIONAL REGULATOR CARH, 26-MER DNA SEGMENT CONTAINING THE CARH OPERATOR S (ANTISENSE STRAND), 26-MER DNA SEGMENT CONTAINING THE CARH OPERATOR S (SENSE STRAND) TRANSCRIPTION REGULATOR/DNA TRANSCRIPTION FACTOR, LIGHT SENSOR, ADENOSYLCOBALAMIN-BINDIN BINDING, TRANSCRIPTION REGULATOR-DNA COMPLEX
5hr6	prot-nuc 2.88	5'-DEOXYADENOSINE 2(C10 H13 N5 O3)	X-RAY CRYSTAL STRUCTURE OF C118A RLMN WITH CROSS-LINKED TRNA FROM ESCHERICHIA COLI TRNA GLU, RLMN METHYLASE TRANSFERASE/RNA PROTEIN-RNA COMPLEX, RADICAL SAM ENZYME, TRANSFER RNA, IRON- CLUSTER, TRANSFERASE-RNA COMPLEX
5hr7	prot-nuc 2.40	5'-DEOXYADENOSINE 2(C10 H13 N5 O3)	X-RAY CRYSTAL STRUCTURE OF C118A RLMN FROM ESCHERICHIA COLI CROSS-LINKED IN VITRO TRANSCRIBED TRNA DUAL-SPECIFICITY RNA METHYLTRANSFERASE RLMN, TRNA GLU OXIDOREDUCTASE/RNA PROTEIN-RNA COMPLEX, RADICAL SAM ENZYME, TRANSFER RNA, IRON- CLUSTER, OXIDOREDUCTASE-RNA COMPLEX

5BU    5-BROMO-URIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1jid	prot-nuc 1.80	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	HUMAN SRP19 IN COMPLEX WITH HELIX 6 OF HUMAN SRP RNA HELIX 6 OF HUMAN SRP RNA, SIGNAL RECOGNITION PARTICLE 19 KDA PROTEIN: 24 C-TERMINAL RESIDUES TRUNCATED SIGNALING PROTEIN/RNA SIGNAL RECOGNITION PARTICLE (SRP), PROTEIN-RNA COMPLEX, GGAG TETRALOOP, SIGNALING PROTEIN/RNA COMPLEX
1rlg	prot-nuc 2.70	5-BROMO-URIDINE-5'-MONOPHOSPHATE 6(C9 H12 BR N2 O9 P)	MOLECULAR BASIS OF BOX C/D RNA-PROTEIN INTERACTION: CO- CRYSTAL STRUCTURE OF THE ARCHAEAL SRNP INTIATION COMPLEX 50S RIBOSOMAL PROTEIN L7AE, 25-MER STRUCTURAL PROTEIN/RNA PROTEIN-RNA, STRUCTURAL PROTEIN/RNA COMPLEX
2anr	prot-nuc 1.94	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	CRYSTAL STRUCTURE (II) OF NOVA-1 KH1/KH2 DOMAIN TANDEM WITH HAIRPIN NEURO-ONCOLOGICAL VENTRAL ANTIGEN 1: KH1/KH2 DOMAINS, 5'-R(*CP*(5BU) P*CP*GP*CP*GP*GP*AP*UP*CP*AP*GP*UP*CP*AP*CP*CP*CP*AP*AP*GP* )-3' RNA-BINDING PROTEIN/RNA PROTEIN-RNA COMPLEX, KH DOMAIN, HAIRPIN, RNA-BINDING PROTEIN COMPLEX
2az0	prot-nuc 2.60	5-BROMO-URIDINE-5'-MONOPHOSPHATE 6(C9 H12 BR N2 O9 P)	FLOCK HOUSE VIRUS B2-DSRNA COMPLEX (P212121) 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*GP*(5BU) P*CP*CP*AP*(5BU)P*GP*C)-3', B2 PROTEIN VIRAL PROTEIN/RNA PROTEIN-RNA COMPLEX, FOUR-HELIX BUNDLE, VIRAL PROTEIN/RNA COMPLEX
2az2	prot-nuc 2.60	5-BROMO-URIDINE-5'-MONOPHOSPHATE 6(C9 H12 BR N2 O9 P)	FLOCK HOUSE VIRUS B2-DSRNA COMPLEX (P4122) 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*GP*(5BU) P*CP*CP*AP*(5BU)P*GP*C)-3', B2 PROTEIN VIRAL PROTEIN/RNA PROTEIN-RNA COMPLEX, FOUR-HELIX BUNDLE, VIRAL PROTEIN/RNA COMPLEX
2b63	prot-nuc 3.80	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	COMPLETE RNA POLYMERASE II-RNA INHIBITOR COMPLEX DNA-DIRECTED RNA POLYMERASE II 19 KDA POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASE II 45 KDA POLYPEPTIDE, 31-MER, DNA-DIRECTED RNA POLYMERASES I, II, AND III 7.7 KDA POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASES I, II, AND III 23 KDA POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASES I, II, AND III 27 KDA POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASES I/II/III SUBUNIT 10, DNA-DIRECTED RNA POLYMERASE II 32 KDA POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASE II SUBUNIT 9, DNA-DIRECTED RNA POLYMERASES I, II, AND III 14.5 KDA POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASE II 13.6 KDA POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASE II LARGEST SUBUNIT, DNA-DIRECTED RNA POLYMERASE II 140 KDA POLYPEPTIDE TRANSFERASE/RNA RNA POLYMERASE II, RNA, APTAMER, PROTEIN-RNA COMPLEX, INHIBITOR, TRANSFERASE/RNA COMPLEX
2bu1	prot-nuc 2.20	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 N2 O9 BR1 P1)	MS2-RNA HAIRPIN (5BRU-5) COMPLEX MS2 COAT PROTEIN, 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP *5BU*AP*CP*CP*CP*AP*UP*GP*U)-3': COAT PROTEIN-BINDING HAIRPIN, RESIDUES 2-18 VIRUS/RNA VIRUS/RNA, COMPLEX (CAPSID PROTEIN/RNA HAIRPIN), HAIRPIN, CAPSID, LEVIVIRUS, CAPSID PROTEIN, RNA-BINDING, STRUCTURAL PROTEIN, ICOSAHEDRAL VIRUS
3i5y	prot-nuc 2.49	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	STRUCTURE OF MSS116P BOUND TO SSRNA CONTAINING A SINGLE 5-BR PNP ATP-DEPENDENT RNA HELICASE MSS116: UNP RESIDUES 37 TO 597, 5'-R(*UP*UP*UP*(5BU)P*UP*UP*UP*UP*UP*U)-3' HYDROLASE/RNA PROTEIN-RNA COMPLEX, RNA HELICASE, DEAD-BOX, ATP-BINDING, HE HYDROLASE, MITOCHONDRION, MRNA PROCESSING, MRNA SPLICING, NUCLEOTIDE-BINDING, RNA-BINDING, TRANSIT PEPTIDE, TRANSLATI REGULATION, HYDROLASE-RNA COMPLEX
3lwo	prot-nuc 2.85	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	STRUCTURE OF H/ACA RNP BOUND TO A SUBSTRATE RNA CONTAINING 5 PSEUDOURIDINE SYNTHASE CBF5, H/ACA RNA, 5'-R(*GP*AP*GP*CP*GP*(5BU)P*GP*CP*GP*GP*UP*UP*U)- CHAIN: E, 50S RIBOSOMAL PROTEIN L7AE, RIBOSOME BIOGENESIS PROTEIN NOP10 ISOMERASE/RNA BINDING PROTEIN/RNA H/ACA PSEUDOURIDINE SYNTHASE, ISOMERASE, TRNA PROCESSING, RIBONUCLEOPROTEIN, RIBOSOME BIOGENESIS, RRNA PROCESSING, RI PROTEIN, RNA-BINDING, ISOMERASE-RNA BINDING PROTEIN-RNA COM
3o8c	prot-nuc 2.00	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	VISUALIZING ATP-DEPENDENT RNA TRANSLOCATION BY THE NS3 HELIC HCV RNA (5'-R(P*UP*(5BU)P*UP*UP*UP*U)-3'), HCV NS3 PROTEASE/HELICASE HYDROLASE/RNA HELICASE, NTPASE, HCV, RNA, TRANSLOCATION, PROTEASE/NTPASE/H HYDROLASE-RNA COMPLEX
3o8r	prot-nuc 2.30	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	VISUALIZING ATP-DEPENDENT RNA TRANSLOCATION BY THE NS3 HELIC HCV RNA (5'-R(P*UP*(5BU)P*UP*UP*UP*U)-3'), HCV NS3 PROTEASE/HELICASE HYDROLASE/RNA HELICASE, NTPASE, HCV, RNA, TRANSLOCATION, ADP, BERYLLIUM TRIFLUORIDE, PROTEASE/NTPASE/HELICASE, HYDROLASE-RNA COMPLE
3s2d	prot-nuc 3.20	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	RNA POLYMERASE II INITIATION COMPLEX WITH A 5-NT RNA CONTAIN U DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB9, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: H, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: J, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB1, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: E, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB3, DNA (5'- D(*CP*TP*AP*CP*CP*GP*AP*TP*AP*AP*GP*CP*AP*GP*AP*CP*GP*AP*TP CP*TP*CP*GP*AP*TP*G)-3'), DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB2, DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB11, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: F, DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUN CHAIN: LRNA (5'-R(*AP*GP*GP*(5BU)P*G)-3') TRANSCRIPTION/RNA/DNA RNA POLYMERASE II, INITIATION COMPLEX, TRANSCRIPTION-RNA-DNA
4x4t	prot-nuc 2.50	5-BROMO-URIDINE-5'-MONOPHOSPHATE 6(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE A.FULGIDUS CCA-ADDING ENZYME IN COM A G70A ARGINYL-TRNA MINIHELIX ENDING IN CCACCA G70A TRNA MINIHELIX ENDING IN CCACCA, G70A TRNA MINIHELIX ENDING IN CCACCA, RNA (5'-D(P*GP*G)-3'), CCA-ADDING ENZYME, RNA (5'-D(P*CP*G)-3') TRANSFERASE/RNA PROTEIN-RNA COMPLEX, TRNA, NON-CODING RNA, CCA-ADDING ENZYME NUCLEOTIDYLTRANSFERASE, NCRNA, TRANSFERASE-RNA COMPLEX

5CG    5'-CHLORO-5'-DEOXY-GUANOSINE

Code	Class Resolution	Description
1m5p	prot-nuc 2.60	5'-CHLORO-5'-DEOXY-GUANOSINE 2(C10 H12 CL N5 O4)	TRANSITION STATE STABILIZATION BY A CATALYTIC RNA RNA INHIBITOR SUBSTRATE, U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A: U1A RNA BINDING DOMAIN, RNA HAIRPIN RIBOZYME, RNA INHIBITOR SUBSTRATE TRANSLATION/RNA HAIRPIN RIBOZYME, CATALYTIC RNA, U1A RNA BINDING PROTEIN, CL5*, TRANSLATION/RNA COMPLEX

5CM    5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
10mh	prot-nuc 2.55	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	TERNARY STRUCTURE OF HHAI METHYLTRANSFERASE WITH ADOHCY AND HEMIMETHYLATED DNA CONTAINING 5,6-DIHYDRO-5-AZACYTOSINE AT THE TARGET DNA (5'-D(P*CP*CP*AP*TP*GP*(5CM) P*GP*CP*TP*GP*AP*C)-3'), PROTEIN (CYTOSINE-SPECIFIC METHYLTRANSFERASE HHAI), DNA (5'- D(P*GP*TP*CP*AP*GP*5NCP*GP*CP*AP*TP*GP*G)-3') TRANSFERASE/DNA TRANSFERASE, METHYLTRANSFERASE, RESTRICTION SYSTEM, COMPLEX (METHYLTRANSFERASE/ DNA), TRANSFERASE/DNA COMPLEX
1bsu	prot-nuc 2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL AND ENERGETIC ORIGINS OF INDIRECT READOUT IN SITE-SPECIFIC DNA CLEAVAGE BY A RESTRICTION ENDONUCLEASE ENDONUCLEASE ECORV (3.1.21.4), DNA (5'-D(*AP*AP*AP*GP*AP*(5CM)P*IP*TP*CP*TP*T)- 3'), DNA (5'-D(P*AP*AP*GP*AP*(5CM)P*IP*TP*CP*TP*T)- 3') HYDROLASE/DNA COMPLEX ENDONUCLEASE ECORV (3.1.21.4)/DNA, HYDROLASE/DNA COMPLEX
1dct	prot-nuc 2.80	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	DNA (CYTOSINE-5) METHYLASE FROM HAEIII COVALENTLY BOUND TO DNA DNA (5'-D(*AP*CP*CP*AP*GP*CP*AP*GP*GP*(C49) P*CP*AP*CP*CP*AP*GP*TP*G)-3'), DNA (5'-D(*TP*CP*AP*CP*TP*GP*GP*TP*GP*GP*(C5M) P*CP*TP*GP*CP*TP*GP*G)-3'), PROTEIN (MODIFICATION METHYLASE HAEIII) TRANSFERASE/DNA ENZYME, CYTOSINE METHYLASE, TRANSFERASE/DNA COMPLEX
1ig4	prot-nuc NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF THE METHYL-CPG-BINDING DOMAIN OF HUMAN MBD1 IN COMPLEX WITH METHYLATED DNA 5'-D(*GP*TP*AP*TP*CP*(5CM)P*GP*GP*AP*TP*AP*C)-3', METHYL-CPG BINDING PROTEIN: METHYL-CPG-BINDING DOMAIN TRANSCRIPTION/DNA PROTEIN-DNA COMPLEX, ALPHA-BETA, DOUBLE HELIX, RECOGNITION VIA BETA-SHEET, TRANSCRIPTION/DNA COMPLEX
1odg	prot-nuc 2.80	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2()	VERY-SHORT-PATCH DNA REPAIR ENDONUCLEASE BOUND TO ITS REACTION PRODUCT SITE 5'-D(*TP*AP*GP*GP*CP*5CM*TP*GP*GP*AP*TP*CP)-3', DNA MISMATCH ENDONUCLEASE HYDROLASE HYDROLASE, DNA REPAIR, ENDONUCLEASE, VERY SHORT PATCH REPAIR, DNA REPAI HYDROLASE, NUCLEASE, ZINC, METAL-BINDING
2c7o	prot-nuc 1.90	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	HHAI DNA METHYLTRANSFERASE COMPLEX WITH 13MER OLIGONUCLEOTIDE CONTAINING 2-AMINOPURINE ADJACENT TO THE TARGET BASE (PCGC:GMGC) AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*T*GP*TP*CP*AP*(2PR)*CP*GP*CP*AP*TP*CP *C)-3', 5'-D(*T*GP*GP*AP*TP*GP*(5CM)*GP*CP*TP*GP*AP *C)-3' TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX, BASE FLIPPING, TRANSFERASE RESTRICTION SYSTEM
2c7p	prot-nuc 1.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	HHAI DNA METHYLTRANSFERASE COMPLEX WITH OLIGONUCLEOTIDE CONT 2-AMINOPURINE OPPOSITE TO THE TARGET BASE (GCGC:GMPC) AND S 5'-D(*G*GP*AP*TP*GP*(5CM*2PR)*CP*TP*GP*AP*C)-3', 5'-D(*G*TP*CP*AP*GP*CP*GP*CP*AP*TP*CP*C)-3', MODIFICATION METHYLASE HHAI TRANSFERASE/DNA BASE FLIPPING, RESTRICTION SYSTEM, TRANSFERASE-DNA COMPLEX
2c7q	prot-nuc 1.85	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	HHAI DNA METHYLTRANSFERASE COMPLEX WITH OLIGONUCLEOTIDE CONTAINING 2-AMINOPURINE OUTSIDE THE RECOGNITION SEQUENCE (PAIRED WITH G) AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*T*GP*TP*CP*AP*GP*CP*GP*CP*CP*GP*CP*C)-3', 5'-D(*T*GP*GP*(2PR)*GP*GP*(5CM)*GP*CP*TP*GP* AP*C)-3' TRANSFERASE/DNA BASE FLIPPING, RESTRICTION SYSTEM, TRANSFERASE-DNA COMPLEX
2c7r	prot-nuc 1.90	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	HHAI DNA METHYLTRANSFERASE (T250G MUTANT) COMPLEX WITH OLIGONUCLEOTIDE CONTAINING 2-AMINOPURINE AS A TARGET BASE (GPGC:GMGC) AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*G*TP*CP*AP*GP*(2PR)*GP*CP*AP*TP*CP*C)-3', 5'-D(*G*GP*AP*TP*GP*(5CM)*GP*CP*TP*GP*AP*C)-3' TRANSFERASE/DNA BASE FLIPPING, RESTRICTION SYSTEM, TRANSFERASE-DNA COMPLEX, TRANSFERASE
2ky8	prot-nuc NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	SOLUTION STRUCTURE AND DYNAMIC ANALYSIS OF CHICKEN MBD2 METH DOMAIN BOUND TO A TARGET METHYLATED DNA SEQUENCE METHYL-CPG-BINDING DOMAIN PROTEIN 2: UNP RESIDUES 2-71, DNA (5'-D(*GP*AP*GP*CP*(5CM)P*GP*AP*TP*(TED)P*CP* CHAIN: C, DNA (5'-D(*GP*GP*AP*AP*TP*(5CM)P*GP*GP*CP*(TED)P* CHAIN: B TRANSCRIPTION/DNA DNA BINDING DOMAIN, TRANSCRIPTION-DNA COMPLEX
2moe	prot-nuc NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF MBD4 METHYL-CYTOSINE BINDING DOMAIN BO METHYLATED DNA METHYL-CPG-BINDING DOMAIN PROTEIN 4: UNP RESIDUES 80-148, DNA (5'-D(*GP*GP*AP*TP*(5CM)P*GP*GP*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*(5CM)P*GP*AP*TP*CP*C)-3') HYDROLASE/DNA PROTEIN/DNA, METHYLATED DNA, HYDROLASE-DNA COMPLEX
2uyc	prot-nuc 2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P1	HHAI DNA METHYLTRANSFERASE R163N MUTANT COMPLEX WITH 13MER GCGC-GMGC OLIGONUCLEOTIDE AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*TP*GP*GP*AP*TP*GP*5CMP*GP*CP*TP *GP*AP*C)-3', 5'-D(*GP*TP*CP*AP*GP*CP*GP*CP*AP*TP *CP*C)-3' TRANSFERASE TRANSFERASE, S-ADENOSYL-L-METHIONINE, BASE FLIPPING, METHYLTRANSFERASE, RESTRICTION SYSTEM, DNA METHYLTRANSFERASE
2uyh	prot-nuc 2.63	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P1	HHAI DNA METHYLTRANSFERASE S87Q-Q237S MUTANT COMPLEX WITH 13MER GCGC-GMGC OLIGONUCLEOTIDE AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*GP*TP*CP*AP*GP*CP*GP*CP*AP*TP *CP*C)-3', 5'-D(*TP*GP*GP*AP*TP*G*5CMP*GP*CP*TP*GP *AP*C)-3' TRANSFERASE TRANSFERASE, S-ADENOSYL-L-METHIONINE, BASE FLIPPING, METHYLTRANSFERASE, RESTRICTION SYSTEM, DNA METHYLTRANSFERASE
2uz4	prot-nuc 2.10	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	HHAI DNA METHYLTRANSFERASE R165N MUTANT COMPLEX WITH 13MER GCGC-GMGC OLIGONUCLEOTIDE AND SAH MODIFICATION METHYLASE HHAI, 5'-D(*GP*TP*CP*AP*GP*CP*GP*CP*AP*TP *CP*C)-3', 5'-D(*TP*GP*GP*AP*TP*GP*5CMP*GP*CP*TP*GP *AP*C)-3' TRANSFERASE TRANSFERASE, S-ADENOSYL-L-METHIONINE, BASE FLIPPING, METHYLTRANSFERASE, RESTRICTION SYSTEM, DNA METHYLTRANSFERASE
2zkd	prot-nuc 1.60	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF THE SRA DOMAIN OF MOUSE NP95 IN COMPLEX HEMI-METHYLATED CPG DNA DNA (5'-D(*DGP*DCP*DAP*DAP*DTP*DCP*(5CM) P*DGP*DGP*DTP*DAP*DG)-3'), DNA (5'-D(*DCP*DTP*DAP*DCP*DCP*DGP*DGP*DAP*DTP*DT 3'), E3 UBIQUITIN-PROTEIN LIGASE UHRF1: UNP RESIDUES 404-613 LIGASE PROTEIN-DNA COMPLEX, CELL CYCLE, DEVELOPMENTAL PROTEIN, DNA DNA REPAIR, DNA-BINDING, LIGASE, METAL-BINDING, NUCLEUS, PHOSPHOPROTEIN, TRANSCRIPTION, TRANSCRIPTION REGULATION, UB CONJUGATION PATHWAY, ZINC-FINGER
2zke	prot-nuc 2.60	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF THE SRA DOMAIN OF MOUSE NP95 IN COMPLEX HEMI-METHYLATED CPG DNA DNA (5'-D(*DCP*DTP*DAP*DCP*DCP*DGP*DGP*DAP*DTP*DT 3'), DNA (5'-D(*DGP*DCP*DAP*DAP*DTP*DCP*(5CM) P*DGP*DGP*DTP*DAP*DG)-3'), E3 UBIQUITIN-PROTEIN LIGASE UHRF1: UNP RESIDUES 404-613 LIGASE PROTEIN-DNA INTERACTION, CELL CYCLE, DEVELOPMENTAL PROTEIN, DAMAGE, DNA REPAIR, DNA-BINDING, LIGASE, METAL-BINDING, NUC PHOSPHOPROTEIN, TRANSCRIPTION, TRANSCRIPTION REGULATION, UB CONJUGATION PATHWAY, ZINC-FINGER
2zkf	prot-nuc 2.55	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF THE SRA DOMAIN OF MOUSE NP95 IN COMPLEX HEMI-METHYLATED CPG DNA DNA (5'-D(P*DCP*DAP*DCP*DCP*DGP*DGP*DAP*DTP*DAP*D 3'), DNA (5'-D(*DCP*DTP*DAP*DTP*DCP*(5CM)P*DGP*DGP*DTP 3'), E3 UBIQUITIN-PROTEIN LIGASE UHRF1: UNP RESIDUES 404-613 LIGASE PROTEIN-DNA INTERACTION, CELL CYCLE, DEVELOPMENTAL PROTEIN, DAMAGE, DNA REPAIR, DNA-BINDING, LIGASE, METAL-BINDING, NUC PHOSPHOPROTEIN, TRANSCRIPTION, TRANSCRIPTION REGULATION, UB CONJUGATION PATHWAY, ZINC-FINGER
2zo0	prot-nuc 2.19	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	MOUSE NP95 SRA DOMAIN DNA SPECIFIC COMPLEX 1 DNA (5'- D(*DTP*DCP*DCP*DAP*DTP*DGP*DCP*DGP*DCP*DTP*DGP*DAP*DC)-3'), DNA (5'-D(*DGP*DTP*DCP*DAP*DGP*(5CM) P*DGP*DCP*DAP*DAP*DTP*DGP*DG)-3'), E3 UBIQUITIN-PROTEIN LIGASE UHRF1: SRA DOMAIN, RESIDUES 419-628 LIGASE/DNA BASE FLIPPING, CELL CYCLE, DEVELOPMENTAL PROTEIN, DNA DAMAGE, DNA REPAIR, DNA-BINDING, LIGASE, METAL-BINDING, NUCLEUS, PHOSPHOPROTEIN, TRANSCRIPTION, TRANSCRIPTION REGULATION, UBL CONJUGATION, UBL CONJUGATION PATHWAY, ZINC, ZINC-FINGER, LIGASE/DNA COMPLEX
2zo1	prot-nuc 1.96	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	MOUSE NP95 SRA DOMAIN DNA SPECIFIC COMPLEX 2 DNA (5'- D(*DTP*DCP*DCP*DAP*DTP*DGP*DCP*DGP*DCP*DTP*DGP*DAP*DC)-3'), DNA (5'-D(*DGP*DTP*DCP*DAP*DGP*(5CM) P*DGP*DCP*DAP*DAP*DTP*DGP*DG)-3'), E3 UBIQUITIN-PROTEIN LIGASE UHRF1: SRA DOMAIN, RESIDUES 419-628 LIGASE/DNA BASE FLIPPING, CELL CYCLE, DEVELOPMENTAL PROTEIN, DNA DAMAGE, DNA REPAIR, DNA-BINDING, LIGASE, METAL-BINDING, NUCLEUS, PHOSPHOPROTEIN, TRANSCRIPTION, TRANSCRIPTION REGULATION, UBL CONJUGATION, UBL CONJUGATION PATHWAY, ZINC, ZINC-FINGER, OXIDOREDUCTASE, PYRUVATE, LIGASE/DNA COMPLEX
3c2i	prot-nuc 2.50	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	THE CRYSTAL STRUCTURE OF METHYL-CPG BINDING DOMAIN OF HUMAN MECP2 IN COMPLEX WITH A METHYLATED DNA SEQUENCE FROM BDNF METHYL-CPG-BINDING PROTEIN 2: UNP RESIDUES 77-167, HUMAN MECP2 MBD DOMAIN, DNA (5'-D(*DTP*DCP*DTP*DGP*DGP*DAP*DAP*(5CM) P*DGP*DGP*DAP*DAP*DTP*DTP*DCP*DTP*DTP*DCP*DTP*DA)-3'), DNA (5'- D(*DAP*DTP*DAP*DGP*DAP*DAP*DGP*DAP*DAP*DTP*DTP*DCP*(5CM) P*DGP*DTP*DTP*DCP*DCP*DAP*DG)-3') TRANSCRIPTION REGULATOR WATER MEDIATED RECOGNITION, PROTEIN-METHYLATED DNA COMPLEX, ASX-ST-MOTIF, ALTERNATIVE SPLICING, CHROMOSOMAL REARRANGEMENT, DISEASE MUTATION, DNA-BINDING, NUCLEUS, PHOSPHOPROTEIN, POLYMORPHISM, REPRESSOR, TRANSCRIPTION REGULATOR
3clz	prot-nuc 2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	THE SET AND RING ASSOCIATED (SRA) DOMAIN OF UHRF1 BOUND TO METHYLATED DNA E3 UBIQUITIN-PROTEIN LIGASE UHRF1: SRA DOMAIN (UNP RESIDUES 414-617), 5'- D(*DCP*DCP*DCP*DTP*DGP*DCP*DGP*DGP*DGP*DCP*DCP*DC)-3', 5'-D(*DGP*DGP*DGP*DCP*DCP*(5CM) P*DGP*DCP*DAP*DGP*DGP*DG)-3' LIGASE CELL CYCLE, DNA DAMAGE, DNA REPAIR, DNA-BINDING, BASE FLIPPING, LIGASE, METAL BINDING, NUCLEASE, DNA REPLICATION, TRANSCRIPTIONAL SILENCING, CHROMATIN, PHOSPHORYLATION, TRANSCRIPTION, TRANSCRIPTION REGULATION, UBL CONJUGATION, UBL CONJUGATION PATHWAY, ZINC, ZINC-FINGER, STRUCTURAL GENOMICS CONSORTIUM, SGC, METAL-BINDING, NUCLEUS, PHOSPHOPROTEIN, POLYMORPHISM
3f8i	prot-nuc 2.29	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	MOUSE UHRF1 SRA DOMAIN BOUND WITH HEMI-METHYLATED CPG, CRYSTAL STRUCTURE IN SPACE GROUP P21 5'- D(*DGP*DTP*DCP*DAP*DGP*DCP*DGP*DCP*DAP*DTP*DGP*DG)-3', 5'-D(*DCP*DCP*DAP*DTP*DGP*(5CM) P*DGP*DCP*DTP*DGP*DAP*DC)-3', E3 UBIQUITIN-PROTEIN LIGASE UHRF1: YDG DOMAIN: UNP RESIDUES 419-628 LIGASE/DNA UHRF1, BASE FLIPPING, 5-METHYLCYTOSINE, CPG METHYLATION, CELL CYCLE, DEVELOPMENTAL PROTEIN, DNA DAMAGE, DNA REPAIR, DNA-BINDING, LIGASE, METAL-BINDING, NUCLEUS, PHOSPHOPROTEIN TRANSCRIPTION, TRANSCRIPTION REGULATION, UBL CONJUGATION, UBL CONJUGATION PATHWAY, ZINC, ZINC-FINGER, LIGASE/DNA COMPLEX
3f8j	prot-nuc 1.99	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	MOUSE UHRF1 SRA DOMAIN BOUND WITH HEMI-METHYLATED CPG, CRYST STRUCTURE IN SPACE GROUP C222(1) 5'-D(*DGP*DTP*DCP*DAP*DGP*DCP*DGP*DCP*DAP*DTP*DGP CHAIN: G, 5'-D(*DCP*DCP*DAP*DTP*DGP*(5CM)P*DGP*DCP*DTP*DGP* 3', E3 UBIQUITIN-PROTEIN LIGASE UHRF1: YDG DOMAIN: UNP RESIDUES 417-628 LIGASE/DNA UHRF1, SRA, BASE FLIPPING, 5-METHYLCYTOSINE, CPG METHYLATION CYCLE, DEVELOPMENTAL PROTEIN, DNA DAMAGE, DNA REPAIR, DNA-B LIGASE, METAL-BINDING, NUCLEUS, PHOSPHOPROTEIN, TRANSCRIPTI TRANSCRIPTION REGULATION, UBL CONJUGATION PATHWAY, ZINC-FIN LIGASE-DNA COMPLEX
3fde	prot-nuc 1.41	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	MOUSE UHRF1 SRA DOMAIN BOUND WITH HEMI-METHYLATED CPG DNA, CRYSTAL STRUCTURE IN SPACE GROUP C222(1) AT 1.4 A RESOLUTION E3 UBIQUITIN-PROTEIN LIGASE UHRF1: YDG DOMAIN: UNP RESIDUES 419-628, 5'-D(*GP*TP*CP*AP*GP*CP*GP*CP*AP*TP*GP*G)-3', 5'-D(*CP*CP*AP*TP*GP*(5CM)P*GP*CP*TP*GP*AP*C)-3' LIGASE SRA DOMAIN, BASE FLIPPING, DNA CPG METHYLATION, CELL CYCLE, DEVELOPMENTAL PROTEIN, DNA DAMAGE, DNA REPAIR, DNA-BINDING, LIGASE, METAL-BINDING, NUCLEUS, PHOSPHOPROTEIN, TRANSCRIPTION, TRANSCRIPTION REGULATION, UBL CONJUGATION, UBL CONJUGATION PATHWAY, ZINC, ZINC-FINGER
3q0b	prot-nuc 2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF SUVH5 SRA- FULLY METHYLATED CG DNA COMP SPACE GROUP P42212 DNA (5'-D(*AP*CP*TP*AP*(5CM)P*GP*TP*AP*GP*T)-3'), HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 S SUVH5: SUVH5 SRA DOMAIN (UNP RESIDUES 362-528) TRANSFERASE/DNA SRA, FULLY METHYLATED CG, SUVH5, 5MC BINDING PROTEIN, FULLY METHYLATED CG DUPLEX DNA, TRANSFERASE-DNA COMPLEX
3q0c	prot-nuc 2.66	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF SUVH5 SRA-FULLY METHYLATED CG DNA COMPL SPACE GROUP P6122 DNA (5'-D(*AP*CP*TP*AP*(5CM)P*GP*TP*AP*GP*TP*T)-3 CHAIN: C, B, HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 S SUVH5: SUVH5 SRA DOMAIN (UNP RESIDUES 362-528) TRANSFERASE/DNA SRA, FULLY METHYLATED CG, SUVH5, 5MC BINDING PROTEIN, FULLY METHYLATED CG DNA DUPLEX, TRANSFERASE-DNA COMPLEX
3q0d	prot-nuc 2.37	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF SUVH5 SRA- HEMI METHYLATED CG DNA COMPL HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 S SUVH5: SUVH5 SRA DOMAIN (UNP RESIDUES 362-528), DNA (5'-D(*CP*TP*GP*AP*CP*GP*TP*GP*GP*A)-3'), DNA (5'-D(*TP*CP*CP*AP*(5CM)P*GP*TP*CP*AP*G)-3') TRANSFERASE/DNA SRA, HEMI-METHYLATED CG, SUVH5, 5MC BINDING, HEMI-METHYLATED TRANSFERASE-DNA COMPLEX
3q0f	prot-nuc 2.75	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF SUVH5 SRA- METHYLATED CHH DNA COMPLEX HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 S SUVH5: SUVH5 SRA DOMAIN (UNP RESIDUES 362-528), DNA (5'-D(*TP*AP*CP*TP*(5CM)P*CP*TP*CP*AP*G)-3'), DNA (5'-D(*CP*TP*GP*AP*GP*GP*AP*GP*TP*AP*T)-3') TRANSFERASE/DNA SRA, FULLY METHYLATED CG, SUVH5, 5MC BINDING DOMAIN, METHYLA DUPLEX DNA, TRANSFERASE-DNA COMPLEX
3ssc	prot-nuc 2.10	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	DNA BINDING DOMAIN OF RESTRICTION ENDONUCLEASE BOUND TO DNA DNA (5'-D(*AP*GP*CP*TP*AP*(5CM)P*CP*GP*GP*TP*CP*T CHAIN: D, DNA (5'-D(*TP*GP*AP*GP*AP*(5CM)P*CP*GP*GP*TP*AP*G CHAIN: C, 5-METHYLCYTOSINE-SPECIFIC RESTRICTION ENZYME B: N-TERMINAL DNA BINDING DOMAIN DNA BINDING PROTEIN/DNA PROTEIN-DNA COMPLEX, RESTRICTION ENDONUCLEASE, 5-METHYLCYTOS FLIPPING COMPLEX, DNA BINDING PROTEIN-DNA COMPLEX
3ssd	prot-nuc 2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	DNA BINDING DOMAIN OF RESTRICTION ENDONUCLEASE BOUND TO DNA DNA (5'-D(*A*GP*CP*TP*AP*CP*CP*GP*GP*TP*CP*TP*C)- CHAIN: D, DNA (5'-D(*T*GP*AP*GP*AP*(5CM)P*CP*GP*GP*TP*AP*GP CHAIN: C, 5-METHYLCYTOSINE-SPECIFIC RESTRICTION ENZYME B: N-TERMINAL DNA BINDING DOMAIN DNA BINDING PROTEIN/DNA RESTRICTION ENDONUCLEASE, 5-METHYLCYTOSINE, BASE FLIPPING, D BINDING PROTEIN-DNA COMPLEX
3vxv	prot-nuc 2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF METHYL CPG BINDING DOMAIN OF MBD4 IN CO THE 5MCG/TG SEQUENCE DNA (5'-D(*GP*TP*CP*TP*GP*GP*TP*AP*GP*TP*GP*AP*CP CHAIN: C, DNA (5'-D(*GP*TP*CP*AP*CP*TP*AP*CP*(5CM)P*GP*GP*A 3'), METHYL-CPG-BINDING DOMAIN PROTEIN 4: METHYL CPG BINDING DOMAIN, UNP RESIDUES 69-136 HYDROLASE/DNA METHYL CPG BINDING DOMAIN, PROTEIN-DNA COMPLEX, VERSATILE BA RECOGNITION, HYDROLASE-DNA COMPLEX
3vxx	prot-nuc 2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF METHYL CPG BINDING DOMAIN OF MBD4 IN CO THE 5MCG/5MCG SEQUENCE METHYL-CPG-BINDING DOMAIN PROTEIN 4: METHYL CPG BINDING DOMAIN, UNP RESIDUES 69-136, DNA (5'-D(*GP*TP*CP*(5CM)P*GP*GP*TP*AP*GP*TP*GP*A 3'), DNA (5'-D(*GP*TP*CP*AP*CP*TP*AP*CP*(5CM)P*GP*GP*A 3') HYDROLASE/DNA METHYL CPG BINDING DOMAIN, PROTEIN-DNA COMPLEX, VERSATILE BA RECOGNITION, HYDROLASE-DNA COMPLEX
3vyb	prot-nuc 2.40	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF METHYL CPG BINDING DOMAIN OF MBD4 IN CO THE 5MCG/HMCG SEQUENCE DNA (5'-D(*GP*TP*CP*AP*CP*TP*AP*CP*(5CM)P*GP*GP*A 3'), DNA (5'-D(*GP*TP*CP*(5HC)P*GP*GP*TP*AP*GP*TP*GP*A 3'), METHYL-CPG-BINDING DOMAIN PROTEIN 4: METHYL CPG BINDING DOMAIN, UNP RESIDUES 69-136 HYDROLASE/DNA METHYL CPG BINDING DOMAIN, PROTEIN-DNA COMPLEX, VERSATILE BA RECOGNITION, HYDROLASE-DNA COMPLEX
3vyq	prot-nuc 2.52	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF THE METHYL CPG BINDING DOMAIN OF MBD4 I WITH THE 5MCG/TG SEQUENCE IN SPACE GROUP P1 METHYL-CPG-BINDING DOMAIN PROTEIN 4: METHYL CPG BINDING DOMAIN, UNP RESIDUES 63-136, DNA (5'-D(*AP*CP*AP*TP*CP*(5CM)P*GP*GP*TP*GP*A)-3 CHAIN: B, DNA (5'-D(*TP*CP*AP*CP*TP*GP*GP*AP*TP*GP*T)-3') HYDROLASE/DNA METHYL CPG BINDING DOMAIN, PROTEIN-DNA COMPLEX, VERSATILE BA RECOGNITION, HYDROLASE-DNA COMPLEX
4aqu	prot-nuc 2.30	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF I-CREI COMPLEXED WITH ITS TARGET METHYL POSITION PLUS 2 (IN THE B STRAND) IN THE PRESENCE OF CALCIU DNA ENDONUCLEASE I-CREI: RESIDUES 2-153, 5'-D(*DCP*CP*AP*AP*AP*CP*TP*GP*TP*CP*TP*CP*AP*5CM *GP*AP*CP*GP*TP*TP*TP*TP*GP*A)-3', 5'-D(*DTP*CP*AP*AP*AP*AP*CP*GP*TP*CP*GP*TP*GP*DAP *GP*AP*CP*AP*GP*TP*TP*TP*GP*G)-3' HYDROLASE HYDROLASE, GENE TARGETING, PROTEIN-DNA INTERACTION, HOMING ENDONUCLEASES
4aqx	prot-nuc 2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF I-CREI COMPLEXED WITH ITS TARGET METHYLATED AT POSITION PLUS 2 (IN THE B STRAND) IN THE PRESENCE OF MAGNESIUM 5'-D(*GP*AP*CP*GP*TP*TP*TP*TP*GP*AP)-3', 5'-D(*GP*AP*CP*AP*GP*TP*TP*TP*GP*GP)-3', 5'-D(*TP*CP*AP*AP*AP*AP*CP*GP*TP*CP*GP*TP*GP*AP)- CHAIN: C, DNA ENDONUCLEASE I-CREI: RESIDUES 2-153, 5'-D(*CP*CP*AP*AP*AP*CP*TP*GP*TP*CP*TP*CP*AP*5CM) CHAIN: E HYDROLASE HYDROLASE, METHYLATION, GENE TARGETING, GENETICS, PROTEIN-DN INTERACTION, HOMING ENDONUCLEASES
4da4	prot-nuc 2.60	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURE OF MOUSE DNMT1 (731-1602) BOUND TO HEMIMETHYLATED DNA_LOWER_STRAND, DNA_UPPER_STRAND, DNA (CYTOSINE-5)-METHYLTRANSFERASE 1: UNP RESIDUES 731-1602 TRANSFERASE/DNA MAINTENANCE DNA METHYLATION, COVALENT COMPLEX, TRANSFERASE-D COMPLEX
4dkj	prot-nuc 2.15	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CPG SPECIFIC METHYLTRANSFERASE IN COMPLEX WITH TARGET DNA CYTOSINE-SPECIFIC METHYLTRANSFERASE, DNA (5'-D(*CP*CP*AP*CP*AP*TP*GP*(C37)P*GP*CP*TP*G 3'), DNA (5'-D(*GP*TP*TP*CP*AP*GP*(5CM)P*GP*CP*AP*TP*G 3') TRANSFERASE/DNA CG-SPECIFICITY, DNA INTERCALATION, CPG SEQUENCE, CYTOSINE C5 METHYLATION, C5-METHYLCYTOSINE, NUCLEOTIDE FLIPPING, S-ADEN METHIONINE-DEPENDENT METHYLTRANSFERASES, C-5 CYTOSINE-SPECI METHYLASES, DNA (CYTOSINE-5-)-METHYLTRANSFERASE ACTIVITY, D BINDING, DNA (CYTOSINE-5-)-METHYLATION, INTRACELLULAR, TRAN DNA COMPLEX
4f6n	prot-nuc 2.80	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF KAISO ZINC FINGER DNA BINDING PROTEIN I WITH METHYLATED CPG SITE DNA TRANSCRIPTIONAL REGULATOR KAISO: ZINC FINGER DNA BINDING DOMAIN, DNA (5'-D(*CP*GP*TP*AP*TP*AP*GP*AP*(5CM)P*GP*(5CM P*GP*GP*TP*GP*AP*CP*AP*C)-3'), DNA (5'-D(*GP*TP*GP*TP*CP*AP*CP*(5CM)P*GP*(5CM) P*GP*TP*CP*TP*AP*TP*AP*CP*G)-3') DNA BINDING PROTEIN/DNA ZINC FINGER, PROTEIN-DNA COMPLEX, DOUBLE HELIX, DNA BINDING, BINDING PROTEIN-DNA COMPLEX
4gjp	prot-nuc 1.94	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF THE TAL EFFECTOR DHAX3 BOUND TO DSDNA C REPETITIVE METHYL-CPG HAX3: TAL EFFECTOR, UNP RESIDUES 231-720, DNA (5'- D(*AP*GP*AP*GP*AP*CP*GP*CP*GP*AP*AP*GP*GP*GP*AP*CP*A)-3'), DNA (5'-D(*TP*GP*TP*CP*CP*CP*TP*TP*(5CM)P*GP*(5CM P*GP*TP*CP*TP*CP*T)-3') TRANSCRIPTION/DNA TRANSCRIPTION ACTIVITION, NUCLEUS, TRANSCRIPTION-DNA COMPLEX
4gjr	prot-nuc 1.85	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF THE TAL EFFECTOR DHAX3 BOUND TO METHYLA DNA (5'-D(*TP*GP*TP*CP*CP*CP*TP*(5CM)P*TP*AP*(5CM P*CP*TP*CP*(5CM)P*CP*T)-3'), DNA (5'- D(*AP*GP*GP*GP*AP*GP*GP*TP*AP*GP*AP*GP*GP*GP*AP*CP*A)-3'), HAX3: TAL EFFECTOR, UNP RESIDUES 231-720 TRANSCRIPTION/DNA TRANSCRIPTION ACTIVATOR, DNA, NUCLEUS, TRANSCRIPTION-DNA COM
4gzn	prot-nuc 0.99	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	MOUSE ZFP57 ZINC FINGERS IN COMPLEX WITH METHYLATED DNA DNA (5'-D(*AP*CP*TP*GP*(5CM)P*GP*GP*CP*AP*AP*T)-3 CHAIN: B, ZINC FINGER PROTEIN 57, DNA (5'-D(*TP*AP*TP*TP*GP*CP*(5CM)P*GP*CP*AP*G)-3 CHAIN: A: ZINC FINGER DOMAIN, UNP RESIDUES 137-195 TRANSCRIPTION/DNA ZINC FINGER, TRANSCRIPTION-DNA COMPLEX
4hp1	prot-nuc 2.25	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF TET3 IN COMPLEX WITH A NON-CPG DSDNA LOC100036628 PROTEIN, DNA (5'-D(*GP*CP*CP*AP*CP*(5CM)P*GP*GP*TP*GP*GP*C CHAIN: A, B DNA BINDING PROTEIN/DNA CXXC, DNA METHYLATION, STRUCTURAL GENOMICS, STRUCTURAL GENOM CONSORTIUM, SGC, DNA BINDING PROTEIN-DNA COMPLEX
4lg7	prot-nuc 2.50	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE MBD4 MBD DOMAIN IN COMPLEX WITH METHYLATED METHYL-CPG-BINDING DOMAIN PROTEIN 4: UNP RESIDUES 83-149, DNA (5'-D(*GP*CP*CP*AP*AP*(5CM)P*GP*TP*TP*GP*GP*C CHAIN: B, C HYDROLASE/DNA STRUCTURAL GENOMICS CONSORTIUM, SGC, HYDROLASE-DNA COMPLEX
4lt5	prot-nuc 2.89	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURE OF A NAEGLERIA TET-LIKE DIOXYGENASE IN COMPLEX WIT METHYLCYTOSINE DNA DNA, DNA, NAEGLERIA TET-LIKE DIOXYGENASE OXIDOREDUCTASE/DNA 5-METHYLCYTOSINE, DIOXYGENASE-DNA COMPLEX, OXIDOREDUCTASE-DN
4m9e	prot-nuc 1.85	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURE OF KLF4 ZINC FINGER DNA BINDING DOMAIN IN COMPLEX METHYLATED DNA DNA (5'-D(*GP*CP*CP*AP*(5CM)P*GP*CP*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*GP*(5CM)P*GP*TP*GP*GP*C)-3'), KRUEPPEL-LIKE FACTOR 4: UNP RESIDUES 396-483 TRANSCRIPTION/DNA DNA METHYLATION, TRANSCRIPTION FACTOR, CELLULAR REPROGRAMMIN ZINC FINGER, DNA BINDING, TRANSCRIPTION-DNA COMPLEX
4m9v	prot-nuc 0.97	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	ZFP57 MUTANT (E182Q) IN COMPLEX WITH 5-CARBOXYLCYTOSINE DNA DNA (5'-D(*AP*CP*TP*GP*(1CC)P*GP*GP*CP*AP*AP*T)-3 CHAIN: B, E, ZINC FINGER PROTEIN 57, DNA (5'-D(*TP*AP*TP*TP*GP*CP*(5CM)P*GP*CP*AP*G)-3 CHAIN: A, D TRANSCRIPTION/DNA EPIGENETICS, TRANSCRIPTION FACTOR, 5-CARBOXYLCYTOSINE, C2H2 FINGER, DNA BINDING, TRANSCRIPTION-DNA COMPLEX
4mht	prot-nuc 2.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	TERNARY STRUCTURE OF HHAI METHYLTRANSFERASE WITH NATIVE DNA AND ADOHCY DNA (5'-D(*TP*GP*AP*TP*AP*GP*(5CM) P*GP*CP*TP*AP*TP*C)-3'), PROTEIN (HHAI METHYLTRANSFERASE (E.C.2.1.1.73)), DNA (5'-D(*GP*AP*TP*AP*GP*(5CM) P*GP*CP*TP*AP*TP*C)-3') TRANSFERASE/DNA COMPLEX (METHYLTRANSFERASE/DNA), TRANSFERASE, METHYLTRANSFERASE, RESTRICTION SYSTEM
4nm6	prot-nuc 2.03	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF TET2-DNA COMPLEX METHYLCYTOSINE DIOXYGENASE TET2: SEE REMARK 999, 5'-D(*AP*CP*CP*AP*CP*(5CM)P*GP*GP*TP*GP*GP*T)-3' OXIDOREDUCTASE/DNA DNA HYDROXYLATION, OXIDOREDUCTASE-DNA COMPLEX
4pw7	prot-nuc 2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURE OF UHRF2-SRA IN COMPLEX WITH A 5MC-CONTAINING DNA 5MC-CONTAINING DNA1, 5MC-CONTAINING DNA2, E3 UBIQUITIN-PROTEIN LIGASE UHRF2 LIGASE/DNA SRA, 5HMC BINDING, 5HMC-CONTAINING DNA, METHYLATION, NUCLEAR DNA COMPLEX
4qen	prot-nuc 2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF KRYPTONITE IN COMPLEX WITH MCHH DNA AND DNA (5'-D(*AP*CP*TP*GP*AP*TP*GP*AP*GP*TP*AP*CP*CP 3'), DNA (5'-D(*GP*GP*TP*AP*CP*TP*(5CM) P*AP*TP*CP*AP*GP*TP*AP*T)-3'), HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 S SUVH4: FUNCTIONAL FRAGMENT TRANSCRIPTION/DNA SRA, SET, HISTONE METHYLATION, METHYLATED DNA, TRANSCRIPTION COMPLEX
4qeo	prot-nuc 2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF KRYPTONITE IN COMPLEX WITH MCHH DNA, H3 PEPTIDE AND SAH DNA 5'-GGTACT(5CM)ATCAGTAT-3', DNA 5'-ACTGATGAGTACCAT-3', HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 S SUVH4: FUNCTIONAL FRAGMENT, HISTONE H3: UNP RESIDUES 2-16 TRANSCRIPTION/DNA SRA, SET, HISTONE METHYLATION, METHYLATED DNA, METHYLATION, TRANSCRIPTION-DNA COMPLEX
4qep	prot-nuc 3.10	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	CRYSTAL STRUCTURE OF KRYPTONITE IN COMPLEX WITH MCHG DNA AND DNA (5'-D(*AP*CP*TP*GP*CP*TP*GP*AP*GP*TP*AP*CP*CP 3'), DNA (5'-D(*GP*GP*TP*AP*CP*TP*(5CM) P*AP*GP*CP*AP*GP*TP*AP*T)-3'), HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 S SUVH4: FUNCTIONAL FRAGMENT TRANSCRIPTION/DNA SRA, SET, HISTONE METHYLATION, METHYLATED DNA, METHYLATION, TRANSCRIPTION-DNA COMPLEX
4r28	prot-nuc 3.06	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	MSPJI RESTRICTION ENDONUCLEASE IN COMPLEX WITH 27-MER OLIGON RESTRICTION ENDONUCLEASE, DNA (25-MER), DNA (26-MER) HYDROLASE/DNA ENDONUCLEASE, DNA METHYLATION DEPENDENT, SRA DOMAIN, EPIGENE TOOL, CYTOSINE METHYLATION-DEPENDENT ENDONUCLEASE, TETRAMER ENDONUCLEASE, HYDROLASE, HYDROLASE-DNA COMPLEX
4r2a	prot-nuc 1.59	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	EGR1/ZIF268 ZINC FINGERS IN COMPLEX WITH METHYLATED DNA EARLY GROWTH RESPONSE PROTEIN 1: ZINC FINGER 1-3, DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5CM)P*GP*T)-3 CHAIN: B DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
4r2e	prot-nuc 1.84	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	WILMS TUMOR PROTEIN (WT1) ZINC FINGERS IN COMPLEX WITH METHY DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5CM)P*GP*T)-3 CHAIN: B, WILMS TUMOR PROTEIN, ISOFORM 4/CRA_A: ZINC FINGER 2-4 DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
4r2r	prot-nuc 2.09	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	WILMS TUMOR PROTEIN (WT1) ZINC FINGERS IN COMPLEX WITH CARBO DNA DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(1CC)P*GP*T)-3 CHAIN: B, WILMS TUMOR PROTEIN, ISOFORM 4/CRA_A: ZINC FINGER 2-4 DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
4r2s	prot-nuc 2.49	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	WILMS TUMOR PROTEIN (WT1) Q369P ZINC FINGERS IN COMPLEX WITH METHYLATED DNA DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5CM)P*GP*T)-3 CHAIN: B, DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, WILMS TUMOR PROTEIN, ISOFORM 4/CRA_A: ZINC FINGER 2-4 DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
4x9j	prot-nuc 1.41	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	EGR-1 WITH DOUBLY METHYLATED DNA DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*(5CM)P*GP* CHAIN: C, DNA (5'-D(*AP*GP*(5CM)P*GP*TP*GP*GP*GP*(5CM)P*GP* CHAIN: B, EARLY GROWTH RESPONSE PROTEIN 1: UNP RESIDUES 335-423 TRANSCRIPTION REGULATOR/DNA DNA BINDING, METHYLATED DNA, ZINC FINGER, TRANSCRIPTION, TRANSCRIPTION REGULATOR-DNA COMPLEX
5b2j	prot-nuc 2.60	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 8(C10 H16 N3 O7 P)	HUMAN NUCLEOSOME CONTAINING CPG METHYLATED DNA HISTONE H3.1, HISTONE H2B TYPE 1-J, HISTONE H4, HISTONE H2A TYPE 1-B/E, DNA (146-MER) TRANSCRIPTION/DNA CHROMATIN, EPIGENETICS, HISTONE, TRANSCRIPTION, TRANSCRIPTIO COMPLEX
5bt2	prot-nuc 2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	MECP2 MBD DOMAIN (A140V) IN COMPLEX WITH METHYLATED DNA DNA (5'-D(*TP*CP*TP*GP*GP*AP*AP*(5CM) P*GP*GP*AP*AP*TP*TP*CP*TP*TP*CP*TP*A)-3'), DNA (5'-D(*AP*TP*AP*GP*AP*AP*GP*AP*AP*TP*TP*CP*(5 P*GP*TP*TP*CP*CP*AP*G)-3'), METHYL-CPG-BINDING PROTEIN 2: MBD DOMAIN, UNP RESIDUES 77-167 DNA BINDING PROTEIN/DNA A/T RUN, MECP2, HYDRATION SPINE, METHYLATED DNA, DNA BINDING DNA COMPLEX
5cg9	prot-nuc 2.69	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	NGTET1 IN COMPLEX WITH 5MC DNA IN SPACE GROUP P3221 TET-LIKE DIOXYGENASE: UNP RESIDUES 57-321, DNA (5'-D(P*CP*AP*TP*GP*CP*GP*CP*TP*GP*AP*C)-3'), DNA (5'-D(*TP*GP*TP*CP*AP*GP*(5CM)P*GP*CP*AP*TP*G CHAIN: C, F OXIDOREDUCTASE/DNA DIOXYGENASE, 5-METHYLCYTOSINE, NGTET1, OXIDOREDUCTASE-DNA CO
5cpj	prot-nuc 3.15	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 12(C10 H16 N3 O7 P)	NUCLEOSOME CONTAINING METHYLATED SAT2R DNA DNA (146-MER), HISTONE H2B TYPE 1-J, HISTONE H3.1, HISTONE H2A TYPE 1-B/E, HISTONE H4, DNA (146-MER) "STRUCTURAL PROTEIN/DNA HISTONE FOLD, DNA BINDING, NUCLEUS, NUCLEOSOME, CHROMATIN FO DNA METHYLATION, STRUCTURAL PROTEIN-DNA COMPLEX, "STRUCTURA PROTEIN-DNA COMPLEX
5cpk	prot-nuc 2.63	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 12(C10 H16 N3 O7 P)	NUCLEOSOME CONTAINING METHYLATED SAT2L DNA HISTONE H2B TYPE 1-J, HISTONE H3.1, DNA (145-MER), DNA (145-MER), HISTONE H2A TYPE 1-B/E, HISTONE H4 STRUCTURAL PROTEIN/DNA HISTONE FOLD, DNA BINDING, NUCLEUS, NUCLEOSOME, CHROMATIN FO DNA METHYLATION, STRUCTURAL PROTEIN-DNA COMPLEX
5ef6	prot-nuc 3.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 8(C10 H16 N3 O7 P)	STRUCTURE OF HOXB13 COMPLEX WITH METHYLATED DNA HOMEOBOX PROTEIN HOX-B13: UNP RESIDUES 217-278, DNA (5'-D(P*GP*GP*AP*CP*CP*TP*(5CM) P*GP*TP*AP*AP*AP*AP*CP*AP*CP*AP*A)-3'), DNA (5'-D(P*TP*TP*GP*TP*GP*TP*TP*TP*TP*AP*(5CM) P*GP*AP*GP*GP*TP*CP*C)-3') TRANSCRIPTION TRANSCRIPTION FACTOR, METHYLATED DNA, COMPLEX, TRANSCRIPTION
5ego	prot-nuc 2.54	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	HOXB13-MEIS1 HETERODIMER BOUND TO METHYLATED DNA HOMEOBOX PROTEIN HOX-B13: UNP RESIDUES 217-277, HOMEOBOX PROTEIN MEIS1: UNP RESIDUES 279-333, DNA (5'-D(*CP*CP*TP*(5CM) P*GP*TP*AP*AP*AP*AP*CP*TP*GP*TP*CP*AP*AP*C)-3'), DNA (5'-D(P*GP*TP*TP*GP*AP*CP*AP*GP*TP*TP*TP*TP*A P*GP*AP*GP*G)-3') TRANSCRIPTION TRANSCRIPTION FACTOR, HETERODIMER, COMPLEX, BOUND TO DNA, TRANSCRIPTION
5emc	prot-nuc 2.30	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	TRANSCRIPTION FACTOR GRDBD AND SMGRE COMPLEX DNA (5'-D(*CP*CP*AP*GP*AP*AP*(5CM) P*AP*TP*CP*AP*TP*GP*TP*TP*(5CM)P*TP*G)-3'), DNA (5'-D(*CP*CP*AP*GP*AP*AP*(5CM) P*AP*TP*GP*AP*TP*GP*TP*TP*(5CM)P*TP*G)-3'), GLUCOCORTICOID RECEPTOR: UNP RESIDUES 411-500 TRANSCRIPTION/DNA TRANSCRIPTION FACTOR, COMPLEX, DNA, TRANSCRIPTION-DNA COMPLE
5emp	prot-nuc 2.30	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	TRANSCRIPTION FACTOR GRDBD AND MMGRE COMPLEX GLUCOCORTICOID RECEPTOR: UNP RESIDUES 411-500, DNA (5'-D(P*CP*CP*AP*GP*AP*AP*CP*AP*TP*(5CM) P*AP*TP*GP*TP*TP*CP*TP*G)-3'), DNA (5'- D(*CP*CP*AP*GP*AP*AP*CP*AP*TP*GP*AP*TP*GP*TP*TP*CP*TP*G)-3' CHAIN: C TRANSCRIPTION/DNA TRANSCRIPTION FACTOR, COMPLEX, DNA, TRANSCRIPTION-DNA COMPLE
5gse	prot-nuc 3.14	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 3(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF UNUSUAL NUCLEOSOME HISTONE H2A TYPE 1-B/E, HISTONE H4, DNA (250-MER), DNA (250-MER), HISTONE H3.1, HISTONE H2B TYPE 1-J STRUCTURAL PROTEIN/DNA HISTONE-FOLD, DNA-BINDING, NUCLEUS, STRUCTURAL PROTEIN-DNA C
5j3e	prot-nuc 2.60	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF HUMAN THYN1 PROTEIN IN COMPLEX WITH 5- METHYLCYTOSINE CONTAINING DNA 5-METHYLCYTOSINE CONTAINING DNA, THYMOCYTE NUCLEAR PROTEIN 1 NUCLEAR PROTEIN/DNA PROTEIN-DNA COMPLEX, MODIFIED DNA, 5-METHYLCYTOSINE CONTAINI STRUCTURAL GENOMICS CONSORTIUM, SGC, NUCLEAR PROTEIN-DNA CO
5ke7	prot-nuc 2.06	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	MOUSE KLF4 ZNF1-3 AND TPG/MPA SEQUENCE DNA COMPLEX STRUCTURE KRUEPPEL-LIKE FACTOR 4: UNP RESIDUES 396-483, DNA (5'-D(*GP*CP*CP*AP*(5CM)P*AP*CP*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*GP*TP*GP*TP*GP*GP*C)-3') TRANSCRIPTION/DNA KLF4, ZINC FINGER, KRUPPEL-LIKE FACTORS, TRANSCRIPTION-DNA C
5ke8	prot-nuc 2.45	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	MOUSE KLF4 E446P ZNF1-3 AND MPG/MPG SEQUENCE DNA COMPLEX STR DNA (5'-D(*GP*AP*GP*GP*(5CM)P*GP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*(5CM)P*GP*CP*CP*TP*C)-3'), KRUEPPEL-LIKE FACTOR 4: UNP RESIDUES 396-483 TRANSCRIPTION/DNA KLF4, ZINC FINGER, KRUPPEL-LIKE FACTORS, TRANSCRIPTION-DNA C
5kl4	prot-nuc 1.78	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	WILMS TUMOR PROTEIN (WT1) ZNF2-4 Q369H IN COMPLEX WITH FORMY WILMS TUMOR PROTEIN: UNP RESIDUES 333-420, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5FC)P*GP*T)-3 CHAIN: B, E, DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, F TRANSCRIPTION/DNA WILMS TUMOR PROTEIN, WT1, ZINC FINGER, 5-FORMYL CYTOSINE, TRANSCRIPTION-DNA COMPLEX
5kl5	prot-nuc 2.29	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	WILMS TUMOR PROTEIN (WT1) ZNF2-4 Q369H IN COMPLEX WITH CARBO DNA DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(1CC)P*GP*T)-3 CHAIN: B, DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, WILMS TUMOR PROTEIN: UNP RESIDUES 333-420 TRANSCRIPTION/DNA WILMS TUMOR PROTEIN, WT1, ZINC FINGER, 5-CARBOXYL CYTOSINE, TRANSCRIPTION-DNA COMPLEX
5kl7	prot-nuc 1.58	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	WILMS TUMOR PROTEIN (WT1) ZNF2-4Q369R IN COMPLEX WITH CARBOX WILMS TUMOR PROTEIN: UNP RESIDUES 333-420, DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(1CC)P*GP*T)-3 CHAIN: B TRANSCRIPTION/DNA WILMS TUMOR PROTEIN, WT1, ZINC FINGER, 5-CARBOXYL CYTOSINE, TRANSCRIPTION-DNA COMPLEX
5lty	prot-nuc 2.66	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	HOMEOBOX TRANSCRIPTION FACTOR CDX2 BOUND TO METHYLATED DNA DNA (5'-D(P*GP*GP*AP*GP*GP*TP*(5CM) P*GP*TP*AP*AP*AP*AP*CP*AP*CP*AP*A)-3'), HOMEOBOX PROTEIN CDX-2, DNA (5'-D(P*TP*TP*GP*TP*GP*TP*TP*TP*TP*AP*(5CM) P*GP*AP*CP*CP*TP*CP*C)-3') TRANSCRIPTION TRANSCRIPTION, TRANSCRIPTION FACTOR, METHYLATED DNA
5lux	prot-nuc 3.23	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	HOMEOBOX TRANSCRIPTION FACTOR CDX1 BOUND TO METHYLATED DNA DNA (5'-D(P*TP*TP*GP*TP*GP*TP*TP*TP*TP*AP*(5CM) P*GP*AP*CP*CP*TP*C)-3'), DNA (5'-D(P*GP*AP*GP*GP*TP*(5CM) P*GP*TP*AP*AP*AP*AP*CP*AP*CP*AP*A)-3'), HOMEOBOX PROTEIN CDX-1, DNA (5'-D(P*TP*TP*GP*TP*GP*TP*TP*TP*TP*AP*(5CM) P*GP*AP*CP*CP*TP*CP*C)-3'), DNA (5'-D(P*GP*GP*AP*GP*GP*TP*(5CM) P*GP*TP*AP*AP*AP*AP*CP*AP*CP*AP*A)-3') TRANSCRIPTION TRANSCRIPTION, TRANSCRIPTION FACTOR, METHYLATED DNA
5mht	prot-nuc 2.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	TERNARY STRUCTURE OF HHAI METHYLTRANSFERASE WITH HEMIMETHYLATED DNA AND ADOHCY DNA (5'-D(*CP*CP*AP*TP*GP*(5CM) P*GP*CP*TP*GP*AP*C)-3'), PROTEIN (HHAI METHYLTRANSFERASE), DNA (5'-D(*GP*TP*CP*AP*GP*CP*GP*CP*AP*TP*GP*G)- 3') TRANSFERASE/DNA TRANSFERASE, METHYLTRANSFERASE, RESTRICTION SYSTEM, COMPLEX (METHYLTRANSFERASE/DNA)
5szx	prot-nuc 2.25	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	EPSTEIN-BARR VIRUS ZTA DNA BINDING DOMAIN HOMODIMER IN COMPL METHYLATED DNA ZTA TRANSCRIPTION FACTOR: DNA BINDING DOMAIN (UNP RESIDUES 175-236), DNA (5'-D(*AP*AP*GP*CP*AP*CP*TP*GP*AP*GP*(5CM) P*GP*AP*TP*GP*AP*AP*G)-3'), DNA (5'-D(*TP*CP*TP*TP*CP*AP*TP*(5CM) P*GP*CP*TP*CP*AP*GP*TP*GP*CP*T)-3') TRANSCRIPTION REGULATOR/DNA ZTA, ZEBRA, BZLF-1, AP-1, EPSTEIN-BARR VIRUS, EBV, 5-METHYLC 5MC, DNA METHYLATION, TRANSCRIPTION FACTOR, BASIC LEUCINE-Z BZIP, TRANSCRIPTION REGULATOR-DNA COMPLEX
5t00	prot-nuc 2.19	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	HUMAN CTCF ZNF3-7 AND METHYLATED DNA COMPLEX DNA (5'-TAG(5CM)GCCCCCTGCTGGC-3'), DNA (5'-GCCAGCAGGGGG(5CM)GCTA-3'), TRANSCRIPTIONAL REPRESSOR CTCF: UNP RESIDUES 321-465 TRANSCRIPTION REGULATOR/DNA CCCTC-BINDING FACTOR, ZINC FINGER, CTCF, TRANSCRIPTION REGUL COMPLEX
5t01	prot-nuc 1.89	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	HUMAN C-JUN DNA BINDING DOMAIN HOMODIMER IN COMPLEX WITH MET DNA TRANSCRIPTION FACTOR AP-1: DNA BINDING DOMAIN (UNP RESIDUES 254-315), DNA (5'-D(*AP*AP*TP*GP*GP*AP*(5CM) P*GP*AP*GP*TP*CP*AP*TP*AP*GP*GP*AP*G)-3'), DNA (5'- D(P*CP*TP*CP*CP*TP*AP*TP*GP*AP*CP*TP*CP*GP*TP*CP*CP*AP*T)-3 CHAIN: C TRANSCRIPTION REGULATOR/DNA ZTA, ZEBRA, BZLF-1, AP-1, EPSTEIN-BARR VIRUS, EBV, 5-METHYLC 5MC, DNA METHYLATION, TRANSCRIPTION FACTOR, BASIC LEUCINE-Z BZIP, TRANSCRIPTION REGULATOR-DNA COMPLEX
6mht	prot-nuc 2.05	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	TERNARY STRUCTURE OF HHAI METHYLTRANSFERASE WITH ADOHCY AND DNA CONTAINING 4'-THIO-2'DEOXYCYTIDINE AT THE TARGET DNA (5'-D(P*CP*CP*AP*TP*GP*(5CM) P*GP*CP*TP*GP*AP*C)-3'), DNA (5'-D(P*GP*TP*CP*AP*GP*(4SC) P*GP*CP*AP*TP*GP*G)-3'), CYTOSINE-SPECIFIC METHYLTRANSFERASE HHAI TRANSFERASE/DNA TRANSFERASE, METHYLTRANSFERASE, RESTRICTION SYSTEM, COMPLEX (METHYLTRANSFERASE/DNA)

5CY    N,N'-(DIPROPYL)-TETRAMETHYLINDODICARBOCYANINE

Code	Class Resolution	Description
3bep	prot-nuc 1.92	N,N'-(DIPROPYL)-TETRAMETHYLINDODICARBOCYANINE C31 H39 N2 O2 1+	STRUCTURE OF A SLIDING CLAMP ON DNA DNA (5'- D(P*DCP*DCP*DCP*DAP*DTP*DCP*DGP*DTP*DAP*DT)-3'), DNA (5'- D(*DTP*DTP*DTP*DTP*DAP*DTP*DAP*DCP*DGP*DAP*DTP*DGP*DGP*DG)- 3'), DNA POLYMERASE III SUBUNIT BETA TRANSFERASE, TRANSCRIPTION/DNA BETA SUBUNIT, SLIDING CLAMP, E. COLI POLYMERASE III, DNA COMPLEX, TRANSFERASE, TRANSCRIPTION/DNA COMPLEX
4jrp	prot-nuc 1.95	1-(3-HYDROXYPROPYL)-2-{(1E,3E,5E)-5-[1-(3- HYDROXYPROPYL)-3,3-DIMETHYL-1,3-DIHYDRO-2H-INDOL-2- YLIDENE]PENTA-1,3-DIEN-1-YL}-3,3-DIMETHYL-3H-INDOLIUM 2(C31 H39 N2 O2 1+)	STRUCTURE OF E. COLI EXONUCLEASE I IN COMPLEX WITH A 5CY-DT1 OLIGONUCLEOTIDE EXODEOXYRIBONUCLEASE I, 5CY-DT13 HYDROLASE/DNA DNA REPAIR, DNAQ SUPERFAMILY, EXONUCLEASE, HYDROLASE-DNA COM
4k8x	prot-nuc 2.28	1-(3-HYDROXYPROPYL)-2-{(1E,3E,5E)-5-[1-(3- HYDROXYPROPYL)-3,3-DIMETHYL-1,3-DIHYDRO-2H-INDOL-2- YLIDENE]PENTA-1,3-DIEN-1-YL}-3,3-DIMETHYL-3H-INDOLIUM C31 H39 N2 O2 1+	BINARY COMPLEX OF 9N DNA POLYMERASE IN THE REPLICATIVE STATE DNA POLYMERASE, DNA (5'- D(P*AP*AP*AP*GP*GP*CP*GP*CP*AP*GP*TP*TP*CP*GP*CP*G)-3'), DNA (5'-D(*CP*GP*CP*GP*AP*AP*CP*TP*GP*CP*GP*(DOC) CHAIN: P TRANSFERASE/DNA DNA POLYMERASE, BINARY COMPLEX, TRANSFERASE-DNA COMPLEX

5DB    1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-METHOXY-5-METHYLPYRIMIDIN-2(1H)-ONE

Code	Class Resolution	Description
5dlf	prot-nuc 1.97	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-METHOXY-5-METHYLPYRIMIDIN-2(1H)-ONE C11 H17 N2 O8 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DATP O4-METHYLHYMIDINE DNA POLYMERASE ETA, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA (5'-D(*C*AP*TP*(5DB)P*AP*TP*GP*AP*CP*GP*CP*T) CHAIN: T TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA-DIRECTED DNA POLYMERASE, A TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SYNTHESIS ( BINDING, O4-ALKYLTHYMIDINE, O4-METHYLTHYMIDINE, TRANSFERASE COMPLEX
5dlg	prot-nuc 2.35	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-METHOXY-5-METHYLPYRIMIDIN-2(1H)-ONE C11 H17 N2 O8 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DGMP OPPOSITE O4-METHYLHYMIDINE DNA (5'-D(*CP*AP*TP*(5DB)P*AP*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA POLYMERASE ETA TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA-DIRECTED DNA POLYMERASE, G TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SYNTHESIS ( BINDING, O4-ALKYLTHYMIDINE, O4-METHYLTHYMIDINE, TRANSFERASE COMPLEX

5EJ    1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-ETHOXY-5-METHYLPYRIMIDIN-2(1H)-ONE

Code	Class Resolution	Description
5dqg	prot-nuc 2.29	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-ETHOXY-5-METHYLPYRIMIDIN-2(1H)-ONE C12 H19 N2 O8 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DAMP OPPOSITE O4-ETHYLTHYMIDINE DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA (5'-D(*CP*AP*TP*(5EJ)P*AP*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA-DIRECTED DNA POLYMERASE, A TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SYNTHESIS ( BINDING, O4-ALKYLTHYMIDINE, O4-ETHYLTHYMIDINE, TRANSFERASE- COMPLEX
5dqh	prot-nuc 1.99	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-ETHOXY-5-METHYLPYRIMIDIN-2(1H)-ONE C12 H19 N2 O8 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DGMP OPPOSITE O4-ETHYLTHYMIDINE DNA (5'-D(*CP*AP*TP*(5EJ)P*AP*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA POLYMERASE ETA: UNP RESIDUES 1-432 TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA-DIRECTED DNA POLYMERASE, G TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SYNTHESIS ( BINDING, O4-ALKYLTHYMIDINE, O4-ETHYLTHYMIDINE, TRANSFERASE- COMPLEX
5dqi	prot-nuc 2.30	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-ETHOXY-5-METHYLPYRIMIDIN-2(1H)-ONE C12 H19 N2 O8 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA EXTENDING AN O ETHYLTHYMIDINE : DA PAIR BY INSERTING DCTP OPPOSITE DG DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*AP*C)-3'), DNA (5'-D(*CP*AP*TP*GP*(5EJ)P*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA POLYMERASE ETA TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA-DIRECTED DNA POLYMERASE, A TRIPHOSPHATE, Y-FAMILY POLYMERASE, TRANS-LESION SYNTHESIS ( BINDING, O4-ALKYLTHYMIDINE, O4-ETHYLTHYMIDINE, TRANSFERASE- COMPLEX

5FC    5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
4r2d	prot-nuc 2.09	5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H14 N3 O8 P)	EGR1/ZIF268 ZINC FINGERS IN COMPLEX WITH FORMYLATED DNA EARLY GROWTH RESPONSE PROTEIN 1: ZINC FINGER 1-3, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5FC)P*GP*T)-3 CHAIN: B, DNA (5'-D(*TP*AP*(5FC)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
4r2q	prot-nuc 1.54	5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H14 N3 O8 P)	WILMS TUMOR PROTEIN (WT1) ZINC FINGERS IN COMPLEX WITH FORMY DNA (5'-D(*TP*AP*(5FC)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5FC)P*GP*T)-3 CHAIN: B, WILMS TUMOR PROTEIN, ISOFORM 4/CRA_A: ZINC FINGER 2-4 DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
5d9y	prot-nuc 1.97	5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H14 N3 O8 P	CRYSTAL STRUCTURE OF TET2-5FC COMPLEX METHYLCYTOSINE DIOXYGENASE TET2,METHYLCYTOSINE DI TET2, DNA (5'-D(*AP*CP*TP*GP*TP*(5FC)P*GP*AP*AP*GP*CP*T CHAIN: B, DNA (5'-D(*AP*GP*CP*TP*TP*CP*GP*AP*CP*AP*GP*T)-3' CHAIN: C OXIDOREDUCTASE/DNA 5-METHYLCYTOSINE DIOXYGENASE, TET2, 5-FORMYLCYTOSINE, PROTEI COMPLEX, OXIDOREDUCTASE-DNA COMPLEX
5kl4	prot-nuc 1.78	5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H14 N3 O8 P)	WILMS TUMOR PROTEIN (WT1) ZNF2-4 Q369H IN COMPLEX WITH FORMY WILMS TUMOR PROTEIN: UNP RESIDUES 333-420, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5FC)P*GP*T)-3 CHAIN: B, E, DNA (5'-D(*TP*AP*(5CM)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, F TRANSCRIPTION/DNA WILMS TUMOR PROTEIN, WT1, ZINC FINGER, 5-FORMYL CYTOSINE, TRANSCRIPTION-DNA COMPLEX

5FU    5-FLUORO-URIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2e9t	prot-nuc 2.60	5-FLUORO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 F N2 O9 P)	FOOT-AND-MOUTH DISEASE VIRUS RNA-POLYMERASE RNA DEPENDENT IN WITH A TEMPLATE-PRIMER RNA AND 5F-UTP RNA-DEPENDENT RNA POLYMERASE, 5'-R(*GP*GP*GP*CP*CP*CP*(5FU))-3', 5'-R(P*UP*AP*GP*GP*GP*CP*CP*C)-3' TRANSFERASE/RNA FOOT-AND-MOUTH DISEASE VIRUS, RNA-DEPENDENT RNA POLYMERASE, POLYMERASE, POLYMERASE, TRANSFERASE-RNA COMPLEX

5GP    GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1wah	prot-nuc model  	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	DNA POLYMERASE FROM BACTERIOPHAGE RB69, THEORETICAL MODEL DNA, DNA, DNA SUBSTRATE (TTTT), DNA POLYMERASE COMPLEX (NUCLEOTIDYLTRANSFERASE/DNA) NUCLEOTIDYLTRANSFERASE, RB69 DNA POLYMERASE (GP43), COMPLEX (NUCLEOTIDYLTRANSFERASE/DNA)
4ff2	prot-nuc 2.00	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	N4 MINI-VRNAP TRANSCRIPTION INITIATION COMPLEX, 2 MIN AFTER GTP, ATP AND MN BACTERIOPHAGE N4 P2 PROMOTER, VIRION RNA POLYMERASE TRANSFERASE/DNA RNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4ff3	prot-nuc 2.00	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	N4 MINI-VRNAP TRANSCRIPTION INITIATION COMPLEX, 3 MIN AFTER GTP, ATP AND MN BACTERIOPHAGE N4 P2 PROMOTER, VIRION RNA POLYMERASE TRANSFERASE/DNA RNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4ff4	prot-nuc 2.03	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	N4 MINI-VRNAP TRANSCRIPTION INITIATION COMPLEX, 4 MIN AFTER GTP, ATP AND MN BACTERIOPHAGE N4 P2 PROMOTER, VIRION RNA POLYMERASE TRANSFERASE/DNA RNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4x4n	prot-nuc 2.95	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CRYSTAL STRUCTURE OF THE A.FULGIDUS CCA-ADDING ENZYME IN COM A G70A ARGINYL-TRNA MINIHELIX RNA (5'-D(P*CP*G)-3'), G70A TRNA MINIHELIX, CCA-ADDING ENZYME TRANSFERASE/RNA PROTEIN-RNA COMPLEX, TRNA, NON-CODING RNA, CCA-ADDING ENZYME NUCLEOTIDYLTRANSFERASE, NCRNA, TRANSFERASE-RNA COMPLEX
4x4v	prot-nuc 2.60	GUANOSINE-5'-MONOPHOSPHATE 3(C10 H14 N5 O8 P)	CRYSTAL STRUCTURE OF THE A.FULGIDUS CCA-ADDING ENZYME IN COM A HUMAN MENBETA MINIHELIX ENDING IN CCACC AND AMPCPP CCA-ADDING ENZYME, HUMAN MENBETA MINIHELIX ENDING IN CCACC RNA BINDING PROTEIN PROTEIN-RNA COMPLEX, TRNA, NON-CODING RNA, CCA-ADDING ENZYME NUCLEOTIDYLTRANSFERASE, NCRNA, RNA BINDING PROTEIN

5GS    2'-C-METHYLURIDINE 5'-(TRIHYDROGEN DIPHOSPHATE)

Code	Class Resolution	Description
4wtf	prot-nuc 2.65	2'-C-METHYLURIDINE 5'-(TRIHYDROGEN DIPHOSPHATE) C10 H16 N2 O12 P2	CRYSTAL STRUCTURE OF HCV NS5B GENOTYPE 2A JFH-1 ISOLATE WITH E87Q C223H V321I MUTATIONS AND DELTA8 BETA HAIRPIN LOOP DEL COMPLEX WITH GS-639475, MN2+ AND SYMMETRICAL PRIMER TEMPLAT CAAAAUUU RNA PRIMER TEMPLATE CAAAAUUU, RNA-DIRECTED RNA POLYMERASE TRANSFERASE/RNA HCV, VIRAL, NS5B, RDRP, RESISTANCE MUTATION, TEMPLATE, PRIME INITIATION, DELTA8 BETA HAIRPIN LOOP DELETION, TRANSFERASE- COMPLEX

5HC    2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
3vyb	prot-nuc 2.40	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C10 H16 N3 O8 P	CRYSTAL STRUCTURE OF METHYL CPG BINDING DOMAIN OF MBD4 IN CO THE 5MCG/HMCG SEQUENCE DNA (5'-D(*GP*TP*CP*AP*CP*TP*AP*CP*(5CM)P*GP*GP*A 3'), DNA (5'-D(*GP*TP*CP*(5HC)P*GP*GP*TP*AP*GP*TP*GP*A 3'), METHYL-CPG-BINDING DOMAIN PROTEIN 4: METHYL CPG BINDING DOMAIN, UNP RESIDUES 69-136 HYDROLASE/DNA METHYL CPG BINDING DOMAIN, PROTEIN-DNA COMPLEX, VERSATILE BA RECOGNITION, HYDROLASE-DNA COMPLEX
4par	prot-nuc 2.89	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	THE 5-HYDROXYMETHYLCYTOSINE-SPECIFIC RESTRICTION ENZYME ABAS COMPLEX WITH PRODUCT-LIKE DNA DNA 18-MER, UNCHARACTERIZED PROTEIN ABASI, DNA 14-MER DNA BINDING PROTEIN/DNA HYDROXYMETHYLCYTOSINE-DEPENDENT RESTRICTION ENZYME, HYDROLAS ENDONUCLEASE-LIKE, SRA DOMAIN-LIKE, EPIGENETIC SEQUENCING T
4pba	prot-nuc 3.30	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	THE 5-HYDROXYMETHYLCYTOSINE-SPECIFIC RESTRICTION ENZYME ABAS COMPLEX WITH SUBSTRATE-LIKE DNA UNCHARACTERIZED PROTEIN ABASI, DNA (32-MER) DNA BINDING PROTEIN/DNA HYDROXYMETHYLCYTOSINE-DEPENDENT RESTRICTION ENZYME, HYDROLAS ENDONUCLEASE-LIKE, SRA DOMAIN-LIKE, EPIGENETIC SEQUENCING T
4pw5	prot-nuc 2.20	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	STRUCTURE OF UHRF2-SRA IN COMPLEX WITH A 5HMC-CONTAINING DNA I E3 UBIQUITIN-PROTEIN LIGASE UHRF2, 5HMC-CONTAINING DNA1, 5HMC-CONTAINING DNA2 LIGASE/DNA SRA, 5HMC BINDING, 5HMC-CONTAINING DNA, HYDROXYMETHYLATION, LIGASE-DNA COMPLEX
4pw6	prot-nuc 3.79	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C10 H16 N3 O8 P	STRUCTURE OF UHRF2-SRA IN COMPLEX WITH A 5HMC-CONTAINING DNA II E3 UBIQUITIN-PROTEIN LIGASE UHRF2, 5HMC-CONTAINING DNA1, 5HMC-CONTAINING DNA2 LIGASE/DNA SRA, 5HMC BINDING, 5HMC-CONTAINING DNA, HYDROXYMETHYLATION, LIGASE-DNA COMPLEX
4r2c	prot-nuc 1.89	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	EGR1/ZIF268 ZINC FINGERS IN COMPLEX WITH HYDROXYMETHYLATED D EARLY GROWTH RESPONSE PROTEIN 1: ZINC FINGER 1-3, DNA (5'-D(*TP*AP*(5HC)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5HC)P*GP*T)-3 CHAIN: B DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
4r2p	prot-nuc 1.79	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	WILMS TUMOR PROTEIN (WT1) ZINC FINGERS IN COMPLEX WITH HYDROXYMETHYLATED DNA WILMS TUMOR PROTEIN, ISOFORM 4/CRA_A: ZINC FINGER 2-4, DNA (5'-D(*AP*GP*CP*GP*TP*GP*GP*GP*(5HC)P*GP*T)-3 CHAIN: B, DNA (5'-D(*TP*AP*(5HC)P*GP*CP*CP*CP*AP*CP*GP*C)-3 CHAIN: C DNA BINDING PROTEIN/DNA ZINC FINGER, TRANSCRIPTION, DNA BINDING PROTEIN-DNA COMPLEX
4ygi	prot-nuc 2.60	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C10 H16 N3 O8 P	CRYSTAL STRUCTURE OF SUVH5 SRA BOUND TO FULLY HYDROXYMETHYLA HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 S SUVH5: SUVH5 SRA DOMAIN, UNP RESIDUES 362-528, POLYDEOXYRIBONUCLEOTIDE TRANSFERASE/DNA SUVH5 SRA, FULLY HYDROXYMETHYLATED CG, 5-HYDROXYMETHYLCYTOSI BINDING PROTEIN., TRANSFERASE-DNA COMPLEX
5cg8	prot-nuc 2.70	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C10 H16 N3 O8 P	NGTET1 IN COMPLEX WITH 5HMC DNA DNA (5'-D(*AP*GP*AP*AP*TP*TP*CP*CP*GP*TP*TP*CP*CP CHAIN: B, DNA (5'-D(*TP*GP*GP*AP*AP*(5HC)P*GP*GP*AP*AP*TP*T 3'), TET-LIKE DIOXYGENASE: UNP RESIDUES 57-321 OXIDOREDUCTASE/DNA DIOXYGENASE, 5-HYDROXYMETHYLCYTOSINE, NGTET1, OXIDOREDUCTASE COMPLEX
5deu	prot-nuc 1.80	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF TET2-5HMC COMPLEX DNA (5'-D(P*CP*CP*AP*CP*(5HC)P*GP*GP*TP*GP*GP*T)- CHAIN: C, DNA (5'-D(*AP*CP*CP*AP*CP*(5HC)P*GP*GP*TP*GP*GP*T CHAIN: B, METHYLCYTOSINE DIOXYGENASE TET2, CHIMERIC CONSTRU CHAIN: A: UNP RESIDUES 1129-1480, 1844-1935 OXIDOREDUCTASE/DNA 5-METHYLCYTOSINE DIOXYGENASE, TET2, 5HMC, PROTEIN-DNA COMPLE OXIDOREDUCTASE-DNA COMPLEX

5HT    5-HYDROXY-THYMIDINE

Code	Class Resolution	Description
1ehl	prot-nuc 2.40	5-HYDROXY-THYMIDINE C10 H16 N2 O6	64M-2 ANTIBODY FAB COMPLEXED WITH D(5HT)(6-4)T 5'-(D(5HT)P*(6-4)T)-3', ANTI-(6-4) PHOTOPRODUCT ANTIBODY 64M-2 FAB (HEAVY CHAIN), ANTI-(6-4) PHOTOPRODUCT ANTIBODY 64M-2 FAB (LIGHT CHAIN) IMMUNE SYSTEM IMMUNOGLOBULIN, PROTEIN-DNA COMPLEX, DNA PHOTOPRODUCT, IMMUNE SYSTEM

5HU    5-HYDROXYMETHYLURIDINE-2'-DEOXY-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1y6g	prot-nuc 2.80	5-HYDROXYMETHYLURIDINE-2'-DEOXY-5'-MONOPHOSPHATE C10 H15 N2 O9 P	ALPHA-GLUCOSYLTRANSFERASE IN COMPLEX WITH UDP AND A 13_MER DNA CONTAINING A HMU BASE AT 2.8 A RESOLUTION DNA ALPHA-GLUCOSYLTRANSFERASE, 5'-D(*CP*TP*AP*TP*CP*TP*GP*AP*GP*TP*AP*T)-3', 5'-D(*GP*AP*TP*AP*CP*TP*(5HU)P*AP*GP*AP*TP*AP*G)- 3' TRANSFERASE/DNA TRANSFERASE, TRANSFERASE/DNA COMPLEX
1y8z	prot-nuc 1.90	5-HYDROXYMETHYLURIDINE-2'-DEOXY-5'-MONOPHOSPHATE C10 H15 N2 O9 P	ALPHA-GLUCOSYLTRANSFERASE IN COMPLEX WITH UDP AND A 13-MER D CONTAINING A HMU BASE AT 1.9 A RESOLUTION 5'-D(*CP*TP*AP*TP*CP*TP*GP*AP*G)-3', DNA ALPHA-GLUCOSYLTRANSFERASE, 5'-D(*GP*AP*TP*AP*CP*TP*(5HU)P*AP*GP*AP*TP*AP*G)- CHAIN: C TRANSFERASE/DNA TRANSFERASE, TRANSFERASE-DNA COMPLEX
4e9h	prot-nuc 3.00	5-HYDROXYMETHYLURIDINE-2'-DEOXY-5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF GLYCOSYLASE DOMAIN OF MBD4 BOUND TO 5HMU CONTAI METHYL-CPG-BINDING DOMAIN PROTEIN 4: GLYCOSYLASE DOMAIN OF MBD4 (RESIDUES 426-580), DNA (5'-D(*CP*CP*AP*GP*CP*GP*(5HU)P*GP*CP*AP*GP*C CHAIN: C, DNA (5'-D(*GP*CP*TP*GP*CP*GP*CP*GP*CP*TP*GP*G)-3' CHAIN: D HYDROLASE/DNA HHH DNA GLYCOSYLASE FAMILY, HYDROLASE-DNA COMPLEX
4ea4	prot-nuc 2.00	5-HYDROXYMETHYLURIDINE-2'-DEOXY-5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF THE GLYCOSYLASE DOMAIN OF MBD4 BOUND TO 5HMU-CO DNA METHYL-CPG-BINDING DOMAIN PROTEIN 4: GLYCOSYLASE DOMAIN OF MBD4 (RESIDUES 426-580), DNA (5'-D(*GP*CP*TP*GP*CP*GP*CP*GP*CP*TP*GP*G)-3' CHAIN: D, DNA (5'-D(*CP*CP*AP*GP*CP*GP*(5HU)P*GP*CP*AP*GP*C CHAIN: C HYDROLASE/DNA HHH DNA GLYCOSYLASE FAMILY, HYDROLASE-DNA COMPLEX
4ea5	prot-nuc 2.14	5-HYDROXYMETHYLURIDINE-2'-DEOXY-5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF THE GLYCOSLYASE DOMAIN OF MBD4 BOUND TO A 5HMU DNA METHYL-CPG-BINDING DOMAIN PROTEIN 4: GLYCOSYLASE DOMAIN (RESIDUES 426-580) OF MBD4, DNA (5'-D(*GP*CP*TP*GP*CP*GP*CP*GP*CP*TP*GP*G)-3' CHAIN: D, DNA (5'-D(*CP*CP*AP*GP*CP*GP*(5HU)*GP*CP*AP*GP*C) CHAIN: C HYDROLASE/DNA HHH DNA GLYCOSYLASE FAMILY, HYDROLASE-DNA COMPLEX
4ew0	prot-nuc 2.39	5-HYDROXYMETHYLURIDINE-2'-DEOXY-5'-MONOPHOSPHATE C10 H15 N2 O9 P	MOUSE MBD4 GLYCOSYLASE DOMAIN IN COMPLEX WITH A G:5HMU (5- HYDROXYMETHYLURACIL) MISMATCH METHYL-CPG-BINDING DOMAIN PROTEIN 4: GLYCOSYLASE DOMAIN, UNP RESIDUES 411-554, DNA (5'-D(*TP*CP*AP*GP*CP*GP*CP*AP*TP*GP*G)-3'), DNA (5'-D(*CP*CP*AP*TP*GP*(5HU)P*GP*CP*TP*GP*A)-3 CHAIN: C HYDROLASE/DNA 5-HYDROXYMETHYLURACIL, DEAMINATION, 5-METHYLCYTOSINE, ACTIVE DEMETHYLATION, HELIX-HAIRPIN-HELIX, DNA GLYCOSYLASE, HYDROL COMPLEX

5IU    5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1a31	prot-nuc 2.10	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 10(C9 H12 I N2 O8 P)	HUMAN RECONSTITUTED DNA TOPOISOMERASE I IN COVALENT COMPLEX WITH A 22 BASE PAIR DNA DUPLEX DNA (5'- D(*AP*AP*AP*AP*AP*GP*AP*CP*5IUP*5IU*TP*GP*AP*AP*AP*AP*AP*5I UP*5IUP*5IUP*5IUP*T)-3'), DNA (5'- D(*AP*AP*AP*AP*AP*TP*5IUP*5IUP*5IUP*5IUP*CP*AP*AP*AP*GP*TP* CP*TP*TP*TP*TP*T)-3'), PROTEIN (TOPOISOMERASE I): CORE DOMAIN AND C-TERMINAL DOMAIN ISOMERASE/DNA TOPOISOMERASE I/DNA, DNA, TOPOISOMERASE I, ISOMERASE/DNA COMPLEX
1a6y	prot-nuc 2.30	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	REVERBA ORPHAN NUCLEAR RECEPTOR/DNA COMPLEX DNA (5'- D(*CP*TP*GP*AP*CP*CP*TP*AP*GP*TP*GP*AP*CP*CP*TP*AP*GP*TP*TP *G)-3'), ORPHAN NUCLEAR RECEPTOR NR1D1: DNA BINDING DOMAIN CONSISTS OF RESIDUES A 101 TO A 164, B 101 TO B 164, DNA (5'- D(*CP*AP*AP*CP*TP*AP*GP*GP*TP*CP*AP*CP*(5IT) P*AP*GP*GP*TP*CP*AP*G)-3') TRANSCRIPTION/DNA ORPHAN RECEPTOR, NUCLEAR RECEPTOR, DNA-BINDING, REVERB, REV- ERB, TRANSCRIPTION REGULATION, TRANSCRIPTION/DNA COMPLEX
1ais	prot-nuc 2.10	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	TATA-BINDING PROTEIN/TRANSCRIPTION FACTOR (II)B/TATA-BOX COMPLEX FROM PYROCOCCUS WOESEI DNA (5'-D(*AP*AP*CP*TP*TP*AP*CP*TP*TP*TP*(5IU) P*(5IU)P*AP*AP*AP*GP*C)-3'), PROTEIN (TRANSCRIPTION INITIATION FACTOR IIB): C TERMINAL DOMAIN, PROTEIN (TATA-BINDING PROTEIN): RESIDUES 1 - 181, DNA (5'- D(*GP*CP*TP*TP*TP*AP*AP*AP*AP*AP*GP*TP*AP*AP*GP*TP*T )-3') TRANSCRIPTION/DNA TRANSCRIPTION, HYPERTHERMOPHILE, RIBOSOME BINDING, COMPLEX (RIBOSOME BINDING/ DNA), TRANSCRIPTION/DNA COMPLEX
1bf4	prot-nuc 1.60	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	CHROMOSOMAL DNA-BINDING PROTEIN SSO7D/D(GCGAACGC) COMPLEX PROTEIN (CHROMOSOMAL PROTEIN SSO7D), DNA (5'-D(*GP*CP*GP*AP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*5IUP*CP*GP*C)-3') DNA-BINDING PROTEIN/DNA DNA BINDING PROTEIN, HYPERTHERMOPHILE, ARCHAEBACTERIA, COMPLEX (DNA-BINDING PROTEIN/DNA)
1ckt	prot-nuc 2.50	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	CRYSTAL STRUCTURE OF HMG1 DOMAIN A BOUND TO A CISPLATIN-MODI DUPLEX DNA (5'-D(*CP*CP*(5IU) P*CP*TP*CP*TP*GP*GP*AP*CP*CP*TP*TP*CP*C)-3'), HIGH MOBILITY GROUP 1 PROTEIN: RESIDUES 8-78, DOMAIN A, DNA (5'-D(*GP*GP*AP*AP*GP*GP*TP*CP*CP*AP*GP*AP*GP 3') GENE REGULATION/DNA HIGH-MOBILITY GROUP DOMAIN, BENT DNA, PROTEIN-DRUG-DNA COMPL REGULATION-DNA COMPLEX
1ga5	prot-nuc 2.40	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	CRYSTAL STRUCTURE OF THE ORPHAN NUCLEAR RECEPTOR REV- ERB(ALPHA) DNA-BINDING DOMAIN BOUND TO ITS COGNATE RESPONSE ELEMENT 5'- D(*CP*AP*AP*CP*TP*AP*GP*GP*TP*CP*AP*CP*TP*AP*GP*GP*TP*CP*AP *G)-3', ORPHAN NUCLEAR RECEPTOR NR1D1: DNA-BINDING DOMAIN PLUS C-TERMINAL EXTENSION, 5'- D(*CP*TP*GP*AP*CP*CP*TP*AP*GP*TP*GP*AP*CP*CP*TP*AP*GP*TP*(5 IT)P*G)-3' TRANSCRIPTION/DNA ORPHAN RECEPTOR, NUCLEAR RECEPTOR, DNA-BINDING, REVERB, REV- ERB, TRANSCRIPTION/DNA COMPLEX
1jj6	prot-nuc 2.30	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS. 5'-D(*AP*TP*CP*TP*TP*AP*TP*CP*AP*AP*AP*AP*AP*C)- 3', DNA-INVERTASE HIN: RESIDUES 139 TO 190, 5'-D(*TP*GP*TP*(5IT) P*TP*TP*TP*GP*AP*TP*AP*AP*GP*A)-3' DNA BINDING PROTEIN/DNA WATER-MEDIATED RECOGNITION, PROTEIN-DNA COMPLEX, HIN RECOMBINASE, I5, DNA BINDING PROTEIN/DNA COMPLEX
1jj8	prot-nuc 2.75	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION B SYSTEMATIC MUTATIONS 5'-D(*TP*GP*(5IT)P*TP*TP*TP*TP*GP*AP*TP*AP*AP*GP* CHAIN: A, 5'-D(*AP*TP*CP*TP*TP*AP*TP*CP*AP*AP*AP*AP*AP*C)-3 CHAIN: B, DNA-INVERTASE HIN: RESIDUES 139 TO 190 DNA BINDING PROTEIN/DNA WATER-MEDIATED RECOGNITION, PROTEIN-DNA COMPLEX, HIN RECOMBI FORM 2, DNA BINDING PROTEIN-DNA COMPLEX
1k4s	prot-nuc 3.20	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 15(C9 H12 I N2 O8 P)	HUMAN DNA TOPOISOMERASE I IN COVALENT COMPLEX WITH A 22 BASE PAIR DNA DUPLEX 5'-D(*AP*AP*AP*AP*AP*GP*AP*CP*(5IU)P*(5IU))-3', DNA TOPOISOMERASE I: CORE DOMAIN AND C-TERMINAL DOMAIN, RESIDUES 174- 765, 5'-D(*(SPT)P*GP*AP*AP*AP*AP*AP*(5IU)P*(5IU) P*(5IU)P*(5IU)P*T)-3', 5'-D(*AP*AP*AP*AP*AP*TP*(IDO)UP*(IDO)UP*(IDO) UP*(IDO)UP*CP*AP*AP*AP*GP*(IDO)UP*CP*(IDO)UP*(IDO)UP*(IDO) UP*(IDO)UP*T)-3' ISOMERASE/DNA COMPLEX (ISOMERASE/DNA), DNA, TOPOISOMERASE I
1k61	prot-nuc 2.10	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	MATALPHA2 HOMEODOMAIN BOUND TO DNA 5'- D(*AP*CP*AP*TP*GP*TP*AP*AP*TP*TP*CP*AP*TP*TP*TP*AP*CP*AP*CP *GP*C)-3', MATING-TYPE PROTEIN ALPHA-2: RESIDUES 132-191, HOMEODOMAIN, 5'-D(*(5IU) P*GP*CP*GP*TP*GP*TP*AP*AP*AP*TP*GP*AP*AP*TP*TP*AP*CP*AP*TP* G)-3' TRANSCRIPTION/DNA PROTEIN-DNA COMPLEX, HOMEODOMAIN, HOOGSTEEN BASE PAIR, TRANSCRIPTION/DNA COMPLEX
1lei	prot-nuc 2.70	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 I N2 O8 P)	THE KB DNA SEQUENCE FROM THE HLV-LTR FUNCTIONS AS AN ALLOSTERIC REGULATOR OF HIV TRANSCRIPTION NUCLEAR FACTOR NF-KAPPA-B P50 SUBUNIT: P50 RHR, 5'- D(*CP*TP*CP*AP*GP*GP*GP*AP*AP*AP*GP*TP*AP*CP*AP*GP*A)-3', NUCLEAR FACTOR NF-KAPPA-B P65 SUBUNIT: P65 RHR, 5'- D(*TP*CP*TP*GP*5ITP*AP*CP*5ITP*5ITP*5ITP*CP*CP*CP*TP*GP*AP* G)-3' TRANSCRIPTION/DNA TRANSCRIPTION FACTOR, NF-KB/DNA COMPLEX, CRYSTAL STRUCTURE, TRANSCRIPTION/DNA COMPLEX
1nh2	prot-nuc 1.90	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	CRYSTAL STRUCTURE OF A YEAST TFIIA/TBP/DNA COMPLEX TRANSCRIPTION INITIATION FACTOR IIA SMALL CHAIN, 5'-D(*TP*GP*TP*AP*(5IU)P*GP*TP*AP*TP*AP*(5IU) P*AP*AP*AP*AP*C)-3', TRANSCRIPTION INITIATION FACTOR IIA LARGE CHAIN: N-TERMINAL 54 RESIDUES, TRANSCRIPTION INITIATION FACTOR TFIID: C-TERMINAL 180 RESIDUES, 5'- D(*GP*TP*TP*TP*TP*AP*TP*AP*TP*AP*CP*AP*TP*AP*CP*A)-3', TRANSCRIPTION INITIATION FACTOR IIA LARGE CHAIN: C-TERMINAL 77 RESIDUES TRANSCRIPTION/DNA TRANSCRIPTION/DNA
1p59	prot-nuc 2.50	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 3(C9 H12 I N2 O8 P)	STRUCTURE OF A NON-COVALENT ENDONUCLEASE III-DNA COMPLEX 5'-D(*AP*AP*GP*AP*CP*GP*(5IU)P*GP*GP*AP*C)-3', ENDONUCLEASE III, 5'-D(TP*GP*(5IU)P*CP*CP*AP*(3DR)P*GP*(5IU) P*CP*T)-3' HYDROLASE/DNA DNA REPAIR, DNA GLYCOSYLASE, [4FE-4S] CLUSTER, IRON-SULFUR CLUSTER, HYDROLASE/DNA COMPLEX
1srs	prot-nuc 3.20	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	SERUM RESPONSE FACTOR (SRF) CORE COMPLEXED WITH SPECIFIC SRE DNA PROTEIN (SERUM RESPONSE FACTOR (SRF)), DNA (5'- D(*CP*CP*AP*TP*GP*GP*CP*CP*TP*AP*AP*TP*TP*AP*GP*GP*A P*AP*G)-3'), DNA (5'-D(*CP*CP*(5IU) P*TP*CP*CP*TP*AP*AP*TP*TP*AP*GP*GP*CP*CP*AP*TP*G)-3') TRANSCRIPTION/DNA TRANSCRIPTION REGULATION, MADS-DOMAIN, COMPLEX (DNA BINDING PROTEIN/DNA), TRANSCRIPTION/DNA COMPLEX
1zme	prot-nuc 2.50	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	CRYSTAL STRUCTURE OF PUT3/DNA COMPLEX DNA (5'-D(*AP*CP*GP*GP*AP*GP*(5IU) P*TP*GP*GP*CP*TP*(5IU)P*CP*CP*CP*G)-3'), PROLINE UTILIZATION TRANSCRIPTION ACTIVATOR: RESIDUES 31 - 100, DNA (5'- D(*AP*CP*GP*GP*GP*AP*AP*GP*CP*CP*AP*AP*CP*TP*CP*CP*G)-3') TRANSCRIPTION/DNA COMPLEX (TRANSCRIPTION REGULATION/DNA), PUT3, ZN2CYS6, BINUCLEAR CLUSTER, TRANSCRIPTION FACTOR, TRANSCRIPTION/DNA COMPLEX
2bsq	prot-nuc 3.00	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2()	FITAB BOUND TO DNA TRAFFICKING PROTEIN A: DNA-BINDING PROTEIN, RESIDUES 2-78, IR36, REVERSE STRAND, IR36, FORWARD STRAND, TRAFFICKING PROTEIN B: PIN DOMAIN, RESIDUES 1-139 TRANSCRIPTION TRANSCRIPTION, TRANSCRIPTION REGULATION COMPLEX, PIN DOMAIN, RIBBON-HELIX-HELIX, DNA BINDING, HETERODIMER
2h1o	prot-nuc 3.00	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	STRUCTURE OF FITAB BOUND TO IR36 DNA FRAGMENT TRAFFICKING PROTEIN B, IR36-STRAND 2, IR36-STRAND 1, TRAFFICKING PROTEIN A GENE REGULATION/DNA COMPLEX PIN DOMAIN, RHH PROTEIN, DNA BINDING, TETRAMER OF DIMERS, GENE REGULATION/DNA COMPLEX COMPLEX
2irf	prot-nuc 2.20	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 6(C9 H12 I N2 O8 P)	CRYSTAL STRUCTURE OF AN IRF-2/DNA COMPLEX. DNA (5'-D(P*AP*AP*GP*TP*GP*AP*AP*AP*GP*(5IU) P*GP*A)-3'), DNA (5'- D(*TP*TP*CP*AP*CP*TP*TP*TP*CP*AP*CP*(5IU)P*T)-3'), INTERFERON REGULATORY FACTOR 2: DNA-BINDING DOMAIN GENE REGULATION/DNA TRANSCRIPTION FACTOR, IFN INDUCTION, IRF FAMILY, GENE REGULATION/DNA COMPLEX
2nll	prot-nuc 1.90	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	RETINOID X RECEPTOR-THYROID HORMONE RECEPTOR DNA-BINDING DOMAIN HETERODIMER BOUND TO THYROID RESPONSE ELEMENT DNA PROTEIN (THYROID HORMONE RECEPTOR), DNA (5'-D(*CP*AP*GP*GP*TP*CP*AP*TP*TP*(5IU) P*CP*AP*GP*GP*TP*CP*AP*G)-3'), DNA (5'- D(*CP*TP*GP*AP*CP*CP*TP*GP*AP*AP*AP*TP*GP*AP*CP*CP*T P*G)- 3'), PROTEIN (RETINOIC ACID RECEPTOR) TRANSCRIPTION/DNA COMPLEX (TRANSCRIPTION REGULATION/DNA), DNA-BINDING, NUCLEAR PROTEIN, ZINC- FINGER, MULTIGENE FAMILY, ALTERNATIVE SPLICING, RECEPTOR, TRANSCRIPTION/DNA COMPLEX
2q2k	prot-nuc 3.00	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	STRUCTURE OF NUCLEIC-ACID BINDING PROTEIN DNA (5'-D(*AP*GP*TP*AP*TP*AP*(5IU)P*AP*CP*(5IU) P*AP*GP*TP*AP*TP*AP*TP*AP*CP*T)-3'), HYPOTHETICAL PROTEIN DNA BINDING PROTEIN/DNA PROTEIN-DNA, PARTITION, SEGREGATION, PARB, DNA BINDING PROTEIN/DNA COMPLEX
2ram	prot-nuc 2.40	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 I N2 O8 P)	A NOVEL DNA RECOGNITION MODE BY NF-KB P65 HOMODIMER PROTEIN (TRANSCRIPTION FACTOR NF-KB P65): P65 RESIDUES 19 - 291, DNA (5'- D(*CP*GP*GP*CP*TP*GP*GP*AP*AP*AP*TP*(5IU)P*(5IU) P*CP*CP*AP*GP*CP*CP*G)-3') TRANSCRIPTION/DNA COMPLEX (TRANSCRIPTION FACTOR/DNA), DNA-BINDING, TRANSCRIPTION REGULATION, ACTIVATOR NUCLEAR PROTEIN, PHOSPHORYLATION, CONFORMATION, TRANSCRIPTION/DNA COMPLEX
3bsu	prot-nuc 2.10	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	HYBRID-BINDING DOMAIN OF HUMAN RNASE H1 IN COMPLEX WITH 12- MER RNA/DNA DNA (5'-D(*DGP*DAP*DAP*DTP*DCP*DAP*DGP*DGP*(5IU) P*DGP*DTP*DC)-3'), RNA (5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP*UP*C)- 3'), RIBONUCLEASE H1: CATALYTIC DOMAIN HYDROLASE/RNA/DNA RNASE H, RNA/DNA HYBRID, DSRNA, HYDROLASE/RNA/DNA COMPLEX
3hot	prot-nuc 3.25	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 3(C9 H12 I N2 O8 P)	CRYSTAL STRUCTURE OF THE MOS1 MARINER PAIRED END COMPLEX WIT MOS1 NTS INVERTED REPEAT DNA, MOS1 TS INVERTED REPEAT DNA, TRANSPOSABLE ELEMENT MARINER, COMPLETE CDS TRANSFERASE, DNA BINDING PROTEIN/DNA PROTEIN-DNA COMPLEX, SYNAPTIC COMPLEX, TRANSPOSASE, INVERTED DNA, DNA BINDING PROTEIN-DNA COMPLEX, TRANSFERASE
3k70	prot-nuc 3.59	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 18(C9 H12 I N2 O8 P)	CRYSTAL STRUCTURE OF THE COMPLETE INITIATION COMPLEX OF RECBCD EXODEOXYRIBONUCLEASE V GAMMA CHAIN, EXODEOXYRIBONUCLEASE V ALPHA CHAIN, DNA (46-MER), EXODEOXYRIBONUCLEASE V BETA CHAIN HYDROLASE/DNA RECOMBINATION, HELICASE, NUCLEASE, HYDROLASE, DNA REPAIR, ATP-BINDING, DNA DAMAGE, ENDONUCLEASE, EXONUCLEASE, NUCLEOTIDE-BINDING, HYDROLASE/DNA COMPLEX
4m8o	prot-nuc 2.20	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 7(C9 H12 I N2 O8 P)	TERNARY COMPLEX OF DNA POLYMERASE EPSILON WITH AN INCOMING D TEMPLATE DNA, PRIMER DNA, DNA POLYMERASE EPSILON CATALYTIC SUBUNIT A: POL2 DOMAIN, UNP RESIDUES 1-1228 TRANSFERASE/DNA DNA POLYMERASE B TYPE, DNA SYNTHESIS, PROTEIN-DNA COMPLEX, D REPLICATION, METAL-BINDING, TRANSFERASE DNA COMPLEX, NUCLEOTIDYLTRANSFERASE, TRANSFERASE-DNA COMPLEX
5a3d	prot-nuc 1.80	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 3(C9 H12 I N2 O8 P)	STRUCTURAL INSIGHTS INTO THE RECOGNITION OF CISPLATIN AND AAF-DG LESIONS BY RAD14 (XPA) DNA REPAIR PROTEIN RAD14: DNA BINDING DOMAIN, 5'-D(*DG 5IUP*GP*A 5IUP*GP*AP*CP*G 5IUP*AP*GP*AP*DGP*AP)-3', 5'-D(*DTP*CP*TP*CP*TP*AP*C 8FGP*TP*CP*AP*TP*CP*DA CHAIN: C DNA BINDING PROTEIN DNA BINDING PROTEIN, XPA, RAD14, NER, AAF-DG, CISPLATIN
5l2x	prot-nuc 2.20	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	CRYSTAL STRUCTURE OF HUMAN PRIMPOL TERNARY COMPLEX DNA-DIRECTED PRIMASE/POLYMERASE PROTEIN, DNA (5'-D(P*TP*CP*GP*CP*(5IU)P*AP*CP*C)-3'), DNA (5'-D(P*GP*GP*TP*AP*GP*CP*(DDG))-3') TRANSFERASE/DNA PROTEIN-DNA COMPLEX, TRANSFERASE-DNA COMPLEX

5MC    5-METHYLCYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1asy	prot-nuc 2.90	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	CLASS II AMINOACYL TRANSFER RNA SYNTHETASES: CRYSTAL STRUCTURE OF YEAST ASPARTYL-TRNA SYNTHETASE COMPLEXED WITH TRNA ASP T-RNA (75-MER), ASPARTYL-TRNA SYNTHETASE COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA) COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA)
1asz	prot-nuc 3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	THE ACTIVE SITE OF YEAST ASPARTYL-TRNA SYNTHETASE: STRUCTURAL AND FUNCTIONAL ASPECTS OF THE AMINOACYLATION REACTION T-RNA (75-MER), ASPARTYL-TRNA SYNTHETASE COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA) COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA)
1f7u	prot-nuc 2.20	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	CRYSTAL STRUCTURE OF THE ARGINYL-TRNA SYNTHETASE COMPLEXED W TRNA(ARG) AND L-ARG ARGINYL-TRNA SYNTHETASE, TRNA(ARG) LIGASE/RNA RNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETASE LIGASE-RNA COMPLEX
1f7v	prot-nuc 2.90	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	CRYSTAL STRUCTURE OF YEAST ARGINYL-TRNA SYNTHETASE COMPLEXED TRNAARG TRNA(ARG), ARGINYL-TRNA SYNTHETASE LIGASE/RNA TRNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETAS LIGASE-RNA COMPLEX
1il2	prot-nuc 2.60	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE E. COLI ASPARTYL-TRNA SYNTHETASE:YEAST TRNAASP:ASPARTYL-ADENYLATE COMPLEX ASPARTYL TRANSFER RNA, ASPARTYL-TRNA SYNTHETASE LIGASE/RNA PROTEIN-RNA COMPLEX, LIGASE/RNA COMPLEX
1ip8	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS IN THE PRE- TRANSLOCATIONAL STATE RIBOSOMAL PROTEIN L11, ELONGATION FACTOR G, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA RIBOSOME POSSIBLE INTERACTION BETWEEN SMALL AND LARGE RIBOSOMAL RNAS, MRNA AND TRNAS
1ipm	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR G, ELONGATION FACTOR TU, TRNAS BOUND TO A, P, AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-G, EF-TU
1ipo	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 23S RIBOSOMAL RNA, TRNA BOUND TO R SITE, 16S RIBOSOMAL RNA, ELONGATION FACTOR G, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', ELONGATION FACTOR TU, TRNA BOUND TO P SITE TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA
1ipq	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, ELONGATION FACTOR TU, TRNAS BOUND TO P AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3' TRANSLATION/RNA TRANSITION SUB-STATE, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-TU
1ipr	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRNA BOUND TO P SITE, ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*GP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', ELONGATION FACTOR G, 16S RIBOSOMAL RNA, TRNA BOUND TO R SITE, 23S RIBOSOMAL RNA TRANSLATION/RNA NONCOGNATE CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-TU
1ipu	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', TRNAS BOUND TO E, P, AND R SITES, NASCENT POLYPEPTIDE, 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA TRANSLATION/RNA PROOFREADING, GTP HYDROLYSIS, EF-TU, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA
1ir4	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	DOCKING MODEL OF T. THERMOPHILUS ARGRS AND YEAST TRNA(ARG) ARGINYL T-RNA, ARGINYL-TRNA SYNTHETASE LIGASE/RNA ROSSMANN FOLD, A-HELIX BUNDLE
1jgo	prot-nuc 5.60	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 5(C10 H16 N3 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, MESSENGER RNA MK27, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S11, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgp	prot-nuc 7.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 5(C10 H16 N3 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S8, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MV36, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S2 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgq	prot-nuc 5.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 5(C10 H16 N3 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MF36, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S4, TRNA(PHE), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1k5x	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	STRUCTURE OF THE TRANSLATING 80S RIBOSOME FROM YEAST, OBTAINED BY DOCKING ATOMIC MODELS FOR RNA AND PROTEIN COMPONENTS INTO A 15A CRYO-EM MAP. THIS FILE 1K5X CONTAINS THE 40S RIBOSOMAL SUBUNIT, THE P-SITE BOUND TRNA AND THE MRNA CODON. THE FILE 1K5Y CONTAINS THE 60S RIBOSOMAL SUBUNIT. 40S RIBOSOMAL PROTEIN S11, 40S RIBOSOMAL PROTEIN S9, 40S RIBOSOMAL PROTEIN S15, 40S RIBOSOMAL PROTEIN S22, P-SITE TRNA OF 80S RIBOSOME, 40S RIBOSOMAL PROTEIN S18, 40S RIBOSOMAL PROTEIN S14, 40S RIBOSOMAL PROTEIN S2, 40S RIBOSOMAL PROTEIN S29B, P-SITE CODON OF 80S RIBOSOME, 40S RIBOSOMAL PROTEIN S3, 40S RIBOSOMAL PROTEIN S16, 40S RIBOSOMAL PROTEIN S23, 40S RIBOSOMAL PROTEIN S13, 40S RIBOSOMAL PROTEIN S5, 40S RIBOSOMAL PROTEIN S20, 40S RIBOSOMAL PROTEIN S0A, 18S RIBOSOMAL RNA RIBOSOME CRYO-EM, 40S SACHAROMYCES CEREVISIAE RIBOSOME, HOMOLOGY MODELS
1l1u	prot-nuc model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	TERNARY COMPLEX DOCKED IN THE DECODING SITE OF THE 30S RIBOSOMAL SUBUNIT 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S9, 5'-STACKED TRNA, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, ELONGATION FACTOR TU, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S13, MESSENGER RNA IN THE D-SITE/ASITE, P-SITE AND E- SITE ON THE 30S RIBOSOME, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S7, 50S RIBOSOMAL PROTEIN L7/L12, 30S RIBOSOMAL PROTEIN S3, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S6 RIBOSOME TRNA, 5'-STACK, ANTICODON, DECODING, ELONGATION, PROTEIN SYNTHESIS, TRANSORIENTATION
1mj1	prot-nuc 13.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	FITTING THE TERNARY COMPLEX OF EF-TU/TRNA/GTP AND RIBOSOMAL INTO A 13 A CRYO-EM MAP OF THE COLI 70S RIBOSOME S12 RIBOSOMAL PROTEIN, HELIX 69 OF 23S RRNA, SARCIN-RICIN LOOP OF 23SRRNA, PHE-TRNA, ELONGATION FACTOR TU, S13 RIBOSOMAL PROTEIN, L11 RIBOSOMAL PROTEIN RIBOSOME 70S RIBOSOME, LOW RESOLUTION MODEL TERNARY COMPLEX, EF-TU, R
1ml5	prot-nuc 14.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	STRUCTURE OF THE E. COLI RIBOSOMAL TERMINATION COMPLEX WITH FACTOR 2 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN THX, 50S 5S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S19, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L16, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S4, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L13, T-RNA(PHE), 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S14, A- AND P-SITE MESSENGER RNA CODONS, 50S RIBOSOMAL PROTEIN L18, 30S RIBOSOMAL PROTEIN S16, 50S RIBOSOMAL PROTEIN L19, 30S RIBOSOMAL PROTEIN S15, 50S RIBOSOMAL PROTEIN L1, 50S RIBOSOMAL PROTEIN L14, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L24, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 50S RIBOSOMAL PROTEIN L5, 50S 23S RIBOSOMAL RNA, 30S 16S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L4, 30S RIBOSOMAL PROTEIN S8, 50S RIBOSOMAL PROTEIN L15, 30S RIBOSOMAL PROTEIN S10, 50S RIBOSOMAL PROTEIN L30, 30S RIBOSOMAL PROTEIN S2, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L29, PEPTIDE CHAIN RELEASE FACTOR 2, 30S RIBOSOMAL PROTEIN S13 RIBOSOME E. COLI, RIBOSOME, TERMINATION OF PROTEIN SYNTHESIS, RELEASE CRYO-ELETRON MICROSCOPY, ANGULAR RECONSTITUTION
1ob2	prot-nuc 3.35	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	E. COLI ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC KIRROMYCIN, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE/NUCLEAR PROTEIN HYDROLASE/NUCLEAR PROTEIN, HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA
1ob5	prot-nuc 3.10	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O8 P)	T. AQUATICUS ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC ENACYLOXIN IIA, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA, GTP-BINDING, NUCLEOTIDE-BINDING, PROTEIN BIOSYNTHESIS
1sz1	prot-nuc 6.21	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	MECHANISM OF CCA-ADDING ENZYMES SPECIFICITY REVEALED BY CRYS STRUCTURES OF TERNARY COMPLEXES TRNA NUCLEOTIDYLTRANSFERASE, T-RNA (76-MER) TRANSFERASE/RNA CCA-ADDING ENZYME, SPECIFICITY, TRNA, COMPLEX, TRANSFERASE-R COMPLEX
1ttt	prot-nuc 2.70	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O8 P)	PHE-TRNA, ELONGATION FACTOR EF-TU:GDPNP TERNARY COMPLEX OF ELONGATION FACTOR TU (EF-TU), TRANSFER RIBONUCLEIC ACID (YEAST, PHE) COMPLEX (ELONGATION FACTOR/TRNA) PROTEIN SYNTHESIS, EF-TU, TRNA, RIBOSOME, 1EFT, 4TNA, PEPTID ELONGATION RIBONUCLEOPROTEIN, COMPLEX (ELONGATION FACTOR-TR COMPLEX (ELONGATION FACTOR-TRNA) COMPLEX
2dlc	prot-nuc 2.40	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	CRYSTAL STRUCTURE OF THE TERNARY COMPLEX OF YEAST TYROSYL-TR SYNTHETASE T-RNA (76-MER), TYROSYL-TRNA SYNTHETASE, CYTOPLASMIC LIGASE/TRNA TYRRS, TRNA, LIGASE-TRNA COMPLEX
2om7	prot-nuc 7.30	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	STRUCTURAL BASIS FOR INTERACTION OF THE RIBOSOME WITH THE SW REGIONS OF GTP-BOUND ELONGATION FACTORS 30S RIBOSOMAL PROTEIN S12, P/E-TRNA, FRAGMENT OF23S RRNA (H95), FRAGMENT OF 16S RRNA (H44), FRAGMENT OF23S RRNA (H76), 30S RIBOSOMAL PROTEIN S2, 50S RIBOSOMAL PROTEIN L1, FRAGMENT OF 16S RRNA (H15), 16S RIBOSOMAL RNA (H5), FRAGMENT OF 16S RRNA (H14), FRAGMENT OF23S RRNA (H42-44), ELONGATION FACTOR G, FRAGMENT OF23S RRNA (H89), FRAGMENT OF23S RRNA (H68) RIBOSOME RNA-PROTEIN COMPLEX, RIBOSOME
3deg	prot-nuc 10.90	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	COMPLEX OF ELONGATING ESCHERICHIA COLI 70S RIBOSOME AND EF4( GMPPNP 50S RNA HELIX 42-44, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 30S RNA HELIX 8, P-TRNA, GTP-BINDING PROTEIN LEPA: EF4, 50S RNA HELIX 92, A/L-TRNA, 30S RNA HELIX 14, 50S RNA HELIX 95, 50S RNA HELIX 71 RIBOSOME RIBOSOME, TRANSLATION, LEPA, EF4, GTP-BINDING, MEMBRANE, NUC BINDING, ANTIBIOTIC RESISTANCE, RIBONUCLEOPROTEIN, RIBOSOMA PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METHYLATI
4cxg	prot-nuc 8.70	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT ROLLING: A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 18S RRNA - H44, 40S RIBOSOMAL PROTEIN US12, TRANSFER RNA, 28S RRNA - H95, 28S RRNA - H89, ELONGATION FACTOR 1A, MESSENGER RNA, 18S RRNA - H8, 18S RRNA - H5-H14 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX
4cxh	prot-nuc 8.90	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 28S RRNA - H95, TRANSFER RNA, 40S RIBOSOMAL PROTEIN US12, 18S RRNA - H44, 18S RRNA - H8, 18S RRNA - H5-H14, MESSENGER RNA, ELONGATION FACTOR 1A, 28S RRNA - H89 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX, ELONGATION FACTOR EE
4dr1	prot-nuc 3.60	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE APO 30S RIBOSOMAL SUBUNIT FROM THER THERMOPHILUS (HB8) 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dr2	prot-nuc 3.25	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr3	prot-nuc 3.35	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr4	prot-nuc 3.97	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, COGNATE TRANSFER RNA ANTICODON STEM-LOO MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr5	prot-nuc 3.45	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED COGNATE RNA ANTICODON STEM-LOOP AND STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*U)-3', 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr6	prot-nuc 3.30	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, NEAR-COGNATE TRANSFER RNA ANTICODON STE MISMATCHED AT THE FIRST CODON POSITION AND STREPTOMYCIN BOU 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*UP*U)-3', 5'-R(P*UP*UP*GP*AP*GP*GP*(PSU)P*GP*G)-3', 30S RIBOSOMAL PROTEIN S10, 5'-R(P*CP*UP*UP*GP*AP*GP*GP*(PSU)P*GP*GP*U)-3', 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr7	prot-nuc 3.75	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED NEAR-CO TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE SECOND C POSITION, AND STREPTOMYCIN BOUND 5'-R(P*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*GP*CP*CP*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 5'-R(*UP*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 5'-R(P*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4duy	prot-nuc 3.39	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4duz	prot-nuc 3.65	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv0	prot-nuc 3.85	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv1	prot-nuc 3.85	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv2	prot-nuc 3.65	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv3	prot-nuc 3.55	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv4	prot-nuc 3.65	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv5	prot-nuc 3.68	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv6	prot-nuc 3.30	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv7	prot-nuc 3.29	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4ji0	prot-nuc 3.49	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji1	prot-nuc 3.14	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji2	prot-nuc 3.64	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji3	prot-nuc 3.35	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji4	prot-nuc 3.69	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji5	prot-nuc 3.85	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji6	prot-nuc 3.55	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji7	prot-nuc 3.50	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji8	prot-nuc 3.74	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4kvb	prot-nuc 4.20	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THERMUS THERMOPHILUS HB27 30S RIBOSOMAL SUBUNIT LACKING RIBO PROTEIN S17 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, TRANSLATION, 50S RIBOSOMAL SUBUNIT, R
4lf4	prot-nuc 3.34	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf5	prot-nuc 3.75	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf6	prot-nuc 3.31	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf7	prot-nuc 3.15	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf8	prot-nuc 3.15	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf9	prot-nuc 3.28	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfa	prot-nuc 3.65	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfb	prot-nuc 3.01	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfc	prot-nuc 3.60	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4nxm	prot-nuc 3.65	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM A GIDB ( MUTANT OF THERMUS THERMOPHILUS (HB8) RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17 RIBOSOME STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE, DECODING RIBOSOME
4nxn	prot-nuc 3.54	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM A GIDB ( MUTANT OF THERMUS THERMOPHILUS (HB8), BOUND WITH STREPTOMYC RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE, DECODING RIBOSOME-ANTIBIOTIC COMPLEX
4x62	prot-nuc 3.45	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), RNA (5'-D(*AP*AP*AP*UP*UP*U)-3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x64	prot-nuc 3.35	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, RNA (5'-D(*(MA6)P*AP*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x65	prot-nuc 3.35	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, RNA (5'-D(*AP*(MA6)P*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x66	prot-nuc 3.45	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(*AP*AP*(MA6)P*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
5br8	prot-nuc 3.40	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	AMBIENT-TEMPERATURE CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUN THERMUS THERMOPHILUS IN COMPLEX WITH PAROMOMYCIN 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME 30S RIBOSOMAL SUBUNIT, PAROMOMYCIN, AMBIENT TEMPERATURE, SFX ELECTROSPINNING, RIBOSOME
5me0	prot-nuc 13.50	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 1 (30S IC-1) STA GE81112 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, FMET-TRNA, 30S RIBOSOMAL PROTEIN S5 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION
5me1	prot-nuc 13.50	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 2 (30S IC-2) STA GE81112 FMET-TRNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION
5no2	prot-nuc 5.16	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE) 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S6, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME
5no3	prot-nuc 5.16	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE WITHOUT US3) 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S18, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S5, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S16 RIBOSOME RIBOSOME
5no4	prot-nuc 5.16	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	RSGA-GDPNP BOUND TO THE 30S RIBOSOMAL SUBUNIT (RSGA ASSEMBLY INTERMEDIATE WITH US3) 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S6, SMALL RIBOSOMAL SUBUNIT BIOGENESIS GTPASE RSGA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S5, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME
5u4j	prot-nuc 3.70	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	STRUCTURAL BASIS OF CO-TRANSLATIONAL QUALITY CONTROL BY ARFA BOUND TO RIBOSOME 23S RRNA, PEPTIDE CHAIN RELEASE FACTOR 2, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S5, ALTERNATIVE RIBOSOME-RESCUE FACTOR A, P-SITE TRNA FMET, MRNA, 30S RIBOSOMAL PROTEIN S12, 16S RRNA, 30S RIBOSOMAL PROTEIN S4 RIBOSOME RIBOSOME, ARFA, RF2, NONSTOP TRANSLATION

5MU    5-METHYLURIDINE 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1asy	prot-nuc 2.90	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	CLASS II AMINOACYL TRANSFER RNA SYNTHETASES: CRYSTAL STRUCTURE OF YEAST ASPARTYL-TRNA SYNTHETASE COMPLEXED WITH TRNA ASP T-RNA (75-MER), ASPARTYL-TRNA SYNTHETASE COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA) COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA)
1asz	prot-nuc 3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE ACTIVE SITE OF YEAST ASPARTYL-TRNA SYNTHETASE: STRUCTURAL AND FUNCTIONAL ASPECTS OF THE AMINOACYLATION REACTION T-RNA (75-MER), ASPARTYL-TRNA SYNTHETASE COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA) COMPLEX (AMINOACYL-TRNA SYNTHASE/TRNA)
1b23	prot-nuc 2.60	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	E. COLI CYSTEINYL-TRNA AND T. AQUATICUS ELONGATION FACTOR EF TERNARY COMPLEX ELONGATION FACTOR TU, CYSTEINYL TRNA GENE REGULATION/RNA TRANSLATION ELONGATION FACTOR, TRANSFER RNA, PROTEIN SYNTHES REGULATION-RNA COMPLEX
1c0a	prot-nuc 2.40	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF THE E. COLI ASPARTYL-TRNA SYNTHETASE : TRNAASP : ASPARTYL-ADENYLATE COMPLEX ASPARTYL TRNA, ASPARTYL TRNA SYNTHETASE LIGASE/RNA PROTEIN-RNA COMPLEX, LIGASE/RNA COMPLEX
1efw	prot-nuc 3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	CRYSTAL STRUCTURE OF ASPARTYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS COMPLEXED TO TRNAASP FROM ESCHERICHIA COLI ASPARTYL-TRNA SYNTHETASE, ASPARTYL-TRNA LIGASE/RNA ASPARTYL-TRNA SYNTHETASE, TRNA, PROTEIN/RNA COMPLEX, LIGASE/RNA
1eg0	prot-nuc 11.50	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	FITTING OF COMPONENTS WITH KNOWN STRUCTURE INTO AN 11.5 A CRYO-EM MAP OF THE E.COLI 70S RIBOSOME PROTEIN (S5 RIBOSOMAL PROTEIN), PROTEIN (S4 RIBOSOMAL PROTEIN), PROTEIN (S15 RIBOSOMAL PROTEIN), PROTEIN (RIBOSOMAL PROTEIN L1), PROTEIN (S20 RIBOSOMAL PROTEIN), PROTEIN (RIBOSOMAL PROTEIN L6), FRAGMENT OF 23S RRNA: RESIDUES 1051-1108, PROTEIN (S7 RIBOSOMAL PROTEIN), PROTEIN (S8 RIBOSOMAL PROTEIN), HELIX 95 OF 23S RRNA, PROTEIN (S6 RIBOSOMAL PROTEIN), PROTEIN (RIBOSOMAL PROTEIN L11), PROTEIN (S17 RIBOSOMAL PROTEIN), FRAGMENT OF 16S RRNA HELIX 23: RESIDUES 673-713, FORMYL-METHIONYL-TRNA RIBOSOME 70S RIBOSOME, LOW RESOLUTION MODEL
1eqq	prot-nuc 3.20	5-METHYLURIDINE 5'-MONOPHOSPHATE 4(C10 H15 N2 O9 P)	SINGLE STRANDED DNA BINDING PROTEIN AND SSDNA COMPLEX SINGLE STRANDED DNA BINDING PROTEIN, 5'-R(*(5MU)P*(5MU)P*(5MU))-3' REPLICATION/RNA BETA BARREL, PROTEIN-DNA COMPLEX, REPLICATION/RNA COMPLEX
1f7u	prot-nuc 2.20	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF THE ARGINYL-TRNA SYNTHETASE COMPLEXED W TRNA(ARG) AND L-ARG ARGINYL-TRNA SYNTHETASE, TRNA(ARG) LIGASE/RNA RNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETASE LIGASE-RNA COMPLEX
1f7v	prot-nuc 2.90	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF YEAST ARGINYL-TRNA SYNTHETASE COMPLEXED TRNAARG TRNA(ARG), ARGINYL-TRNA SYNTHETASE LIGASE/RNA TRNA-PROTEIN COMPLEX, AMINOACYLATION, ARGINYL-TRNA SYNTHETAS LIGASE-RNA COMPLEX
1gsg	prot-nuc 2.80	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF E.COLI GLUTAMINYL-TRNA SYNTHETASE COMPLEXED WIT AND ATP AT 2.8 ANGSTROMS RESOLUTION TRNAGLN, GLUTAMINYL-TRNA SYNTHETASE LIGASE/RNA PROTEIN-T-RNA COMPLEX, SINGLE STRAND, PROTEIN/RNA, LIGASE-RN
1h3e	prot-nuc 2.90	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	TYROSYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS COMPLEXED WITH WILD-TYPE TRNATYR(GUA) AND WITH ATP AND TYROSINOL WILD-TYPE TRNATYR(GUA), TYROSYL-TRNA SYNTHETASE LIGASE LIGASE, CLASS I AMINOACYL-TRNA SYNTHETASE: ATP + L-TYROSINE TRNA(TYR) -> AMP + PPI + L-TYROSYL-TRNA(TYR)
1h4q	prot-nuc 3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	PROLYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS COMPLEXED WITH TRNAPRO(CGG), ATP AND PROLINOL TRNAPRO(CGG), PROLYL-TRNA SYNTHETASE AMINOACYL-TRNA SYNTHETASE AMINOACYL-TRNA SYNTHETASE, ATP + L-PROLINE + TRNA(PRO) AMP + PPI + L-PROLYL-TRNA(PRO), CLASS II AMINOACYL-TRNA SYNTHETASE
1h4s	prot-nuc 2.85	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	PROLYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS COMPLEXED WITH TRNAPRO(CGG) AND A PROLYL-ADENYLATE ANALOGUE TRNAPRO(CGG), PROLYL-TRNA SYNTHETASE AMINOACYL-TRNA SYNTHETASE AMINOACYL-TRNA SYNTHETASE, ATP + L-PROLINE + TRNA(PRO) AMP + PPI + L-PROLYL-TRNA(PRO), CLASS II AMINOACYL-TRNA SYNTHETASE
1il2	prot-nuc 2.60	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	CRYSTAL STRUCTURE OF THE E. COLI ASPARTYL-TRNA SYNTHETASE:YEAST TRNAASP:ASPARTYL-ADENYLATE COMPLEX ASPARTYL TRANSFER RNA, ASPARTYL-TRNA SYNTHETASE LIGASE/RNA PROTEIN-RNA COMPLEX, LIGASE/RNA COMPLEX
1ip8	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS IN THE PRE- TRANSLOCATIONAL STATE RIBOSOMAL PROTEIN L11, ELONGATION FACTOR G, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA RIBOSOME POSSIBLE INTERACTION BETWEEN SMALL AND LARGE RIBOSOMAL RNAS, MRNA AND TRNAS
1ipm	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 3(C10 H15 N2 O9 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR G, ELONGATION FACTOR TU, TRNAS BOUND TO A, P, AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-G, EF-TU
1ipo	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 23S RIBOSOMAL RNA, TRNA BOUND TO R SITE, 16S RIBOSOMAL RNA, ELONGATION FACTOR G, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', ELONGATION FACTOR TU, TRNA BOUND TO P SITE TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA
1ipq	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, ELONGATION FACTOR TU, TRNAS BOUND TO P AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3' TRANSLATION/RNA TRANSITION SUB-STATE, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-TU
1ipr	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRNA BOUND TO P SITE, ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*GP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', ELONGATION FACTOR G, 16S RIBOSOMAL RNA, TRNA BOUND TO R SITE, 23S RIBOSOMAL RNA TRANSLATION/RNA NONCOGNATE CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-TU
1ipu	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 3(C10 H15 N2 O9 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR TU, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*U)-3', TRNAS BOUND TO E, P, AND R SITES, NASCENT POLYPEPTIDE, 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA TRANSLATION/RNA PROOFREADING, GTP HYDROLYSIS, EF-TU, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA
1ir4	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	DOCKING MODEL OF T. THERMOPHILUS ARGRS AND YEAST TRNA(ARG) ARGINYL T-RNA, ARGINYL-TRNA SYNTHETASE LIGASE/RNA ROSSMANN FOLD, A-HELIX BUNDLE
1jgo	prot-nuc 5.60	5-METHYLURIDINE 5'-MONOPHOSPHATE 3(C10 H15 N2 O9 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, MESSENGER RNA MK27, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S11, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgp	prot-nuc 7.00	5-METHYLURIDINE 5'-MONOPHOSPHATE 3(C10 H15 N2 O9 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S8, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MV36, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S2 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgq	prot-nuc 5.00	5-METHYLURIDINE 5'-MONOPHOSPHATE 3(C10 H15 N2 O9 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MF36, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S4, TRNA(PHE), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1k5x	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF THE TRANSLATING 80S RIBOSOME FROM YEAST, OBTAINED BY DOCKING ATOMIC MODELS FOR RNA AND PROTEIN COMPONENTS INTO A 15A CRYO-EM MAP. THIS FILE 1K5X CONTAINS THE 40S RIBOSOMAL SUBUNIT, THE P-SITE BOUND TRNA AND THE MRNA CODON. THE FILE 1K5Y CONTAINS THE 60S RIBOSOMAL SUBUNIT. 40S RIBOSOMAL PROTEIN S11, 40S RIBOSOMAL PROTEIN S9, 40S RIBOSOMAL PROTEIN S15, 40S RIBOSOMAL PROTEIN S22, P-SITE TRNA OF 80S RIBOSOME, 40S RIBOSOMAL PROTEIN S18, 40S RIBOSOMAL PROTEIN S14, 40S RIBOSOMAL PROTEIN S2, 40S RIBOSOMAL PROTEIN S29B, P-SITE CODON OF 80S RIBOSOME, 40S RIBOSOMAL PROTEIN S3, 40S RIBOSOMAL PROTEIN S16, 40S RIBOSOMAL PROTEIN S23, 40S RIBOSOMAL PROTEIN S13, 40S RIBOSOMAL PROTEIN S5, 40S RIBOSOMAL PROTEIN S20, 40S RIBOSOMAL PROTEIN S0A, 18S RIBOSOMAL RNA RIBOSOME CRYO-EM, 40S SACHAROMYCES CEREVISIAE RIBOSOME, HOMOLOGY MODELS
1l1u	prot-nuc model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	TERNARY COMPLEX DOCKED IN THE DECODING SITE OF THE 30S RIBOSOMAL SUBUNIT 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S9, 5'-STACKED TRNA, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, ELONGATION FACTOR TU, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S13, MESSENGER RNA IN THE D-SITE/ASITE, P-SITE AND E- SITE ON THE 30S RIBOSOME, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S7, 50S RIBOSOMAL PROTEIN L7/L12, 30S RIBOSOMAL PROTEIN S3, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S6 RIBOSOME TRNA, 5'-STACK, ANTICODON, DECODING, ELONGATION, PROTEIN SYNTHESIS, TRANSORIENTATION
1mj1	prot-nuc 13.00	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	FITTING THE TERNARY COMPLEX OF EF-TU/TRNA/GTP AND RIBOSOMAL INTO A 13 A CRYO-EM MAP OF THE COLI 70S RIBOSOME S12 RIBOSOMAL PROTEIN, HELIX 69 OF 23S RRNA, SARCIN-RICIN LOOP OF 23SRRNA, PHE-TRNA, ELONGATION FACTOR TU, S13 RIBOSOMAL PROTEIN, L11 RIBOSOMAL PROTEIN RIBOSOME 70S RIBOSOME, LOW RESOLUTION MODEL TERNARY COMPLEX, EF-TU, R
1ml5	prot-nuc 14.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF THE E. COLI RIBOSOMAL TERMINATION COMPLEX WITH FACTOR 2 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN THX, 50S 5S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S19, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L16, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S4, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L13, T-RNA(PHE), 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S14, A- AND P-SITE MESSENGER RNA CODONS, 50S RIBOSOMAL PROTEIN L18, 30S RIBOSOMAL PROTEIN S16, 50S RIBOSOMAL PROTEIN L19, 30S RIBOSOMAL PROTEIN S15, 50S RIBOSOMAL PROTEIN L1, 50S RIBOSOMAL PROTEIN L14, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L24, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 50S RIBOSOMAL PROTEIN L5, 50S 23S RIBOSOMAL RNA, 30S 16S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L4, 30S RIBOSOMAL PROTEIN S8, 50S RIBOSOMAL PROTEIN L15, 30S RIBOSOMAL PROTEIN S10, 50S RIBOSOMAL PROTEIN L30, 30S RIBOSOMAL PROTEIN S2, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L29, PEPTIDE CHAIN RELEASE FACTOR 2, 30S RIBOSOMAL PROTEIN S13 RIBOSOME E. COLI, RIBOSOME, TERMINATION OF PROTEIN SYNTHESIS, RELEASE CRYO-ELETRON MICROSCOPY, ANGULAR RECONSTITUTION
1ob5	prot-nuc 3.10	5-METHYLURIDINE 5'-MONOPHOSPHATE 3(C10 H15 N2 O9 P)	T. AQUATICUS ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC ENACYLOXIN IIA, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA, GTP-BINDING, NUCLEOTIDE-BINDING, PROTEIN BIOSYNTHESIS
1qf6	prot-nuc 2.90	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF E. COLI THREONYL-TRNA SYNTHETASE COMPLEXED WITH COGNATE TRNA THREONYL-TRNA SYNTHETASE, THREONINE TRNA LIGASE/RNA THREONYL-TRNA SYNTHETASE, TRNA(THR), AMP, MRNA, AMINOACYLATI TRANSLATIONAL REGULATION, PROTEIN/RNA, LIGASE-RNA COMPLEX
1ser	prot-nuc 2.90	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	THE 2.9 ANGSTROMS CRYSTAL STRUCTURE OF T. THERMOPHILUS SERYL-TRNA SYNTHETASE COMPLEXED WITH TRNA SER TRNASER, PROTEIN (SERYL-TRNA SYNTHETASE (E.C.6.1.1.11)) LIGASE/RNA PROTEIN-T-RNA COMPLEX, LIGASE/RNA COMPLEX
1sz1	prot-nuc 6.21	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	MECHANISM OF CCA-ADDING ENZYMES SPECIFICITY REVEALED BY CRYS STRUCTURES OF TERNARY COMPLEXES TRNA NUCLEOTIDYLTRANSFERASE, T-RNA (76-MER) TRANSFERASE/RNA CCA-ADDING ENZYME, SPECIFICITY, TRNA, COMPLEX, TRANSFERASE-R COMPLEX
1ttt	prot-nuc 2.70	5-METHYLURIDINE 5'-MONOPHOSPHATE 3(C10 H15 N2 O9 P)	PHE-TRNA, ELONGATION FACTOR EF-TU:GDPNP TERNARY COMPLEX OF ELONGATION FACTOR TU (EF-TU), TRANSFER RIBONUCLEIC ACID (YEAST, PHE) COMPLEX (ELONGATION FACTOR/TRNA) PROTEIN SYNTHESIS, EF-TU, TRNA, RIBOSOME, 1EFT, 4TNA, PEPTID ELONGATION RIBONUCLEOPROTEIN, COMPLEX (ELONGATION FACTOR-TR COMPLEX (ELONGATION FACTOR-TRNA) COMPLEX
1u6b	prot-nuc 3.10	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF A SELF-SPLICING GROUP I INTRON WITH BOT 5'-R(*AP*AP*GP*CP*CP*AP*CP*AP*CP*AP*AP*AP*CP*CP*A *GP *GP*CP*C)-3': GROUP I EXON, 5'-R(*CP*AP*(5MU))-3', 197-MER: GROUP I INTRON, U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A STRUCTURAL PROTEIN/RNA INTRON, EXON, RIBOZYME, GROUP I, U1A, RNA, STRUCTURAL PROTEI COMPLEX
1zzn	prot-nuc 3.37	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF A GROUP I INTRON/TWO EXON COMPLEX THAT INCLUDES ALL CATALYTIC METAL ION LIGANDS. U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A RNA BINDING DOMAIN: RRM 1, 197-MER, 5'- R(*AP*AP*GP*CP*CP*AP*CP*AP*CP*AP*AP*AP*CP*CP*AP*GP*AP*CP*GP *GP*CP*C)-3', 5'-R(*CP*AP*(5MU))-3' STRUCTURAL PROTEIN/RNA RNA STRUCTURE, RIBOZYME, SELF-SPLICING INTRON, AZOARCUS, TWO-METAL-ION MECHANISM, STRUCTURAL PROTEIN/RNA COMPLEX
2czj	prot-nuc 3.01	5-METHYLURIDINE 5'-MONOPHOSPHATE 4(C10 H15 N2 O9 P)	CRYSTAL STRUCTURE OF THE TRNA DOMAIN OF TMRNA FROM THERMUS THERMOPHILUS HB8 SSRA-BINDING PROTEIN, TMRNA (63-MER) RNA BINDING PROTEIN/RNA SMPB, TMRNA, SSRA RNA, 10SA RNA, TRNA, TRANS-TRANSLATION, ST GENOMICS, NPPSFA, NATIONAL PROJECT ON PROTEIN STRUCTURAL AN FUNCTIONAL ANALYSES, RIKEN STRUCTURAL GENOMICS/PROTEOMICS INITIATIVE, RSGI, RNA BINDING PROTEIN-RNA COMPLEX
2dlc	prot-nuc 2.40	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF THE TERNARY COMPLEX OF YEAST TYROSYL-TR SYNTHETASE T-RNA (76-MER), TYROSYL-TRNA SYNTHETASE, CYTOPLASMIC LIGASE/TRNA TYRRS, TRNA, LIGASE-TRNA COMPLEX
2fmt	prot-nuc 2.80	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	METHIONYL-TRNAFMET FORMYLTRANSFERASE COMPLEXED WITH FORMYL- METHIONYL-TRNAFMET METHIONYL-TRNA FMET FORMYLTRANSFERASE, FORMYL-METHIONYL-TRNAFMET2 COMPLEX (METHYLTRANSFERASE/TRNA) COMPLEX (METHYLTRANSFERASE/TRNA), FORMYLTRANSFERASE, INITIATION OF TRANSLATION
2om7	prot-nuc 7.30	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURAL BASIS FOR INTERACTION OF THE RIBOSOME WITH THE SW REGIONS OF GTP-BOUND ELONGATION FACTORS 30S RIBOSOMAL PROTEIN S12, P/E-TRNA, FRAGMENT OF23S RRNA (H95), FRAGMENT OF 16S RRNA (H44), FRAGMENT OF23S RRNA (H76), 30S RIBOSOMAL PROTEIN S2, 50S RIBOSOMAL PROTEIN L1, FRAGMENT OF 16S RRNA (H15), 16S RIBOSOMAL RNA (H5), FRAGMENT OF 16S RRNA (H14), FRAGMENT OF23S RRNA (H42-44), ELONGATION FACTOR G, FRAGMENT OF23S RRNA (H89), FRAGMENT OF23S RRNA (H68) RIBOSOME RNA-PROTEIN COMPLEX, RIBOSOME
3bt7	prot-nuc 2.43	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	STRUCTURE OF E. COLI 5-METHYLURIDINE METHYLTRANSFERASE TRMA WITH 19 NUCLEOTIDE T-ARM ANALOGUE RNA (5'-D(P*GP*CP*UP*GP*UP*GP*(5MU) P*UP*CP*GP*AP*UP*CP*CP*AP*CP*AP*GP*C)-3'), TRNA (URACIL-5-)-METHYLTRANSFERASE TRANSFERASE/RNA METHYLURIDINE, METHYLTRANSFERASE, TRMA, RUMT, S-ADENOSYL-L- METHIONINE, TRNA PROCESSING, TRANSFERASE-RNA COMPLEX
3deg	prot-nuc 10.90	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	COMPLEX OF ELONGATING ESCHERICHIA COLI 70S RIBOSOME AND EF4( GMPPNP 50S RNA HELIX 42-44, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 30S RNA HELIX 8, P-TRNA, GTP-BINDING PROTEIN LEPA: EF4, 50S RNA HELIX 92, A/L-TRNA, 30S RNA HELIX 14, 50S RNA HELIX 95, 50S RNA HELIX 71 RIBOSOME RIBOSOME, TRANSLATION, LEPA, EF4, GTP-BINDING, MEMBRANE, NUC BINDING, ANTIBIOTIC RESISTANCE, RIBONUCLEOPROTEIN, RIBOSOMA PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METHYLATI
3kfu	prot-nuc 3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE 4(C10 H15 N2 O9 P)	CRYSTAL STRUCTURE OF THE TRANSAMIDOSOME ASPARTYL/GLUTAMYL-TRNA(ASN/GLN) AMIDOTRANSFERASE CHAIN: F, I, GLUTAMYL-TRNA(GLN) AMIDOTRANSFERASE SUBUNIT A, TRNA-ASN, NON-DISCRIMINATING AND ARCHAEAL-TYPE ASPARTYL-TRN SYNTHETASE, GLUTAMYL-TRNA(GLN) AMIDOTRANSFERASE SUBUNIT C LIGASE/RNA ASPRS, GATCAB, ATP-BINDING, AMINOACYL-TRNA SYNTHETASE, LIGAS NUCLEOTIDE-BINDING, PROTEIN BIOSYNTHESIS, LIGASE-RNA COMPLE
3v11	prot-nuc 5.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF THE TERNARY INITIATION COMPLEX AIF2:GDPNP:METHI INITIATOR TRNA INITIATOR TRNA, TRANSLATION INITIATION FACTOR 2 SUBUNIT GAMMA, TRANSLATION INITIATION FACTOR 2 SUBUNIT ALPHA, TRANSLATION INITIATION FACTOR 2 SUBUNIT BETA TRANSLATION/RNA GTP BINDING MODULE, INITIATOR TRNA CARRIER, GTP AND TRNA, TRANSLATION-RNA COMPLEX
4cxg	prot-nuc 8.70	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT ROLLING: A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 18S RRNA - H44, 40S RIBOSOMAL PROTEIN US12, TRANSFER RNA, 28S RRNA - H95, 28S RRNA - H89, ELONGATION FACTOR 1A, MESSENGER RNA, 18S RRNA - H8, 18S RRNA - H5-H14 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX
4cxh	prot-nuc 8.90	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 28S RRNA - H95, TRANSFER RNA, 40S RIBOSOMAL PROTEIN US12, 18S RRNA - H44, 18S RRNA - H8, 18S RRNA - H5-H14, MESSENGER RNA, ELONGATION FACTOR 1A, 28S RRNA - H89 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX, ELONGATION FACTOR EE
4jyz	prot-nuc 2.50	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF E. COLI GLUTAMINYL-TRNA SYNTHETASE BOUN AND NATIVE TRNA(GLN) CONTAINING THE CMNM5S2U34 ANTICODON WO RNA (72-MER), GLUTAMINE--TRNA LIGASE LIGASE/RNA ROSSMANN FOLD, PROTEIN-RNA COMPLEX, AMINOACYL-TRNA SYNTHETAS LIGASE, LIGASE-RNA COMPLEX
4uy8	prot-nuc 3.80	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	MOLECULAR BASIS FOR THE RIBOSOME FUNCTIONING AS A L-TRYPTOPH - CRYO-EM STRUCTURE OF A TNAC STALLED E.COLI RIBOSOME 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L18, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L10, 50S RIBOSOMAL PROTEIN L19, 50S RIBOSOMAL PROTEIN L17, RRNA-23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L3, RRNA-5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L29, RIBOSOMAL L7 PROTEIN, 50S RIBOSOMAL PROTEIN L27: RESIDUES 7-85, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L33: RESIDUES 4-53, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L6, TRYPTOPHANASE: RESIDUES 5-24, RNA, 50S RIBOSOMAL PROTEIN L36, RIBOSOMAL PROTEIN L9 RIBOSOME RIBOSOME, TNAC, TRANSLATION REGULATION
5jb3	prot-nuc 5.34	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYO-EM STRUCTURE OF A FULL ARCHAEAL RIBOSOMAL TRANSLATION I COMPLEX IN THE P-REMOTE CONFORMATION TRANSLATION INITIATION FACTOR 1A, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S7, TRANSLATION INITIATION FACTOR 2 SUBUNIT BETA, 30S RIBOSOMAL PROTEIN SX, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S27E, TRANSLATION INITIATION FACTOR 2 SUBUNIT GAMMA, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S6E, 30S RIBOSOMAL PROTEIN S4E, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19E, 30S RIBOSOMAL PROTEIN S8E, 30S RIBOSOMAL PROTEIN S27AE, 30S RIBOSOMAL PROTEIN S17P, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S17E, 30S RIBOSOMAL PROTEIN S19, 50S RIBOSOMAL PROTEIN L7AE, 30S RIBOSOMAL PROTEIN S3AE, PROTEIN TRANSLATION FACTOR SUI1 HOMOLOG, TRANSLATION INITIATION FACTOR 2 SUBUNIT ALPHA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN EL41, INITIATOR MET-TRNA FMET FROM E. COLI (A1U72 VARIA CHAIN: 4, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S15, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S24E, 30S RIBOSOMAL PROTEIN S28E, MRNA TRANSLATION TRANSLATION
5jbh	prot-nuc 5.34	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYO-EM STRUCTURE OF A FULL ARCHAEAL RIBOSOMAL TRANSLATION I COMPLEX IN THE P-IN CONFORMATION 30S RIBOSOMAL PROTEIN US3, 30S RIBOSOMAL PROTEIN US14, INITIATOR MET-TRNA FMET FROM E. COLI (A1U72 VARIA CHAIN: 4, AIF2-ALPHA, 30S RIBOSOMAL PROTEIN US12, 30S RIBOSOMAL PROTEIN ES17, 30S RIBOSOMAL PROTEIN EL41, MRNA, 30S RIBOSOMAL PROTEIN US9, 30S RIBOSOMAL PROTEIN US10, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN US19, 30S RIBOSOMAL PROTEIN ES6, AIF1, AIF1A, 30S RIBOSOMAL PROTEIN SX, 30S RIBOSOMAL PROTEIN ES8, AIF2-BETA, 30S RIBOSOMAL PROTEIN US17, 30S RIBOSOMAL PROTEIN ES27, 30S RIBOSOMAL PROTEIN ES24, 30S RIBOSOMAL PROTEIN ES19, AIF2-GAMMA, 30S RIBOSOMAL PROTEIN US11, 30S RIBOSOMAL PROTEIN US3, 30S RIBOSOMAL PROTEIN US7, 30S RIBOSOMAL PROTEIN US2, 50S RIBOSOMAL PROTEIN UL30, 30S RIBOSOMAL PROTEIN ES28, 30S RIBOSOMAL PROTEIN US5, 30S RIBOSOMAL PROTEIN US15, 30S RIBOSOMAL PROTEIN US8, 30S RIBOSOMAL PROTEIN US13, 30S RIBOSOMAL PROTEIN ES27, 30S RIBOSOMAL PROTEIN US4, 30S RIBOSOMAL PROTEIN ES4 TRANSCRIPTION TRANSCRIPTION
5lmq	prot-nuc 4.20	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF BACTERIAL 30S-IF1-IF3-MRNA-TRNA TRANSLATION PRE INITIATION COMPLEX, OPEN FORM (STATE-2A) 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S10, MRNA, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, TRNA, 30S RIBOSOMAL PROTEIN S13 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lmr	prot-nuc 4.45	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF BACTERIAL 30S-IF1-IF3-MRNA-TRNA TRANSLATION PRE INITIATION COMPLEX(STATE-2B) TRNAI, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, MRNA, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S17 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lms	prot-nuc 5.10	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF BACTERIAL 30S-IF1-IF3-MRNA-TRNA TRANSLATION PRE INITIATION COMPLEX(STATE-2C) 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, TRNAI, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S17, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, MRNA RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lmt	prot-nuc 4.15	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF BACTERIAL 30S-IF1-IF3-MRNA-TRNA TRANSLATION PRE INITIATION COMPLEX(STATE-3) 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, TRNAI, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S10, MRNA, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-3 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lmu	prot-nuc 4.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF BACTERIAL 30S-IF3-MRNA-TRNA TRANSLATION PRE-INI COMPLEX, CLOSED FORM (STATE-4) 30S RIBOSOMAL PROTEIN S13, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, TRNAI, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, MRNA, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF3, TR THERMUS THERMOPHILUS
5lmv	prot-nuc 4.90	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF BACTERIAL 30S-IF1-IF2-IF3-MRNA-TRNA TRANSLATION INITIATION COMPLEX(STATE-III) 30S RIBOSOMAL PROTEIN S8, TRNAI, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-3, TRANSLATION INITIATION FACTOR IF-1, 30S RIBOSOMAL PROTEIN S5, TRANSLATION INITIATION FACTOR IF-2, MRNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME RIBOSOME, TRANSLATION, INITIATION FACTORS, 30S, IF1, IF2, IF PIC, THERMUS THERMOPHILUS
5me0	prot-nuc 13.50	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 1 (30S IC-1) STA GE81112 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, FMET-TRNA, 30S RIBOSOMAL PROTEIN S5 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION
5me1	prot-nuc 13.50	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF THE 30S PRE-INITIATION COMPLEX 2 (30S IC-2) STA GE81112 FMET-TRNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S11, TRANSLATION INITIATION FACTOR IF-1, TRANSLATION INITIATION FACTOR IF-2, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S21, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, TRANSLATION INITIATION FACTOR IF-3, 30S RIBOSOMAL PROTEIN S4, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME RIBOSOME, INITIATION OF TRANSLATION

5NC    5-AZA-CYTIDINE-5'MONOPHOSPHATE

Code	Class Resolution	Description
10mh	prot-nuc 2.55	5-AZA-CYTIDINE-5'MONOPHOSPHATE C8 H13 N4 O7 P	TERNARY STRUCTURE OF HHAI METHYLTRANSFERASE WITH ADOHCY AND HEMIMETHYLATED DNA CONTAINING 5,6-DIHYDRO-5-AZACYTOSINE AT THE TARGET DNA (5'-D(P*CP*CP*AP*TP*GP*(5CM) P*GP*CP*TP*GP*AP*C)-3'), PROTEIN (CYTOSINE-SPECIFIC METHYLTRANSFERASE HHAI), DNA (5'- D(P*GP*TP*CP*AP*GP*5NCP*GP*CP*AP*TP*GP*G)-3') TRANSFERASE/DNA TRANSFERASE, METHYLTRANSFERASE, RESTRICTION SYSTEM, COMPLEX (METHYLTRANSFERASE/ DNA), TRANSFERASE/DNA COMPLEX

5OC    2'-DEOXY-5-HYDROXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
3tab	prot-nuc 2.80	2'-DEOXY-5-HYDROXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H14 N3 O8 P)	5-HYDROXYCYTOSINE PAIRED WITH DGMP IN RB69 GP43 DNA POLYMERASE, DNA (5'-D(*CP*CP*(5OC) P*GP*GP*TP*AP*TP*GP*AP*CP*AP*GP*CP*CP*GP*CP*G)-3'), DNA (5'-D(*GP*CP*GP*GP*CP*TP*GP*TP*CP*AP*TP*AP*CP 3') TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX
3tae	prot-nuc 2.71	2'-DEOXY-5-HYDROXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H14 N3 O8 P)	5-HYDROXYCYTOSINE PAIRED WITH DAMP IN RB69 GP43 DNA (5'-D(*CP*CP*(5OC) P*GP*GP*TP*AP*TP*GP*AP*CP*AP*GP*CP*CP*GP*CP*G)-3'), DNA (5'-D(*GP*CP*GP*GP*CP*TP*GP*TP*CP*AP*TP*AP*CP 3'), DNA POLYMERASE TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX

5PY    1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE

Code	Class Resolution	Description
2ih2	prot-nuc 1.61	1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE 2(C10 H15 N2 O7 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON METHYLPYRIMIDIN-2(1H)-ONE AT THE TARGET BASE PARTNER POSITI 5'-D(*GP*AP*CP*AP*(5PY)P*CP*GP*(6MA)P*AP*C)-3', 5'-D(*GP*TP*TP*CP*GP*AP*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, 5-METHYLPYR 2(1H)-ONE, BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE- COMPLEX
3cvu	prot-nuc 2.00	1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE C10 H15 N2 O7 P	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE BOUND TO DS DNA WITH A T-T (6-4) PHOTOLESION DNA (5'-D(*DAP*DCP*DAP*DGP*DCP*DGP*DGP*(64T) P*(5PY)P*DGP*DCP*DAP*DGP*DGP*DT)-3'), DNA (5'- D(*DTP*DAP*DCP*DCP*DTP*DGP*DCP*DAP*DAP*DCP*DCP*DGP*DCP*DTP* DG)-3'), RE11660P LYASE/DNA DNA REPAIR, LYASE/DNA COMPLEX
3cvv	prot-nuc 2.10	1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE C10 H15 N2 O7 P	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE BOUND TO DS DNA WITH A T-T (6-4) PHOTOLESION AND F0 COFACTOR DNA (5'-D(*DAP*DCP*DAP*DGP*DCP*DGP*DGP*(64T) P*(5PY)P*DGP*DCP*DAP*DGP*DGP*DT)-3'), DNA (5'- D(*DTP*DAP*DCP*DCP*DTP*DGP*DCP*DAP*DAP*DCP*DCP*DGP*DCP*DTP* DG)-3'), RE11660P LYASE/DNA DNA REPAIR, LYASE/DNA COMPLEX
3cvw	prot-nuc 3.20	1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE C10 H15 N2 O7 P	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE H365N MUTANT BOUND TO DS DNA WITH A T-T (6-4) PHOTOLESION AND COFACTOR F0 DNA (5'-D(*DAP*DCP*DAP*DGP*DCP*DGP*DGP*(64T) P*(5PY)P*DGP*DCP*DAP*DGP*DGP*DT)-3'), DNA (5'- D(*DTP*DAP*DCP*DCP*DTP*DGP*DCP*DAP*DAP*DCP*DCP*DGP*DCP*DTP* DG)-3'), RE11660P LYASE/DNA DNA REPAIR, LYASE/DNA COMPLEX
3cvx	prot-nuc 3.20	1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE C10 H15 N2 O7 P	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE H369M MUTANT BOUND TO DS DNA WITH A T-T (6-4) PHOTOLESION RE11660P, DNA (5'- D(*DTP*DAP*DCP*DCP*DTP*DGP*DCP*DAP*DAP*DCP*DCP*DGP*DCP*DTP* DG)-3'), DNA (5'-D(*DAP*DCP*DAP*DGP*DCP*DGP*DGP*(64T) P*(5PY)P*DGP*DCP*DAP*DGP*DGP*DT)-3') LYASE/DNA DNA REPAIR, LYASE/DNA COMPLEX
3ei1	prot-nuc 2.80	1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE C10 H15 N2 O7 P	STRUCTURE OF HSDDB1-DRDDB2 BOUND TO A 14 BP 6-4 PHOTOPRODUCT CONTAINING DNA-DUPLEX DNA DAMAGE-BINDING PROTEIN 2, 5'-D(*DAP*DCP*DGP*DCP*DGP*DAP*(64T)P*(5PY) P*DGP*DCP*DGP*DCP*DCP*DC)-3', 5'- D(*DTP*DGP*DGP*DGP*DCP*DGP*DCP*DAP*DAP*DTP*DCP*DGP*DCP*DG)- 3', DNA DAMAGE-BINDING PROTEIN 1 DNA BINDING PROTEIN/DNA UV-DAMAGE, DDB, NUCLEOTIDE EXCISION REPAIR, XERODERMA PIGMENTOSUM, ALTERNATIVE SPLICING, DISEASE MUTATION, DNA DAMAGE, DNA REPAIR, DNA-BINDING, NUCLEUS, PHOSPHOPROTEIN, POLYMORPHISM, WD REPEAT, UBL CONJUGATION PATHWAY, DNA BINDING PROTEIN/DNA COMPLEX
3vw3	prot-nuc 2.50	1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE C10 H15 N2 O7 P	ANTIBODY 64M-5 FAB IN COMPLEX WITH A DOUBLE-STRANDED DNA (6- PHOTOPRODUCT ANTI-(6-4) PHOTOPRODUCT ANTIBODY 64M-5 FAB (HEAVY CHAIN: H, DNA (5'-D(*GP*CP*GP*AP*GP*TP*GP*AP*(64T)P*(5PY) P*AP*TP*GP*GP*AP*CP*GP*G)-3'), ANTI-(6-4) PHOTOPRODUCT ANTIBODY 64M-5 FAB (LIGHT CHAIN: L, DNA (5'- D(*CP*CP*CP*GP*TP*CP*CP*AP*TP*AP*AP*TP*CP*AP*CP*TP*CP*G)-3' CHAIN: B IMMUNE SYSTEM/DNA PROTEIN-DNA COMPLEX, DNA (6-4) PHOTOPRODUCT, IMMUNOGLOBULIN, SYSTEM-DNA COMPLEX
4gle	prot-nuc 2.70	1-(2'-DEOXY-5'-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-5-METHYLPYRIMIDIN-2(1H)-ONE C10 H15 N2 O7 P	SACUVDE IN COMPLEX WITH 6-4PP-CONTAINING DNA 5'-D(*GP*CP*GP*TP*CP*CP*(64T)P*(5PY)P*GP*AP*CP*GP 3', UV DAMAGE ENDONUCLEASE, 5'-D(*CP*GP*TP*CP*GP*TP*CP*AP*AP*GP*GP*AP*CP*GP*C CHAIN: B HYDROLASE/DNA TIM BARREL, HYDROLASE-DNA COMPLEX

5SI    2-{2-DEOXY-5-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]OXY}PHOSPHORYL]-BETA-D-ERYTHRO- PENTOFURANOSYL}-6-METHYLISOQUINOLINE-1(2H)-THIONE

Code	Class Resolution	Description
3sv3	prot-nuc 2.10	2-{2-DEOXY-5-O-[(R)-HYDROXY{[(R)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]OXY}PHOSPHORYL]-BETA-D-ERYTHRO- PENTOFURANOSYL}-6-METHYLISOQUINOLINE-1(2H)-THIONE 2(C15 H20 N O12 P3 S)	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQUATICUS IN A CLOSED TERNARY COMPLEX WITH THE ARTI BASE PAIR DNAM-D5SICSTP (5'-D(*AP*AP*AP*(BMN)P*GP*GP*CP*GP*CP*CP*GP*TP*GP 3'), (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC))-3' CHAIN: B, DNA POLYMERASE I, THERMOSTABLE: KLENOW FRAGMENT, UNP RESIDUES 293-832 TRANSFERASE/DNA DNA POLYMERASE, ARTIFICIAL BASE PAIR, TRANSFERASE-DNA COMPLE

5UA    5'-O-CARBOXY-2'-DEOXYADENOSINE

Code	Class Resolution	Description
2xcr	prot-nuc 3.50	5'-O-CARBOXY-2'-DEOXYADENOSINE 2(C11 H13 N5 O5)	THE 3.5A CRYSTAL STRUCTURE OF THE CATALYTIC CORE (B'A' REGION) OF STAPHYLOCOCCUS AUREUS DNA GYRASE COMPLEXED WITH GSK299423 AND DNA DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A5'-D(*5UA*GP*CP*CP*GP*TP*AP*GP*GP*GP*CP*CP*CP*TP* *GP*CP*TP)-3': C-TERMINAL 27KDA DOMAIN, RESIDUES 410-644, N-TERM 56KDA DOMAIN, RESIDUES 2-491, 5'-D(*AP*GP*CP*CP*GP*TP*AP*GP*GP*GP*CP*CP*CP*TP*A *GP*CP*TP)-3' ISOMERASE ISOMERASE
2xcs	prot-nuc 2.10	5'-O-CARBOXY-2'-DEOXYADENOSINE 2(C11 H13 N5 O5)	THE 2.1A CRYSTAL STRUCTURE OF S. AUREUS GYRASE COMPLEX WITH AND DNA DNA GYRASE SUBUNIT B, DNA GYRASE SUBUNIT A: GYRB- C-TERMINAL 27KDA DOMAIN, RESIDUES 410-543 A 644, GYRA- N-TERMINAL 56KDA DOMAIN, RESIDUES 2-491, 5'-5UA*D(GP*CP*CP*GP*TP*AP*GP*GP*GP*CP*CP *CP*TP*AP*CP*GP*GP*CP*T)-3' ISOMERASE ISOMERASE, TYPE IIA TOPOISOMERASE

61C    PLATINUM(4+) CHLORIDE AZANIDE [2-(9H-CARBAZOL-9-YL) ETHYL]AZANIDE (1:1:2:1)

Code	Class Resolution	Description
5hhi	prot-nuc 2.52	PLATINUM(4+) CHLORIDE AZANIDE [2-(9H-CARBAZOL-9-YL) ETHYL]AZANIDE (1:1:2:1) C14 H17 CL N4 PT	STRUCTURE OF HUMAN DNA POLYMERASE BETA HOST-GUEST COMPLEXED PLATINATED N7-G DNA (5'-D(P*CP*CP*TP*GP*CP*TP*CP*CP*TP*C)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*GP*GP*AP*GP*GP*AP*GP*CP 3'), DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3') TRANSFERASE, LYASE/DNA TRANSFERASE, LYASE-DNA COMPLEX

61H    (1R)-1,4-ANHYDRO-2-DEOXY-5-O-[(S)-HYDROXY(OXIDO)- LAMBDA~5~-PHOSPHANYL]-1-PHENANTHREN-2-YL-D-ERYTHRO- PENTITOL

Code	Class Resolution	Description
5hch	prot-nuc 2.90	(1R)-1,4-ANHYDRO-2-DEOXY-5-O-[(S)-HYDROXY(OXIDO)- LAMBDA~5~-PHOSPHANYL]-1-PHENANTHREN-2-YL-D-ERYTHRO- PENTITOL 2(C19 H19 O5 P)	X-RAY STRUCTURE OF A LECTIN-BOUND DNA DUPLEX CONTAINING AN U PHENANTHRENYL PAIR FUCOSE-BINDING LECTIN, DNA (5'-D(*CP*GP*CP*AP*TP*TP*(DF)P*TP*AP*TP*CP*GP CHAIN: B, DNA (5'-D(P*GP*CP*GP*AP*TP*AP*(DF)P*AP*AP*TP*GP*C CHAIN: E SUGAR BINDING PROTEIN LECB, COMPLEX, ARTIFICIAL DNA, PHENANTHRENE, SUGAR BINDING P

61J    (6S)-2,6-ANHYDRO-1-DEOXY-6-(2-{[(S)-HYDROXY(OXIDO)- LAMBDA~5~-PHOSPHANYL]OXY}ETHYL)-D-GALACTITOL

Code	Class Resolution	Description
5hch	prot-nuc 2.90	(6S)-2,6-ANHYDRO-1-DEOXY-6-(2-{[(S)-HYDROXY(OXIDO)- LAMBDA~5~-PHOSPHANYL]OXY}ETHYL)-D-GALACTITOL C8 H17 O7 P	X-RAY STRUCTURE OF A LECTIN-BOUND DNA DUPLEX CONTAINING AN U PHENANTHRENYL PAIR FUCOSE-BINDING LECTIN, DNA (5'-D(*CP*GP*CP*AP*TP*TP*(DF)P*TP*AP*TP*CP*GP CHAIN: B, DNA (5'-D(P*GP*CP*GP*AP*TP*AP*(DF)P*AP*AP*TP*GP*C CHAIN: E SUGAR BINDING PROTEIN LECB, COMPLEX, ARTIFICIAL DNA, PHENANTHRENE, SUGAR BINDING P

62B    LEFAMULIN

Code	Class Resolution	Description
5hl7	prot-nuc 3.55	LEFAMULIN C28 H45 N O5 S	THE CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT OF STAP AUREUS IN COMPLEX WITH LEFAMULIN 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L27, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L19, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L17, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L36, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L18 RIBOSOME RIBOSOME, LEFAMULIN, RNA, ANTIBIOTIC

64A    {[(1S,3R)-3-(5-METHYL-2,4-DIOXO-3,4-DIHYDROPYRIMIDIN- 1(2H)-YL)CYCLOPENTYL]OXY}PROPANEDIOIC ACID

Code	Class Resolution	Description
5hlf	prot-nuc 2.95	{[(1S,3R)-3-(5-METHYL-2,4-DIOXO-3,4-DIHYDROPYRIMIDIN- 1(2H)-YL)CYCLOPENTYL]OXY}PROPANEDIOIC ACID C13 H16 N2 O7	STRUCTURE OF HIV-1 REVERSE TRANSCRIPTASE IN COMPLEX WITH A 3 HAIRPIN TEMPLATE-PRIMER DNA APTAMER AND AN ALPHA-CARBOXYPHO INHIBITOR DNA (38-MER), HIV-1 REVERSE TRANSCRIPTASE P51 SUBUNIT, HIV-1 REVERSE TRANSCRIPTASE P66 SUBUNIT TRANSFERASE/INHIBITOR/DNA DNA APTAMER, 2-O-METHYLCYTIDINE, P51, P66, TRANSFERASE, NCRT NUCLEOTIDE COMPETING, INHIBITOR, TRANSFERASE-INHIBITOR-DNA

64P    5-AMINOTHYMIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2wb2	prot-nuc 2.95	5-AMINOTHYMIDINE 5'-(DIHYDROGEN PHOSPHATE) C10 H18 N3 O8 P1	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE BOUND TO DOUBLE STRANDED DNA CONTAINING A T(6-4)C PHOTOLESION PHOTOLYASE: RESIDUES 1-520, 5'-D(*AP*CP*AP*GP*CP*GP*GP*64PP*ZP*GP*CP*AP *GP*G CHAIN: C5'-D(*TP*AP*CP*CP*TP*GP*CP*GP*AP*CP*CP*GP*CP*TP*G CHAIN: D LYASE/DNA LYASE-DNA COMPLEX, PHOTOLESION, DNA PHOTOLYASE, LYASE

64T    5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1keg	prot-nuc 2.40	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	ANTIBODY 64M-2 FAB COMPLEXED WITH DTT(6-4)TT ANTI-(6-4) PHOTOPRODUCT ANTIBODY 64M-2 FAB (LIGHT CHAIN: L, ANTI-(6-4) PHOTOPRODUCT ANTIBODY 64M-2 FAB (HEAVY CHAIN: H, 5'-D(*TP*(64T)P*TP*T)-3' IMMUNE SYSTEM/DNA PROTEIN-DNA COMPLEX, DNA PHOTOPRODUCT, IMMUNOGLOBULIN, IMMUN DNA COMPLEX
3cvu	prot-nuc 2.00	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE BOUND TO DS DNA WITH A T-T (6-4) PHOTOLESION DNA (5'-D(*DAP*DCP*DAP*DGP*DCP*DGP*DGP*(64T) P*(5PY)P*DGP*DCP*DAP*DGP*DGP*DT)-3'), DNA (5'- D(*DTP*DAP*DCP*DCP*DTP*DGP*DCP*DAP*DAP*DCP*DCP*DGP*DCP*DTP* DG)-3'), RE11660P LYASE/DNA DNA REPAIR, LYASE/DNA COMPLEX
3cvv	prot-nuc 2.10	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE BOUND TO DS DNA WITH A T-T (6-4) PHOTOLESION AND F0 COFACTOR DNA (5'-D(*DAP*DCP*DAP*DGP*DCP*DGP*DGP*(64T) P*(5PY)P*DGP*DCP*DAP*DGP*DGP*DT)-3'), DNA (5'- D(*DTP*DAP*DCP*DCP*DTP*DGP*DCP*DAP*DAP*DCP*DCP*DGP*DCP*DTP* DG)-3'), RE11660P LYASE/DNA DNA REPAIR, LYASE/DNA COMPLEX
3cvw	prot-nuc 3.20	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE H365N MUTANT BOUND TO DS DNA WITH A T-T (6-4) PHOTOLESION AND COFACTOR F0 DNA (5'-D(*DAP*DCP*DAP*DGP*DCP*DGP*DGP*(64T) P*(5PY)P*DGP*DCP*DAP*DGP*DGP*DT)-3'), DNA (5'- D(*DTP*DAP*DCP*DCP*DTP*DGP*DCP*DAP*DAP*DCP*DCP*DGP*DCP*DTP* DG)-3'), RE11660P LYASE/DNA DNA REPAIR, LYASE/DNA COMPLEX
3cvx	prot-nuc 3.20	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	DROSOPHILA MELANOGASTER (6-4) PHOTOLYASE H369M MUTANT BOUND TO DS DNA WITH A T-T (6-4) PHOTOLESION RE11660P, DNA (5'- D(*DTP*DAP*DCP*DCP*DTP*DGP*DCP*DAP*DAP*DCP*DCP*DGP*DCP*DTP* DG)-3'), DNA (5'-D(*DAP*DCP*DAP*DGP*DCP*DGP*DGP*(64T) P*(5PY)P*DGP*DCP*DAP*DGP*DGP*DT)-3') LYASE/DNA DNA REPAIR, LYASE/DNA COMPLEX
3ei1	prot-nuc 2.80	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	STRUCTURE OF HSDDB1-DRDDB2 BOUND TO A 14 BP 6-4 PHOTOPRODUCT CONTAINING DNA-DUPLEX DNA DAMAGE-BINDING PROTEIN 2, 5'-D(*DAP*DCP*DGP*DCP*DGP*DAP*(64T)P*(5PY) P*DGP*DCP*DGP*DCP*DCP*DC)-3', 5'- D(*DTP*DGP*DGP*DGP*DCP*DGP*DCP*DAP*DAP*DTP*DCP*DGP*DCP*DG)- 3', DNA DAMAGE-BINDING PROTEIN 1 DNA BINDING PROTEIN/DNA UV-DAMAGE, DDB, NUCLEOTIDE EXCISION REPAIR, XERODERMA PIGMENTOSUM, ALTERNATIVE SPLICING, DISEASE MUTATION, DNA DAMAGE, DNA REPAIR, DNA-BINDING, NUCLEUS, PHOSPHOPROTEIN, POLYMORPHISM, WD REPEAT, UBL CONJUGATION PATHWAY, DNA BINDING PROTEIN/DNA COMPLEX
3vw3	prot-nuc 2.50	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	ANTIBODY 64M-5 FAB IN COMPLEX WITH A DOUBLE-STRANDED DNA (6- PHOTOPRODUCT ANTI-(6-4) PHOTOPRODUCT ANTIBODY 64M-5 FAB (HEAVY CHAIN: H, DNA (5'-D(*GP*CP*GP*AP*GP*TP*GP*AP*(64T)P*(5PY) P*AP*TP*GP*GP*AP*CP*GP*G)-3'), ANTI-(6-4) PHOTOPRODUCT ANTIBODY 64M-5 FAB (LIGHT CHAIN: L, DNA (5'- D(*CP*CP*CP*GP*TP*CP*CP*AP*TP*AP*AP*TP*CP*AP*CP*TP*CP*G)-3' CHAIN: B IMMUNE SYSTEM/DNA PROTEIN-DNA COMPLEX, DNA (6-4) PHOTOPRODUCT, IMMUNOGLOBULIN, SYSTEM-DNA COMPLEX
4gle	prot-nuc 2.70	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	SACUVDE IN COMPLEX WITH 6-4PP-CONTAINING DNA 5'-D(*GP*CP*GP*TP*CP*CP*(64T)P*(5PY)P*GP*AP*CP*GP 3', UV DAMAGE ENDONUCLEASE, 5'-D(*CP*GP*TP*CP*GP*TP*CP*AP*AP*GP*GP*AP*CP*GP*C CHAIN: B HYDROLASE/DNA TIM BARREL, HYDROLASE-DNA COMPLEX

68Z    1R,2S,4R)-4-[2-AZANYL-6,8-BIS(OXIDANYLIDENE)- 1,7-DIHYDROPURIN-9-YL]-2-OXIDANYL- CYCLOPENTYL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
4cis	prot-nuc 2.05	1R,2S,4R)-4-[2-AZANYL-6,8-BIS(OXIDANYLIDENE)- 1,7-DIHYDROPURIN-9-YL]-2-OXIDANYL- CYCLOPENTYL]METHYL DIHYDROGEN PHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF MUTM IN COMPLEX WITH CARBOCYCLIC 8-OXO-G CONTAINING DNA FORMAMIDOPYRIMIDIN DNA GLYCOSYLASE, DNA, DNA HYDROLASE HYDROLASE, BASE EXCISION REPAIR, DNA REPAIR

6AH    6-AMINOHEXAN-1-OL

Code	Class Resolution	Description
4gz0	prot-nuc 2.11	6-AMINOHEXAN-1-OL 6(C6 H15 N O)	MUS MUSCULUS TDP2-DNA SUBSTRATE ANALOG (5'-6-AMINOHEXANOL) C TYROSYL-DNA PHOSPHODIESTERASE 2: UNP RESIDUES 118-370, DNA (5'-D(P*CP*CP*GP*AP*AP*TP*TP*CP*G)-3') HYDROLASE/DNA PROTEIN-DNA COMPLEX, DNA REPAIR, 5'-DNA END PROCESSING, ENDONUCLEASE/EXONUCLEASE/PHOSPHATASE DOMAIN, EEP DOMAIN, 5' RECOGNITION, EEP,ENDONUCLEASE/EXONUCLEASE/PHOSPHATASE DOMAI RECOGNITION, NUCLEAR, HYDROLASE, HYDROLASE-DNA COMPLEX

6CF    2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE

Code	Class Resolution	Description
3rjh	prot-nuc 2.20	2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE C10 H16 F2 N3 O12 P3	TERNARY COMPLEX OF DNA POLYMERASE BETA WITH A GAPPED DNA CON (SYN)8ODG:DA AT PRIMER TERMINUS AND DG:DCMP(CF2)PPIN THE AC DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*GP*(8OG) P*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') TRANSFERASE, LYASE/DNA MUTAGENESIS, G-T TRANSVERSION, DNA POLYMERASE, OXIDATIVE DAM TRANSFERASE, LYASE-DNA COMPLEX
3rji	prot-nuc 2.30	2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE C10 H16 F2 N3 O12 P3	TERNARY COMPLEX OF DNA POLYMERASE BETA WITH A GAPPED DNA CON 8ODG AT TEMPLATE POSITION PAIRED WITH NON-HYDROLYZABLE DCTP (DCMP(CF2)PP) DNA (5'-D(*CP*CP*GP*AP*CP*(8OG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3') TRANSFERASE, LYASE/DNA MUTAGENESIS, G-T TRANSVERSION, DNA POLYMERASE, OXIDATIVE DAM TRANSFERASE, LYASE-DNA COMPLEX
3rjk	prot-nuc 2.10	2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE C10 H16 F2 N3 O12 P3	TERNARY COMPLEX OF DNA POLYMERASE BETA WITH A GAPPED DNA CON 8ODG:DC BASE PAIR AT PRIMER TERMINUS AND DG:DCMP(CF2)PP IN SITE DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*GP*(8OG) P*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'), DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3') TRANSFERASE, LYASE/DNA MUTAGENESIS, G-T TRANSVERSION, DNA POLYMERASE, OXIDATIVE DAM TRANSFERASE, TRANSFERASE, LYASE-DNA COMPLEX
4f5n	prot-nuc 1.80	2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE C10 H16 F2 N3 O12 P3	OPEN TERNARY COMPLEX OF R283K DNA POLYMERASE BETA WITH A MET DCTP ANALOG DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*GP*GP*CP*GP*CP*AP*TP*CP 3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3') TRANSFERASE, LYASE/DNA TRANSFERASE, LYASE/DNA, LYASE-DNA COMPLEX
4f5o	prot-nuc 2.00	2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE C10 H16 F2 N3 O12 P3	OPEN TERNARY COMPLEX OF R283K DNA POLYMERASE BETA WITH A ONE BOUND DCTP ANALOG DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*(8OG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'), DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA POLYMERASE BETA TRANSFERASE, LYASE/DNA TRANSFERASE, LYASE/DNA, LYASE-DNA COMPLEX
4f5q	prot-nuc 2.25	2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE C10 H16 F2 N3 O12 P3	CLOSED TERNARY COMPLEX OF R283K DNA POLYMERASE BETA DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(P*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3'), DNA POLYMERASE BETA, DNA (5'-D(*CP*CP*GP*AP*CP*GP*GP*CP*GP*CP*AP*TP*CP 3') TRANSFERASE, LYASE/DNA TRANSFERASE, LYASE/DNA, LYASE-DNA COMPLEX
4f5r	prot-nuc 2.20	2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE 2(C10 H16 F2 N3 O12 P3)	OPEN AND CLOSED TERNARY COMPLEX OF R283K DNA POLYMERASE BETA DCTP ANALOG IN THE SAME ASYMMETRIC UNIT DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3'), DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*GP*GP*CP*GP*CP*AP*TP*CP 3'), DNA POLYMERASE BETA TRANSFERASE, LYASE/DNA TRANSFERASE, LYASE/DNA, LYASE-DNA COMPLEX
4gxj	prot-nuc 2.20	2'-DEOXY-5'-O-[(S)-{DIFLUORO[(S)-HYDROXY(PHOSPHONOOXY) PHOSPHORYL]METHYL}(HYDROXY)PHOSPHORYL]CYTIDINE C10 H16 F2 N3 O12 P3	R283K DNA POLYMERASE BETA TERNARY COMPLEX WITH A TEMPLATING INCOMING DCTP ANALOG DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*(8OG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'), DNA POLYMERASE BETA TRANSFERASE/DNA TRANSFERASE, LYASE/DNA POLYMERASE, TRANSFERASE-DNA COMPLEX

6EJ    (1R)-1-[(4-{[(6,7-DIHYDRO[1,4]DIOXINO[2,3-C]PYRIDAZIN- 3-YL)METHYL]AMINO}PIPERIDIN-1-YL)METHYL]-9-FLUORO-1,2- DIHYDRO-4H-PYRROLO[3,2,1-IJ]QUINOLIN-4-ONE

Code	Class Resolution	Description
5iwi	prot-nuc 1.98	(1R)-1-[(4-{[(6,7-DIHYDRO[1,4]DIOXINO[2,3-C]PYRIDAZIN- 3-YL)METHYL]AMINO}PIPERIDIN-1-YL)METHYL]-9-FLUORO-1,2- DIHYDRO-4H-PYRROLO[3,2,1-IJ]QUINOLIN-4-ONE C24 H26 F N5 O3	1.98A STRUCTURE OF GSK945237 WITH S.AUREUS DNA GYRASE AND SI NICKED DNA DNA (5'- D(*AP*GP*CP*CP*GP*TP*AP*GP*GP*TP*AP*CP*AP*CP*CP*GP*CP*AP*CP CHAIN: E, DNA GYRASE SUBUNIT A, DNA (5'- D(*TP*GP*TP*GP*CP*GP*GP*T*GP*TP*AP*CP*CP*TP*AP*CP*GP*GP*CP* CHAIN: G, DNA (5'- D(*TP*GP*TP*GP*CP*GP*GP*T*GP*TP*AP*CP*CP*TP*AP*CP*GP*GP*CP* CHAIN: F, DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B ISOMERASE TYPE IIA TOPOISOMERASE, ANTIBACTERIAL, INHIBITOR, ISOMERASE, PROTEIN
5iwm	prot-nuc 2.50	(1R)-1-[(4-{[(6,7-DIHYDRO[1,4]DIOXINO[2,3-C]PYRIDAZIN- 3-YL)METHYL]AMINO}PIPERIDIN-1-YL)METHYL]-9-FLUORO-1,2- DIHYDRO-4H-PYRROLO[3,2,1-IJ]QUINOLIN-4-ONE C24 H26 F N5 O3	2.5A STRUCTURE OF GSK945237 WITH S.AUREUS DNA GYRASE AND DNA DNA (5'- D(*AP*GP*CP*CP*GP*TP*AP*GP*GP*TP*TP*CP*AP*CP*CP*GP*CP*AP*CP CHAIN: E, DNA GYRASE SUBUNIT A, DNA GYRASE SUBUNIT B,DNA GYRASE SUBUNIT B: UNP RESIDUES 409-543, 580-644,UNP RESIDUES 409-54 644, DNA (5'- D(*TP*GP*TP*GP*CP*GP*GP*TP*GP*AP*AP*CP*CP*TP*AP*CP*GP*GP*CP CHAIN: F ISOMERASE TYPE IIA TOPOISOMERASE, ANTIBACTERIAL, INHIBITOR, ISOMERASE, PROTEIN

6EK    (2S,3S)-2-{[(2S)-3-(2-AMINO-1H-IMIDAZOL-5-YL)-2-{[(2S, 4S)-5-(CARBAMOYLOXY)-4-HYDROXY-2-({[(2S,3S)-3- HYDROXYPIPERIDIN-2-YL]CARBONYL}AMINO) PENTANOYL]AMINO}PROPANOYL]AMINO}-3-(2-CHLORO-1H- IMIDAZOL-5-YL)-3-HYDROXYPROPANOIC ACID

Code	Class Resolution	Description
5iwa	prot-nuc 3.50	(2S,3S)-2-{[(2S)-3-(2-AMINO-1H-IMIDAZOL-5-YL)-2-{[(2S, 4S)-5-(CARBAMOYLOXY)-4-HYDROXY-2-({[(2S,3S)-3- HYDROXYPIPERIDIN-2-YL]CARBONYL}AMINO) PENTANOYL]AMINO}PROPANOYL]AMINO}-3-(2-CHLORO-1H- IMIDAZOL-5-YL)-3-HYDROXYPROPANOIC ACID C24 H35 CL N10 O10	CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM THERMUS THERMOPHILUS IN COMPLEX WITH THE GE81112 PEPTIDE ANTIBIOTIC 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S18, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S12 TRANSLATION PROTEIN SYNTHESIS, TRANSLATION INITIATION, RIBOSOME, ANTIBIO TRANSLATION

6FK    [(2~{R},3~{S},5~{R})-5-[2-AZANYL-8- [ETHANOYL(PHENYL)AMINO]-6-OXIDANYLIDENE-1~{H}-PURIN-9- YL]-3-OXIDANYL-OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
5g32	prot-nuc 2.20	[(2~{R},3~{S},5~{R})-5-[2-AZANYL-8- [ETHANOYL(PHENYL)AMINO]-6-OXIDANYLIDENE-1~{H}-PURIN-9- YL]-3-OXIDANYL-OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE 2(C18 H21 N6 O8 P)	STRUCTURE OF RAD14 IN COMPLEX WITH ACETYLAMINOPHENYL-GUANINE CONTAINING DNA RAD14: RESIDUES 188-306, 5'-D(*GP*CP*TP*CP*TP*AP*6FKP*TP*CP*AP*TP*CP*AP*CP CHAIN: C, E, 5'-D(*GP*TP*GP*AP*TP*GP*AP*CP*GP*TP*AP*GP*AP*GP)- CHAIN: D, F CELL CYCLE CELL CYCLE, DNA REPAIR, NUCLEOTIDE EXCISION REPAIR

6FM    2'-DEOXY-4'-ETHYNYL-2-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
5j2n	prot-nuc 2.90	2'-DEOXY-4'-ETHYNYL-2-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C12 H13 F N5 O6 P	HIV-1 REVERSE TRANSCRIPTASE IN COMPLEX WITH DNA THAT HAS INC EFDA-MP AT THE P-(POST-TRANSLOCATION) SITE AND DTMP AT THE TRANSLOCATION) SITE DNA 5'- D(*AP*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG) P*CP*GP*CP*CP*G)-3', REVERSE TRANSCRIPTASE, P51 DOMAIN, DNA (27-MER), REVERSE TRANSCRIPTASE, P66 DOMAIN TRANSFERASE/DNA HIV-1, REVERSE TRANSCRIPTASE, RT, DNA, DOUBLE STRANDED DNA, EFDA, 4'-ETHYNYL-2-FLUORO-2'-DEOXYADENOSINE, EFDA-MONOPHOSP EFDA-MP, INHIBITORS, NRTI, TDRTI, TRANSLOCATION DEFECTIVE, TRANSLOCATION, N SITE, TRANSFERASE-DNA COMPLEX
5j2p	prot-nuc 2.53	2'-DEOXY-4'-ETHYNYL-2-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 2(C12 H13 F N5 O6 P)	HIV-1 REVERSE TRANSCRIPTASE IN COMPLEX WITH DNA THAT HAS INC EFDA-MP AT THE P-(POST-TRANSLOCATION) SITE AND A SECOND EFD THE N-(PRE-TRANSLOCATION) SITE REVERSE TRANSCRIPTASE, P51 DOMAIN, DNA (5'- D(*AP*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG) P*CP*GP*CP*CP*(6FM)P*(6FM))-3'), DNA (27-MER), REVERSE TRANSCRIPTASE, P66 DOMAIN TRANSFERASE/DNA HIV-1, REVERSE TRANSCRIPTASE, RT, DNA, DOUBLE STRANDED DNA, EFDA, 4'-ETHYNYL-2-FLUORO-2'-DEOXYADENOSINE, EFDA-MONOPHOSP EFDA-MP, INHIBITORS, NRTI, TDRTI, TRANSLOCATION DEFECTIVE, SITE, PRE-TRANSLOCATION, POST-TRANSLOCATION, TRANSFERASE-DN
5j2q	prot-nuc 2.79	2'-DEOXY-4'-ETHYNYL-2-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 2(C12 H13 F N5 O6 P)	HIV-1 REVERSE TRANSCRIPTASE IN COMPLEX WITH DNA THAT HAS INC A MISMATCHED EFDA-MP AT THE N-(PRE-TRANSLOCATION) SITE DNA (5'- D(*AP*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG) P*CP*GP*CP*CP*(6FM)P*(6FM))-3'), HIV-1 REVERSE TRANSCRIPTASE P51 DOMAIN, HIV-1 REVERSE TRANSCRIPTASE P66 SUBUNIT, DNA (27-MER) TRANSFERASE/DNA HIV-1, REVERSE TRANSCRIPTASE, RT, DNA, DOUBLE STRANDED DNA, MISMATCH, EFDA, 4'-ETHYNYL-2-FLUORO-2'-DEOXYADENOSINE, EFDA MONOPHOSPHATE, EFDA-MP, INHIBITORS, NRTI, TDRTI, TRANSLOCAT DEFECTIVE, P SITE, N SITE, PRE-TRANSLOCATION, POST-TRANSLOC TRANSFERASE-DNA COMPLEX

6FN    2'-DEOXY-4'-ETHYNYL-2-FLUOROADENOSINE 5'-(TETRAHYDROGEN TRIPHOSPHATE)

Code	Class Resolution	Description
5j2m	prot-nuc 2.43	2'-DEOXY-4'-ETHYNYL-2-FLUOROADENOSINE 5'-(TETRAHYDROGEN TRIPHOSPHATE) C12 H15 F N5 O12 P3	HIV-1 REVERSE TRANSCRIPTASE IN COMPLEX WITH DNA AND EFDA-TRI A TRANSLOCATION-DEFECTIVE RT INHIBITOR DNA (27-MER), HIV-1 REVERSE TRANSCRIPTASE P51 SUBUNIT: UNP RESIDUES 1-560, DNA (5'- D(*AP*CP*AP*GP*TP*CP*CP*CP*TP*GP*TP*TP*CP*GP*GP*(MRG) P*CP*GP*CP*CP*G)-3'), HIV-1 REVERSE TRANSCRIPTASE P51 SUBUNIT: UNP RESIDUES 1-440 TRANSFERASE/DNA HIV-1, REVERSE TRANSCRIPTASE, RT, DNA, DOUBLE STRANDED DNA, EFDA, 4'-ETHYNYL-2-FLUORO-2'-DEOXYADENOSINE, EFDA-TRIPHOSPH EFDA-TP, INHIBITORS, NRTI, TDRTI, TRANSLOCATION DEFECTIVE, TRANSFERASE-DNA COMPLEX

6GS    2'-DEOXY-2'-FLUORO-2'-METHYLURIDINE 5'-(TRIHYDROGEN DIPHOSPHATE)

Code	Class Resolution	Description
4wtg	prot-nuc 2.90	2'-DEOXY-2'-FLUORO-2'-METHYLURIDINE 5'-(TRIHYDROGEN DIPHOSPHATE) C10 H15 F N2 O11 P2	CRYSTAL STRUCTURE OF HCV NS5B GENOTYPE 2A JFH-1 ISOLATE WITH E87Q C223H V321I MUTATIONS AND DELTA8 BETA HAIRPIN LOOP DEL COMPLEX WITH SOFOSBUVIR DIPHOSPHATE GS-607596, MN2+ AND SYM PRIMER TEMPLATE 5'-CAAAAUUU RNA-DIRECTED RNA POLYMERASE, RNA PRIMER TEMPLATE CAAAAUUU TRANSFERASE/RNA HCV, VIRAL, NS5B, RDRP, RESISTANCE MUTATION, TEMPLATE, PRIME INITIATION, DELTA8 BETA HAIRPIN LOOP DELETION, TRANSFERASE- COMPLEX

6IA    N6-ISOPENTENYL-ADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2dlc	prot-nuc 2.40	N6-ISOPENTENYL-ADENOSINE-5'-MONOPHOSPHATE C15 H24 N5 O7 P	CRYSTAL STRUCTURE OF THE TERNARY COMPLEX OF YEAST TYROSYL-TR SYNTHETASE T-RNA (76-MER), TYROSYL-TRNA SYNTHETASE, CYTOPLASMIC LIGASE/TRNA TYRRS, TRNA, LIGASE-TRNA COMPLEX
3epl	prot-nuc 3.60	N6-ISOPENTENYL-ADENOSINE-5'-MONOPHOSPHATE C15 H24 N5 O7 P	CRYSTALLOGRAPHIC SNAPSHOTS OF EUKARYOTIC DIMETHYLALLYLTRANSFERASE ACTING ON TRNA: INSIGHT INTO TRNA RECOGNITION AND REACTION MECHANISM TRNA ISOPENTENYLTRANSFERASE: UNP RESIDUES 13-421, TRNA, TRNA TRANSFERASE/RNA TRANSFERASE, ALTERNATIVE INITIATION, ATP-BINDING, CYTOPLASM, MITOCHONDRION, NUCLEOTIDE-BINDING, NUCLEUS, TRNA PROCESSING TRANSFERASE/RNA COMPLEX

6MA    N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1g38	prot-nuc 2.00	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	ADENINE-SPECIFIC METHYLTRANSFERASE M. TAQ I/DNA COMPLEX 5'-D(*GP*TP*TP*CP*GP*AP*TP*GP*TP*C)-3', 5'-D(*GP*AP*CP*AP*TP*CP*GP*(6MA)P*AP*C)-3', MODIFICATION METHYLASE TAQI: RESIDUES 21 - 413 TRANSFERASE/DNA TRANSFERASE, DNA, METHYLTRANSFERASE, RESTRICTION SYSTEM, TRA DNA COMPLEX
1j3e	prot-nuc 2.50	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	CRYSTAL STRUCTURE OF THE E.COLI SEQA PROTEIN COMPLEXED WITH N6-METHYLADENINE- GUANINE MISMATCH DNA 5'-D(*AP*AP*GP*GP*(6MA)P*TP*CP*CP*AP*A)-3', SEQA PROTEIN: DNA BINDING DOMAIN, 5'-D(*TP*TP*GP*GP*AP*GP*CP*CP*TP*T)-3' REPLICATION/DNA PROTEIN-DNA COMPLEX, RECOGNITION OF HEMIMETHYLATED DNA, MISMATCHED DNA, REPLICATION, RIKEN STRUCTURAL GENOMICS/PROTEOMICS INITIATIVE, RSGI, STRUCTURAL GENOMICS, REPLICATION/DNA COMPLEX
1lrr	prot-nuc 2.65	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF E. COLI SEQA COMPLEXED WITH HEMIMETHYLA 5'-D(*CP*AP*CP*CP*GP*AP*TP*CP*GP*AP*CP*T)-3', SEQA PROTEIN: RESIDUES 51-181, 5'-D(*AP*GP*TP*CP*GP*(6MA)P*TP*CP*GP*GP*TP*G)-3' REPLICATION INHIBITOR/DNA PROTEIN-DNA COMPLEX, REPLICATION, METHYLATED GATC, REPLICATI INHIBITOR-DNA COMPLEX
2aor	prot-nuc 2.00	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF MUTH-HEMIMETHYLATED DNA COMPLEX DNA MISMATCH REPAIR PROTEIN MUTH, 5'-D(*CP*AP*GP*GP*(6MA) P*TP*CP*CP*AP*AP*GP*CP*TP*TP*GP*GP*AP*TP*CP*CP*TP*G)-3' HYDROLASE/DNA GATC RECOGNITION, HYDROLASE/DNA COMPLEX
2ibs	prot-nuc 2.40	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFERASE M.TAQI COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CONTAINING 2-AMINOPURINE AT THE TARGET POSITION 5'-D(*GP*TP*TP*CP*GP*(2PR)P*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI, 5'-D(*GP*AP*CP*AP*TP*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, 2-AMINOPURINE, BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE/DNA COMPLEX
2ibt	prot-nuc 1.70	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON AMINOPURINE AT THE TARGET POSITION AND AN ABASIC SITE ANALO TARGET BASE PARTNER POSITION 5'-D(*GP*TP*TP*CP*GP*(2PR)P*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI, 5'-D(*GP*AP*CP*AP*(3DR)P*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, 2-AMINOPURINE, ABASIC SITE ANALO FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
2ih2	prot-nuc 1.61	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON METHYLPYRIMIDIN-2(1H)-ONE AT THE TARGET BASE PARTNER POSITI 5'-D(*GP*AP*CP*AP*(5PY)P*CP*GP*(6MA)P*AP*C)-3', 5'-D(*GP*TP*TP*CP*GP*AP*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, 5-METHYLPYR 2(1H)-ONE, BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE- COMPLEX
2ih4	prot-nuc 2.10	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON PYRROLO-DC AT THE TARGET BASE PARTNER POSITION 5'-D(*GP*AP*CP*AP*(4PC)P*CP*GP*(6MA)P*AP*C)-3', 5'-D(*GP*TP*TP*CP*GP*AP*TP*GP*TP*C)-3', MODIFICATION METHYLASE TAQI TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, PYRROLO-DC, FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
2ih5	prot-nuc 1.80	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON ABASIC SITE ANALOG AT THE TARGET BASE PARTNER POSITION MODIFICATION METHYLASE TAQI, 5'-D(*GP*TP*TP*CP*GP*AP*TP*GP*TP*C)-3', 5'-D(*GP*AP*CP*AP*(3DR)P*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, ABASIC SITE BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
2jg3	prot-nuc 1.90	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	MTAQI WITH BAZ MODIFICATION METHYLASE TAQI5'-D(*GP*AP*CP*AP*TP*CP*GP*6MAP*AP*CP)-3', 5'-D(*GP*TP*TP*CP*GP*AP*TP*GP*TP*CP)-3' TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX, DNA, TRANSFERASE, BASE FLIPPING, RESTRICTION SYSTEM
2np6	prot-nuc 2.10	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON ABASIC SITE ANALOG AT THE TARGET POSITION MODIFICATION METHYLASE TAQI, 5'-D(*GP*AP*CP*AP*TP*CP*GP*(6MA)P*AP*C)-3', 5'-D(*GP*TP*TP*CP*GP*(3DR)P*TP*GP*TP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, ABASIC SITE ANALOG, BASE FLIPPIN NUCLEOTIDE FLIPPING, TRANSFERASE-DNA COMPLEX
2np7	prot-nuc 1.90	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	CRYSTAL STRUCTURE OF THE ADENINE-SPECIFIC DNA METHYLTRANSFER COMPLEXED WITH THE COFACTOR ANALOG AETA AND A 10 BP DNA CON ABASIC SITE ANALOG AT THE TARGET POSITION AND PYRROLO-DC AT TARGET BASE PARTNER POSITION MODIFICATION METHYLASE TAQI, 5'-D(*GP*TP*TP*CP*GP*(3DR)P*TP*GP*TP*C)-3', 5'-D(*GP*AP*CP*AP*(4PC)P*CP*GP*(6MA)P*AP*C)-3' TRANSFERASE/DNA DNA, DNA METHYLTRANSFERASE, TARGET BASE PARTNER, PYRROLO-DC, SITE ANALOG, BASE FLIPPING, NUCLEOTIDE FLIPPING, TRANSFERAS COMPLEX
3fmt	prot-nuc 2.98	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 4(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF SEQA BOUND TO DNA 5'- D(*TP*CP*TP*AP*AP*GP*GP*AP*TP*CP*CP*CP*GP*CP*CP*GP*AP*TP*CP *GP*AP*C)-3', 5'-D(*GP*AP*GP*TP*CP*GP*(6MA) P*TP*CP*GP*GP*CP*GP*GP*GP*(6MA)P*TP*CP*CP*TP*TP*A)-3', PROTEIN SEQA: SEQADELTA(41-59) REPLICATION INHIBITOR/DNA PROTEIN-DNA COMPLEX, HEMIMETHYLATED GATC, DNA REPLICATION, SEQUESTRATION, DNA REPLICATION INHIBITOR, DNA-BINDING, REPLICATION INHIBITOR/DNA COMPLEX
3h8r	prot-nuc 1.77	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	STRUCTURE DETERMINATION OF DNA METHYLATION LESIONS N1-MEA AN IN DUPLEX DNA USING A CROSS-LINKED HOST-GUEST SYSTEM 5'-D(*TP*CP*GP*CP*TP*AP*TP*AP*AP*TP*AP*CP*A)-3', 5'-D(*CP*TP*GP*TP*AP*TP*(2YR)P*AP*TP*(6MA)P*GP*CP CHAIN: B, ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB HO CHAIN: A: TRUNCATION WITH N-TERMINAL 55 AMINO ACID DELETED OXIDOREDUCTASE/DNA PROTEIN-DNA COMPLEX, DIOXYGENASE, DNA DAMAGE, DNA REPAIR, IR METAL-BINDING, NUCLEUS, OXIDOREDUCTASE-DNA COMPLEX
4esj	prot-nuc 2.05	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 4(C11 H16 N5 O6 P)	RESTRICTION ENDONUCLEASE DPNI IN COMPLEX WITH TARGET DNA DNA (5'-D(*CP*TP*GP*GP*(6MA)P*TP*CP*CP*AP*G)-3'), TYPE-2 RESTRICTION ENZYME DPNI HYDROLASE/DNA RESTRICTION ENDONUCLEASE-DNA COMPLEX, TYPE IIM, TYPE IIE, RE ENZYME, DPNI, METHYLATION DEPENDENT, N6-METHYLADENINE, PD-( TYPE ENDONUCLEASE, WINGED HELIX DOMAIN, RESTRICTION ENDONUC DNA BINDING, HYDROLASE-DNA COMPLEX
4kyw	prot-nuc 2.35	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 4(C11 H16 N5 O6 P)	RESTRICTION ENDONUCLEASE DPNI IN COMPLEX WITH TWO DNA MOLECU 5'-(*DC*DTP*DGP*DGP*6MAP*DTP*DCP*DCP*DAP*DG)-3', TYPE-2 RESTRICTION ENZYME DPNI HYDROLASE/DNA RESTRICTION ENDONUCLEASE-DNA COMPLEX, TYPE IIM, TYPE IIE, RE ENZYME, DPNI, METHYLATION DEPENDENT, N6-METHYLADENINE, PD-( TYPE ENDONUCLEASE, WINGED HELIX DOMAIN, RESTRICTION ENDONUC DNA BINDING, HYDROLASE-DNA COMPLEX
4nid	prot-nuc 1.58	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	CRYSTAL STRUCTURE OF ALKB PROTEIN WITH COFACTORS BOUND TO DS CONTAINING M6A ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: UNP RESIDUES 12-214, 5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T)-3', 5'-D(*TP*AP*GP*GP*TP*AP*AP*(6MA)P*AP*CP*CP*GP*T)- CHAIN: B OXIDOREDUCTASE/DNA DNA/RNA DIRECT REPAIR, JELLY-ROLL FOLD, DNA/RNA DEMETHYLATIO FE(II), 2-KG, OXIDOREDUCTASE-DNA COMPLEX
4nig	prot-nuc 1.52	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	CRYSTAL STRUCTURE OF ALKB D135I/E136H MUTANT PROTEIN WITH CO BOUND TO DSDNA CONTAINING M6A/A 5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T)-3', 5'-D(*TP*AP*GP*GP*TP*AP*AP*(6MA)P*AP*CP*CP*GP*T)- CHAIN: B, ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: UNP RESIDUES 13-216 OXIDOREDUCTASE/DNA DNA/RNA DIRECT REPAIR, JELLY-ROLL FOLD, DNA/RNA DEMETHYLATIO FE(II), 2-KG, OXIDOREDUCTASE-DNA COMPLEX
4nih	prot-nuc 1.37	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	CRYSTAL STRUCTURE OF ALKB E136L MUTANT PROTEIN WITH COFACTOR DSDNA CONTAINING M6A/A 5'-D(*TP*AP*GP*GP*TP*AP*AP*(6MA)P*AP*CP*CP*GP*T)- CHAIN: B, 5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T)-3', ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: UNP RESIDUES 13-216 OXIDOREDUCTASE/DNA DNA/RNA DIRECT REPAIR, JELLY-ROLL FOLD, DNA/RNA DEMETHYLATIO FE(II), 2-KG, OXIDOREDUCTASE-DNA COMPLEX
4nii	prot-nuc 1.62	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	CRYSTAL STRUCTURE OF ALKB D135I MUTANT PROTEIN WITH COFACTOR DSDNA CONTAINING M6A/A ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB: UNP RESIDUES 12-215, 5'-D(*AP*AP*CP*GP*GP*TP*AP*TP*TP*AP*CP*CP*T)-3', 5'-D(*TP*AP*GP*GP*TP*AP*AP*(6MA)P*AP*CP*CP*GP*T)- CHAIN: B OXIDOREDUCTASE/DNA DNA/RNA DIRECT REPAIR, JELLY-ROLL FOLD, DNA/RNA DEMETHYLATIO FE(II), 2-KG, OXIDOREDUCTASE-DNA COMPLEX

6MD    N-METHYLADENOSINE

Code	Class Resolution	Description
4x64	prot-nuc 3.35	N-METHYLADENOSINE C11 H15 N5 O4	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, RNA (5'-D(*(MA6)P*AP*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX

6MI    6-METHYL-8-(2-DEOXY-RIBOFURANOSYL)ISOXANTHOPTERIDINE

Code	Class Resolution	Description
1pgz	prot-nuc 2.60	6-METHYL-8-(2-DEOXY-RIBOFURANOSYL)ISOXANTHOPTERIDINE C12 H16 N5 O8 P	CRYSTAL STRUCTURE OF UP1 COMPLEXED WITH D(TTAGGGTTAG(6-MI) G); A HUMAN TELOMERIC REPEAT CONTAINING 6-METHYL-8-(2- DEOXY-BETA-RIBOFURANOSYL)ISOXANTHOPTERIDINE (6-MI) 5'-D(*T*TP*AP*GP*GP*GP*TP*TP*AP*GP*(6MI)P*G)-3', HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A1: RESIDUES 1-195 DNA BINDING PROTEIN/DNA PROTEIN-DNA COMPLEX; UP1; HUMAN TELOMERIC REPEAT; HTR; TR2- 11F; RRM; RNA RECOGNITION MOTIF; 6-MI; 6-METHYL-8-(2-DEOXY- BETA-RIBOFURANOSYL)ISOXANTHOPTERIDINE; HNRNP A1, DNA BINDING PROTEIN/DNA COMPLEX
1po6	prot-nuc 2.10	6-METHYL-8-(2-DEOXY-RIBOFURANOSYL)ISOXANTHOPTERIDINE C12 H16 N5 O8 P	CRYSTAL STRUCTURE OF UP1 COMPLEXED WITH D(TAGG(6MI)TTAGGG): A HUMAN TELOMERIC REPEAT CONTAINING 6-METHYL-8-(2-DEOXY- BETA-RIBOFURANOSYL)ISOXANTHOPTERIDINE (6MI) HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A1: RESIDUES 8-190, 5'-D(*T*AP*GP*GP*(6MI)P*TP*TP*AP*GP*GP*G)-3' RNA BINDING PROTEIN/DNA PROTEIN-DNA COMPLEX, UP1, HUMAN TELOMERIC REPEAT, HTR, TR2- 6F, RRM, RNA RECOGNITION MOTIF, 6MI, 6-METHYL-8-(2-DEOXY- BETA-RIBOFURANOSYL)ISOXANTHOPTERIDINE, HNRNP A1, RNA BINDING PROTEIN/DNA COMPLEX

6MN    2-AMINO-2-DEOXY-6-O-PHOSPHONO-ALPHA-D-MANNOPYRANOSE

Code	Class Resolution	Description
3g96	prot-nuc 3.01	2-AMINO-2-DEOXY-6-O-PHOSPHONO-ALPHA-D-MANNOPYRANOSE C6 H14 N O8 P	CRYSTAL STRUCTURE OF THE BACILLUS ANTHRACIS GLMS RIBOZYME BO MAN6P U1 SMALL NUCLEAR RIBONUCLEOPROTEIN A: RNA BINDING DOMAIN (UNP RESIDUES 1 TO 98), RNA (5'-R(*AP*(A2M)P*GP*CP*GP*CP*CP*AP*GP*AP*AP*C CHAIN: E, F, G, H, GLMS RIBOZYME RNA BINDING PROTEIN/RNA CATALYTIC RNA, RNA BINDING PROTEIN-RNA COMPLEX

6MP    6-METHYLPURINE

Code	Class Resolution	Description
2pua	prot-nuc 2.90	6-METHYLPURINE C6 H6 N4	CRYSTAL STRUCTURE OF THE LACI FAMILY MEMBER, PURR, BOUND TO GROOVE BINDING BY ALPHA HELICES PURINE REPRESSOR, DNA (5'- D(*TP*AP*CP*GP*CP*AP*AP*AP*CP*GP*TP*TP*TP*GP*CP*GP*T )-3') TRANSCRIPTION/DNA COMPLEX (DNA-BINDING PROTEIN-DNA), DNA-BINDING REGULATORY PR TRANSCRIPTION-DNA COMPLEX

6MZ    N6-METHYLADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2mtv	prot-nuc NMR    	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	SOLUTION STRUCTURE OF THE YTH DOMAIN OF YT521-B IN COMPLEX W METHYLADENOSINE CONTAINING RNA YTH DOMAIN-CONTAINING PROTEIN 1: UNP RESIDUES 347-502, RNA_(5'-R(*UP*GP*(6MZ)P*CP*AP*C)-3') RNA BINDING PROTEIN/RNA YTH, M6A, RNA BINDING PROTEIN-RNA COMPLEX
2uu9	prot-nuc 3.10	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT COMPLEXED WITH A VALINE-ASL WITH CMO5U IN POSITION 34 BOUND TO AN MRNA WITH A GUG-CODON IN THE A-SITE AND PAROMOMYCIN. 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S17, RNA, RNA, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5 RIBOSOME TRNA-BINDING, RRNA-BINDING, METAL-BINDING, ZINC-FINGER, TRANSLATION, COILED COIL, PAROMOMYCIN, TRNA, ZINC, MRNA, CMO5U, RIBOSOME, RNA-BINDING, MODIFIACTIONS, RIBOSOMAL PROTEIN, RIBONUCLEOPROTEIN
2uua	prot-nuc 2.90	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT COMPLEXED WITH A VALINE-ASL WITH CMO5U IN POSITION 34 BOUND TO AN MRNA WITH A GUC-CODON IN THE A-SITE AND PAROMOMYCIN. 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S11, 5'-R(*GP*UP*CP*AP*AP*AP)-3', 5'-R(*CP*CP*UP*CP*CP*CP*UP*CM0P*AP*CP*6MZP*AP *GP*GP*AP*GP*G)-3', 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17 RIBOSOME TRNA-BINDING, RRNA-BINDING, METAL-BINDING, ZINC-FINGER, TRANSLATION, COILED COIL, PAROMOMYCIN, TRNA, ZINC, MRNA, CMO5U, RIBOSOME, RNA-BINDING, MODIFIACTIONS, RIBOSOMAL PROTEIN, RIBONUCLEOPROTEIN
2uub	prot-nuc 2.90	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT COMPLEXED WITH A VALINE-ASL WITH CMO5U IN POSITION 34 BOUND TO AN MRNA WITH A GUU-CODON IN THE A-SITE AND PAROMOMYCIN. 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 5'-R(*GP*UP*UP*AP*AP*AP)-3', 5'-R(*CP*CP*UP*CP*CP*CP*UP*CM0P*AP*CP*6MZP*AP *GP*GP*AP*GP*G)-3', 30S RIBOSOMAL PROTEIN S11 RIBOSOME TRNA-BINDING, RRNA-BINDING, METAL-BINDING, ZINC-FINGER, TRANSLATION, COILED COIL, PAROMOMYCIN, TRNA, ZINC, MRNA, CMO5U, RIBOSOME, RNA-BINDING, MODIFICATIONS, RIBOSOMAL PROTEIN, RIBONUCLEOPROTEIN
2uuc	prot-nuc 3.10	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT COMPLEXED WITH A VALINE-ASL WITH CMO5U IN POSITION 34 BOUND TO AN MRNA WITH A GUA-CODON IN THE A-SITE AND PAROMOMYCIN. 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S17, 5'-R(*GP*UP*AP*AP*AP*AP)-3', 5'-R(*CP*CP*UP*CP*CP*CP*UP*CM0P*AP*CP*6MZP*AP *GP*GP*AP*GP*G)-3', 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S13 RIBOSOME TRNA, ZINC, MRNA, CMO5U, RIBOSOME, DECODING, ZINC-FINGER, RNA-BINDING, TRANSLATION, COILED COIL, PAROMOMYCIN, RRNA- BINDING, TRNA-BINDING, METAL-BINDING, MODIFICATIONS, RIBOSOMAL PROTEIN, RIBONUCLEOPROTEIN
4r3i	prot-nuc 1.80	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE CRYSTAL STRUCTURE OF AN RNA COMPLEX YTH DOMAIN-CONTAINING PROTEIN 1, RNA (5'-R(*GP*GP*(6MZ)P*CP*U)-3') RNA BINDING PROTEIN/RNA STRUCTURAL GENOMICS, STRUCTURAL GENOMICS CONSORTIUM, SGC, RN PROTEIN-RNA COMPLEX
4rcj	prot-nuc 1.60	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF YTHDF1 YTH DOMAIN IN COMPLEX WITH 5MER YTH DOMAIN-CONTAINING FAMILY PROTEIN 1: UNP RESIDUES 365-554, RNA (5'-R(*GP*GP*(6MZ)P*CP*U)-3') RNA BINDING PROTEIN/RNA STRUCTURAL GENOMICS, STRUCTURAL GENOMICS CONSORTIUM, SGC, RN PROTEIN-RNA COMPLEX
4rcm	prot-nuc 1.80	N6-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF THE PHO92 YTH DOMAIN IN COMPLEX WITH M6 RNA (5'-R(*UP*G)-D(*(6MZ)P*CP*U)-3'), METHYLATED RNA-BINDING PROTEIN 1: UNP RESIDUES 141-306 RNA BINDING PROTEIN/RNA STRUCTURAL GENOMICS, STRUCTURAL GENOMICS CONSORTIUM, SGC, RN PROTEIN-RNA COMPLEX
4u8t	prot-nuc 2.70	N6-METHYLADENOSINE-5'-MONOPHOSPHATE 6(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF YTH DOMAIN OF ZYGOSACCHAROMYCES ROUXII PROTEIN IN COMPLEX WITH N6-METHYLADENOSINE RNA ZYRO0G01672P: YTH DOMAIN, UNP RESIDUES 166-329, RNA (5'-R(*AP*GP*GP*(6MZ)P*CP*AP*U)-3') RNA BINDING PROTEIN/RNA N6-METHYLADENOSINE RNA, YTH RNA BINDING DOMAIN, RNA BINDING RNA COMPLEX
4x65	prot-nuc 3.35	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, RNA (5'-D(*AP*(MA6)P*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x66	prot-nuc 3.45	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(*AP*AP*(MA6)P*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX

6NO    AVILAMYCIN

Code	Class Resolution	Description
5jvg	prot-nuc 3.43	AVILAMYCIN C61 H88 CL2 O32	THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS IN WITH AVILAMYCIN 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L27, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L18, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L25/GENERAL STRESS PROTEIN CHAIN: S, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L33, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L30, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L17, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L19, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L22 RIBOSOME DEINOCOCCUS RADIODURANS, AVILAMYCIN, DEGRADABLE ANTIBIOTICS, RIBOSOME, LARGE RIBOSOMAL SUBUNIT, RESISTANCE

6O1    EVERNIMICIN

Code	Class Resolution	Description
5jvh	prot-nuc 3.58	EVERNIMICIN C70 H97 CL2 N O38	THE CRYSTAL STRUCTURE LARGE RIBOSOMAL SUBUNIT (50S) OF DEINO RADIODURANS IN COMPLEX WITH EVERNIMICIN 50S RIBOSOMAL PROTEIN L18, 50S RIBOSOMAL PROTEIN L13, 50S RIBOSOMAL PROTEIN L32, 50S RIBOSOMAL PROTEIN L3, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L5, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L20, 50S RIBOSOMAL PROTEIN L33, 50S RIBOSOMAL PROTEIN L4, 50S RIBOSOMAL PROTEIN L15, 50S RIBOSOMAL PROTEIN L30, 50S RIBOSOMAL PROTEIN L21, 50S RIBOSOMAL PROTEIN L16, 50S RIBOSOMAL PROTEIN L28, 50S RIBOSOMAL PROTEIN L29, 50S RIBOSOMAL PROTEIN L34, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L35, 50S RIBOSOMAL PROTEIN L14, 50S RIBOSOMAL PROTEIN L19, 50S RIBOSOMAL PROTEIN L17, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L24, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L27, 50S RIBOSOMAL PROTEIN L25 RIBOSOME RIBOSOME, ANTIBIOTICS

6OG    6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1t38	prot-nuc 3.20	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE BOUND TO DNA CONTAINING O6-METHYLGUANINE METHYLATED-DNA--PROTEIN-CYSTEINE METHYLTRANSFERASE, 5'-D(*TP*AP*CP*TP*AP*GP*CP*CP*AP*TP*GP*GP*C)-3', 5'-D(*GP*CP*CP*AP*TP*GP*(6OG)P*CP*TP*AP*GP*TP*A)- 3' TRANSFERASE/DNA ALKYLTRANSFERASE, METHYLTRANSFERASE, DNA REPAIR, HELIX-TURN- HELIX, TRANSFERASE/DNA COMPLEX
2hhq	prot-nuc 1.80	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	O6-METHYL-GUANINE:T PAIR IN THE POLYMERASE-10 BASEPAIR POSITION DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT), 5'- D(*GP*CP*CP*TP*GP*AP*CP*TP*CP*GP*TP*AP*TP*GP*A)-3', 5'-D(*CP*AP*TP*(6OG)P*CP*GP*AP*GP*TP*CP*AP*GP*G)- 3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, PROTEIN- DNA COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2hhs	prot-nuc 1.80	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	O6-METHYL:C PAIR IN THE POLYMERASE-10 BASEPAIR POSITION 5'-D(*CP*AP*TP*(6OG)P*CP*GP*AP*GP*TP*CP*AP*GP*G)- 3', 5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*GP*CP*AP*TP*GP*A)- 3', DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT) TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, DNA- PROTEIN COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2hht	prot-nuc 2.05	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	C:O6-METHYL-GUANINE PAIR IN THE POLYMERASE-2 BASEPAIR POSITION 5'-D(*GP*TP*AP*CP*(6OG) P*AP*GP*CP*TP*GP*AP*TP*CP*GP*CP*A)-3', DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT), 5'-D(*GP*CP*GP*AP*TP*CP*AP*GP*CP*TP*CP*G)-3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, PROTEIN- DNA COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2hhu	prot-nuc 1.80	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	C:O6-METHYL-GUANINE IN THE POLYMERASE POSTINSERTION SITE (- 1 BASEPAIR POSITION) 5'-D(*GP*CP*GP*AP*TP*CP*AP*GP*CP*CP*C)-3', DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT), 5'-D(*GP*TP*AP*CP*(6OG) P*GP*GP*CP*TP*GP*AP*TP*CP*GP*CP*A)-3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, PROTEIN- DNA COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2hhv	prot-nuc 1.55	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	T:O6-METHYL-GUANINE IN THE POLYMERASE-2 BASEPAIR POSITION 5'-D(*GP*CP*GP*AP*TP*CP*AP*GP*CP*TP*TP*G)-3', DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT), 5'-D(*GP*TP*AP*CP*(6OG) P*AP*GP*CP*TP*GP*AP*TP*CP*GP*CP*A)-3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, PROTEIN- DNA COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2hhw	prot-nuc 1.88	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	DDTTP:O6-METHYL-GUANINE PAIR IN THE POLYMERASE ACTIVE SITE, IN THE CLOSED CONFORMATION DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT), 5'-D(*CP*AP*TP*(6OG)P*CP*GP*AP*GP*TP*CP*AP*GP*G)- 3', 5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*(DDG))-3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, DNA- PROTEIN COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2hhx	prot-nuc 2.26	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	O6-METHYL-GUANINE IN THE POLYMERASE TEMPLATE PREINSERTION SITE DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT), 5'-D(*CP*AP*TP*(6OG)P*CP*GP*AP*GP*TP*CP*AP*GP*G)- 3', 5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*G)-3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, PROTEIN- DNA COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2hvh	prot-nuc 2.49	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	DDCTP:O6MEG PAIR IN THE POLYMERASE ACTIVE SITE (0 POSITION) 5'-D(*CP*A*TP*(6OG)P*CP*GP*AP*GP*TP*CP*AP*GP*G)- 3', DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E. COLI KLENOW FRAGMENT), 5'-D(*CP*CP*TP*GP*AP*CP*TP*CP*(DDG))-3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, PROTEIN- DNA COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2hw3	prot-nuc 1.98	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	T:O6-METHYL-GUANINE PAIR IN THE POLYMERASE POSTINSERTION SITE (-1 BASEPAIR POSITION) 5'-D(*GP*CP*GP*AP*TP*CP*AP*GP*CP*TP*T)-3', DNA POLYMERASE I: RESIDUES 299-876 (ANALOGOUS TO E COLI KLENOW FRAGMENT), 5'-D(*GP*TP*A*CP*(6OG) P*AP*GP*CP*TP*GP*AP*TP*CP*GP*CP*A)-3' TRANSFERASE/DNA DNA POLYMERASE I, DNA REPLICATION, KLENOW FRAGMENT, PROTEIN- DNA COMPLEX, O6-METHYL-GUANINE, TRANSFERASE/DNA COMPLEX
2j6s	prot-nuc 2.50	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	TERNARY COMPLEX OF SULFOLOBUS SOLFATARICUS DPO4 DNA POLYMERASE, O6-METHYLGUANINE MODIFIED DNA, AND DATP. DNA POLYMERASE IV, 5'-D(*TP*CP*AP*TP*XP*GP*AP*AP*TP*CP *CP*TP*TP*CP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*CP*C)-3' TRANSFERASE/DNA TRANSFERASE/DNA, TRANSFERASE/DNA COMPLEX, MUTATOR PROTEIN, DNA REPLICATION, O6-METHYLGUANINE, TRANSFERASE, METAL-BINDING, DNA POLYMERASE, TRANSLESION DNA SYNTHESIS, DNA-DIRECTED DNA POLYMERASE, DPO4, MAGNESIUM, DNA REPAIR, DNA DAMAGE, DNA-BINDING, NUCLEOTIDYLTRANSFERASE, SULFOLOBUS SOLFATARICUS
2j6t	prot-nuc 2.60	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	TERNARY COMPLEX OF SULFOLOBUS SOLFATARICUS DPO4 DNA POLYMERASE, O6-METHYLGUANINE MODIFIED DNA, AND DATP. 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*C)-3', 5'-D(*TP*CP*AP*TP*XP*GP*AP*AP*TP*CP *CP*TP*TP*CP*CP*CP*CP*C)-3', DNA POLYMERASE IV TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX, MUTATOR PROTEIN, DNA REPLICATION, O6-METHYLGUANINE, TRANSFERASE, METAL-BINDING, TRANSLESION DNA SYNTHESIS, DNA-DIRECTED DNA POLYMERASE, DPO4, DNA REPAIR, DNA DAMAGE, DNA-BINDING, NUCLEOTIDYLTRANSFERASE
2j6u	prot-nuc 2.50	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	TERNARY COMPLEX OF SULFOLOBUS SOLFATARICUS DPO4 DNA POLYMERASE, O6-METHYLGUANINE MODIFIED DNA, AND DGTP. 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*CP*T)-3', 5'-D(*TP*CP*AP*C G32P*GP*AP*AP*TP*CP*CP *TP*TP*CP*CP*CP*CP*C)-3', DNA POLYMERASE IV TRANSFERASE/DNA TRANSFERASE/DNA, TRANSFERASE/DNA COMPLEX, MUTATOR PROTEIN, DNA REPLICATION, O6-METHYLGUANINE, TRANSFERASE, METAL-BINDING, DNA POLYMERASE, TRANSLESION DNA SYNTHESIS, DNA-DIRECTED DNA POLYMERASE, DPO4, MAGNESIUM, DNA REPAIR, DNA DAMAGE, DNA-BINDING, NUCLEOTIDYLTRANSFERASE, SULFOLOBUS SOLFATARICUS
2o8c	prot-nuc 3.37	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	HUMAN MUTSALPHA (MSH2/MSH6) BOUND TO ADP AND AN O6-METHYL-GU MISPAIR DNA MISMATCH REPAIR PROTEIN MSH6: RESIDUES 341-1360, 5'-D(*GP*AP*AP*CP*CP*GP*CP*(6OG)P*CP*GP*CP*TP*AP* CHAIN: E, DNA MISMATCH REPAIR PROTEIN MSH2, 5'-D(*CP*CP*TP*AP*GP*CP*GP*TP*GP*CP*GP*GP*TP*TP*C CHAIN: F DNA BINDING PROTEIN/DNA DNA MISMATCH REPAIR, DNA DAMAGE RESPONSE, PROTEIN-DNA COMPLE MISPAIR, CANCER, O6-METHYL-GUANINE, DNA BINDING PROTEIN-DNA
3gx4	prot-nuc 2.70	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE ANALYSIS OF S. POMBE ATL IN COMPLEX WITH D ALKYLTRANSFERASE-LIKE PROTEIN 1, DNA (5'-D(*GP*CP*CP*AP*TP*GP*(6OG)P*CP*TP*AP*GP*T CHAIN: Y, DNA (5'-D(*CP*TP*AP*CP*TP*AP*GP*CP*CP*AP*TP*GP*G) CHAIN: Z DNA BINDING PROTEIN/DNA ALKYLATED DNA DAMAGE REPAIR METHYLGUANINE, DNA DAMAGE, DNA R DNA-BINDING, DNA BINDING PROTEIN-DNA COMPLEX
3ngd	prot-nuc 2.80	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURAL BASIS FOR PROFICIENT INCORPORATION OF DTTP OPPOSI METHYLGUANINE BY HUMAN DNA POLYMERASE IOTA DNA POLYMERASE IOTA: CATALYTIC FRAGMENT, 1-420, 5'-D(*TP*CP*TP*(6OG) P*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*(DOC))-3' TRANSFERASE/DNA HOOGSTEEN BASE PAIR, NUCLEOSIDE TRIPHOSPHATE, Y-FAMILY DNA POLYMERASE, TRANSLESION SYNTHESIS, TRANSFERASE-DNA COMPLEX
3osn	prot-nuc 1.90	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURAL BASIS FOR PROFICIENT INCORPORATION OF DTTP OPPOSI METHYLGUANINE BY HUMAN DNA POLYMERASE IOTA DNA POLYMERASE IOTA: CATALYTIC FRAGMENT, RESIDUES 1-420, 5'-D(*TP*CP*TP*(6OG) P*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*(DOC))-3' TRANSFERASE/DNA HOOGSTEEN BASE PAIR, PROTEIN-DNA COMPLEX, Y-FAMILY DNA POLYM TRANSLESION SYNTHESIS, NUCLEOSIDE TRIPHOSPHATE, O6-METHYLGU TRANSFERASE-DNA COMPLEX
4mf2	prot-nuc 2.40	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH O6MG A TEMPLATE BASE IN A 1-NUCLEOTIDE GAPPED DNA SYNTHETIC UPSTREAM PRIMER, SYNTHETIC TEMPLATE DNA, DNA POLYMERASE BETA, SYNTHETIC DOWNSTREAM PRIMER TRANSFERASE/DNA PROTEIN-DNA COMPLEX, POLYMERASE X FAMILY, DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4mf8	prot-nuc 2.32	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH NICKED CONTAINING A MISMATCHED TEMPLATE O6MG AND INCOMING CTP PRIMER, TEMPLATE, DOWN PRIMER, DNA POLYMERASE BETA TRANSFERASE/DNA DNA POLYMERASE X FAMILY, DNA SYNTHESIS, TRANSFERASE-DNA COMP
4mfa	prot-nuc 2.27	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH NICKED CONTAINING A MISMATCHED TEMPLATE O6MG AND INCOMING TTP TEMPLATE, UP PRIMER, DNA POLYMERASE BETA, DN PRIMER TRANSFERASE/DNA DNA POLYMERASE X FAMILY, DNA SYNTHESIS, TRANSFERASE-DNA COMP
4mfc	prot-nuc 2.13	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH O6MG I TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP UP PRIMER, TEMPLATE, DN PRIMER, DNA POLYMERASE BETA TRANSFERASE/DNA DNA POLYMERASE X FAMILY, DNA SYNTHESIS, TRANSFERASE-DNA COMP
4mff	prot-nuc 2.55	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH O6MG I TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTP UP PRIMER, TEMPLATE, DN PRIMER, DNA POLYMERASE BETA TRANSFERASE/DNA DNA POLYMERASE X FAMILY, DNA SYNTHESIS, TRANSFERASE-DNA COMP
4nxz	prot-nuc 2.56	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	DNA POLYMERASE BETA WITH O6MG IN THE TEMPLATE BASE OPPOSITE INCOMING NON-HYDROLYZABLE TTP WITH MANGANESE IN THE ACTIVE 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*(6OG)P*TP*CP*GP*CP*AP*TP*CP* 3', DNA POLYMERASE BETA: UNP RESIDUES 10-335 TRANSFERASE, LYASE/DNA DNA BINDING, DNA POLYMERASE FOLD, NUCLEOTIDYL TRANSFER, NUCL TRANSFERASE, LYASE-DNA COMPLEX
4ny8	prot-nuc 2.25	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	DNA POLYMERASE BETA WITH O6MG IN THE TEMPLATE BASE OPPOSITE INCOMING NON-HYDROLYZABLE CTP WITH MANGANESE IN THE ACTIVE DNA POLYMERASE BETA: UNP RESIDUES 10-335, 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*(6OG)P*TP*CP*GP*CP*AP*TP*CP* 3', 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3' TRANSFERASE, LYASE/DNA DNA BINDING, DNA POLYMERASE FOLD, NUCLEOTIDYL TRANSFER, NUCL TRANSFERASE, LYASE-DNA COMPLEX
4ofh	prot-nuc 2.22	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURAL BASIS FOR THYMINE GLYCOSYLASE ACTIVITY ON T:O6-ME MISMATCH BY METHYL-CPG BINDING DOMAIN PROTEIN 4: IMPLICATIO ROLES OF ARG468 IN MISMATCH RECOGNITION AND CATALYSIS 12-MER DNA(T), 12-MER DNA(O6MEG), METHYL-CPG-BINDING DOMAIN PROTEIN 4: CATALYTIC DOMAIN OF MBD4 HYDROLASE/DNA PROTEIN-DNA COMPLEX, MISMATCH, THYMINE GLYCOSYLASE, HYDROLAS COMPLEX
4z6f	prot-nuc 2.44	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	STRUCTURE OF HUMAN DNA POLYMERASE BETA 279NA MUTANT COMPLEXE IN THE TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE MANGANESE DNA POLYMERASE BETA: UNP RESIDUES 10-335, DNA (5'-D(P*GP*TP*CP*GP*G)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(*CP*CP*GP*AP*CP*(6OG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4zyd	prot-nuc 2.68	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF SULFOLOBUS SOLFATARICUS O6-METHYLGUANIN METHYLTRANSFERASE IN COMPLEX WITH MODIFIED DNA METHYLATED-DNA--PROTEIN-CYSTEINE METHYLTRANSFERAS CHAIN: A, DNA (5'-D(*GP*CP*CP*AP*TP*GP*(6OG)P*CP*TP*AP*GP*T CHAIN: B, DNA (5'-D(*TP*AP*CP*TP*AP*GP*CP*CP*AP*TP*GP*GP*C) CHAIN: C TRANSFERASE TRANSFERASE, EXTREMOPHILES, DNA REPAIR, ALKYLATED DNA-PROTEI ALKYLTRANSFERASE, PROTEIN-DNA COMPLEX, CELL CYCLE
5l1i	prot-nuc 2.78	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DCTP O6-METHYL-2'-DEOXYGUANOSINE DNA POLYMERASE ETA, DNA (5'-D(*CP*AP*TP*(6OG)P*AP*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*TP*C)-3') TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA POLYMERASE, LESION BYPASS, METHYL-2'-DEOXYGUANOSINE, Y-FAMILY POLYMERASE, TRANSLESION SYNTHESIS (TLS), DNA BINDING PROTEIN., TRANSFERASE-DNA COMP
5l1j	prot-nuc 1.94	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF HUMAN DNA POLYMERASE ETA INSERTING DTMP OPPOSITE O6-METHYL-2'-DEOXYGUANOSINE DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA (5'-D(*CP*AP*TP*(6OG)P*AP*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA POLYMERASE ETA TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA POLYMERASE, LESION BYPASS, METHYL-2'-DEOXYGUANOSINE, Y-FAMILY POLYMERASE, TRANSLESION SYNTHESIS (TLS), DNA BINDING PROTEIN., TRANSFERASE-DNA COMP
5l1k	prot-nuc 1.82	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	POSTINSERTION COMPLEX OF HUMAN DNA POLYMERASE ETA BYPASSING METHYL-2'-DEOXYGUANOSINE : DC SITE DNA POLYMERASE ETA, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*C)-3'), DNA (5'-D(*CP*AP*TP*GP*(6OG)P*TP*GP*AP*CP*GP*CP*T CHAIN: T TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA POLYMERASE, LESION BYPASS, METHYL-2'-DEOXYGUANOSINE, Y-FAMILY POLYMERASE, TRANSLESION SYNTHESIS (TLS), DNA BINDING PROTEIN., TRANSFERASE-DNA COMP
5l1l	prot-nuc 1.62	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	POSTINSERTION COMPLEX OF HUMAN DNA POLYMERASE ETA BYPASSING METHYL-2'-DEOXYGUANOSINE : DT SITE DNA POLYMERASE ETA, DNA (5'-D(*CP*AP*TP*GP*(6OG)P*TP*GP*AP*CP*GP*CP*T CHAIN: T, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3') TRANSFERASE/DNA CATALYTIC DOMAIN, DNA DAMAGE, DNA POLYMERASE, LESION BYPASS, METHYL-2'-DEOXYGUANOSINE, Y-FAMILY POLYMERASE, TRANSLESION SYNTHESIS (TLS), DNA BINDING PROTEIN., TRANSFERASE-DNA COMP

6PO    9-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-PROPOXY-9H-PURIN-2-AMINE

Code	Class Resolution	Description
4enk	prot-nuc 3.04	9-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-PROPOXY-9H-PURIN-2-AMINE C13 H20 N5 O7 P	CRYSTAL STRUCTURE OF S. POMBE ATL1 IN COMPLEX WITH DAMAGED D CONTAINING O6-PROPYLGUANINE DNA (5'-D(*CP*TP*AP*CP*TP*AP*GP*CP*CP*AP*TP*GP*G) CHAIN: C, DNA (5'-D(*GP*CP*CP*AP*TP*GP*(6PO)P*CP*TP*AP*GP*T CHAIN: B, ALKYLTRANSFERASE-LIKE PROTEIN 1 DNA BINDING PROTEIN/DNA ALKYLTRANSFERASE, DNA REPAIR, NUCLEOTIDE EXCISION REPAIR, NE REPAIR, DNA, DNA DAMAGE, GUANINE, ALKYLATION, DNA BINDING P DNA COMPLEX

6TW    [(2~{R},3~{S},5~{R})-5-[2-[(3-ACETAMIDONAPHTHALEN-2- YL)AMINO]-6-OXIDANYLIDENE-1~{H}-PURIN-9-YL]-3- OXIDANYL-OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHITE

Code	Class Resolution	Description
5lcm	prot-nuc 1.90	[(2~{R},3~{S},5~{R})-5-[2-[(3-ACETAMIDONAPHTHALEN-2- YL)AMINO]-6-OXIDANYLIDENE-1~{H}-PURIN-9-YL]-3- OXIDANYL-OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHITE C22 H23 N6 O7 P	STRUCTURE OF THE RAD14 DNA-BINDING DOMAIN IN COMPLEX WITH N2 ACETYLAMINONAPHTYL- GUANINE CONTAINING DNA DNA (5'-D(*GP*TP*GP*AP*TP*GP*AP*CP*GP*TP*AP*GP*AP CHAIN: D, DNA (5'-D(*GP*CP*TP*CP*TP*AP*CP*(AAN)P*TP*CP*AP*T 3'), DNA REPAIR PROTEIN RAD14 DNA BINDING PROTEIN NUCLEOTIDE EXCISION REPAIR DNA DAMAGE RECOGNITION, DNA BINDI PROTEIN

6U0    [(2~{R},3~{S},4~{R},5~{S})-3,4-BIS(OXIDANYL)-5-[1-[(2- PHENYL-1~{H}-IMIDAZOL-5-YL)METHYL]-1,2,3-TRIAZOL-4- YL]OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
5ki6	prot-nuc 2.15	[(2~{R},3~{S},4~{R},5~{S})-3,4-BIS(OXIDANYL)-5-[1-[(2- PHENYL-1~{H}-IMIDAZOL-5-YL)METHYL]-1,2,3-TRIAZOL-4- YL]OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE C17 H20 N5 O7 P	HUMAN ARGONAUTE-2 BOUND TO A GUIDE RNA WITH A NUCLEOBASE MOD AT POSITION 1 MIR-122, PROTEIN ARGONAUTE-2 HYDROLASE/RNA ARGONAUTE, MIRNA, RNAI, HYDROLASE-RNA COMPLEX

70U    5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
3t1h	prot-nuc 3.11	5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE C12 H17 N2 O10 P S	STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT WITH A HUMAN ANTI-CODON STEM LOOP (HASL) OF TRANSFER RNA LY (TRNALYS3) BOUND TO AN MRNA WITH AN AAA-CODON IN THE A-SITE PAROMOMYCIN 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, TRNA ASL HUMAN LYS3, MRNA A-SITE FRAGMENT, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC PROTEIN SYNTHESIS, TRNA, RIBOSOME-ANTIBIOTIC COMPLEX
3t1y	prot-nuc 2.80	5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE C12 H17 N2 O10 P S	STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT WITH A HUMAN ANTI-CODON STEM LOOP (HASL) OF TRANSFER RNA LY (TRNALYS3) BOUND TO AN MRNA WITH AN AAG-CODON IN THE A-SITE PAROMOMYCIN 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, TRNA ASL HUMAN LYS3, MRNA A-SITE FRAGMENT, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME/ANTIBIOTIC PROTEIN SYNTHESIS, TRNA, RIBOSOME-ANTIBIOTIC COMPLEX
4x62	prot-nuc 3.45	5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE C12 H17 N2 O10 P S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), RNA (5'-D(*AP*AP*AP*UP*UP*U)-3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x64	prot-nuc 3.35	5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE C12 H17 N2 O10 P S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, RNA (5'-D(*(MA6)P*AP*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x65	prot-nuc 3.35	5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE C12 H17 N2 O10 P S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, RNA (5'-D(*AP*(MA6)P*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x66	prot-nuc 3.45	5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE C12 H17 N2 O10 P S	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(*AP*AP*(MA6)P*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX

72J    7-(N-(10-HYDROXYDECANOYL)-AMINOPENTENYL)-7-DEAZA-2'- DATP

Code	Class Resolution	Description
5szt	prot-nuc 1.80	7-(N-(10-HYDROXYDECANOYL)-AMINOPENTENYL)-7-DEAZA-2'- DATP C26 H44 N5 O14 P3	CRYSTAL STRUCTURE OF THE LARGE FRAGMENT OF DNA POLYMERASE I THERMUS AQUATICUS IN A CLOSED TERNARY COMPLEX WITH 7-(N-(10 HYDROXYDECANOYL)-AMINOPENTENYL)-7-DEAZA-2'-DATP DNA (5'-D(*AP*AP*AP*TP*GP*GP*CP*GP*CP*CP*GP*TP*GP 3'), DNA (5'-D(*GP*AP*CP*CP*AP*CP*GP*GP*CP*GP*CP*(DOC) CHAIN: B, DNA POLYMERASE I, THERMOSTABLE TRANSFERASE LINKER-MODIFIED NUCLEOTIDE, KLENTAQ, DNA POLYMERASE, TRANSFE

73W    5'-O-[(DITHIOPHOSPHONO)]CYTIDINE

Code	Class Resolution	Description
5t16	prot-nuc 2.78	5'-O-[(DITHIOPHOSPHONO)]CYTIDINE 4(C9 H14 N3 O6 P S2)	CRYSTAL STRUCTURE OF YEAST RNASE III (RNT1P) COMPLEXED WITH HYDROLYZABLE RNA SUBSTRATE ANALOG RIBONUCLEASE 3: UNP RESIDUES 184-499, RNA SUBSTRATE ANALOG, RIBONUCLEASE 3: UNP RESIDUES 41-199 HYDROLASE/RNA RNT1P, RNASE III, SUBSTRATE-LOADED COMPLEX, HYDROLASE-RNA CO

773    CETHROMYCIN

Code	Class Resolution	Description
1nwx	prot-nuc 3.50	CETHROMYCIN C42 H59 N3 O10	COMPLEX OF THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS WITH ABT-773 RIBOSOMAL PROTEIN L6, RIBOSOMAL PROTEIN L18, RIBOSOMAL PROTEIN L21, RIBOSOMAL PROTEIN L5, RIBOSOMAL PROTEIN L3, 23S RIBOSOMAL RNA, RIBOSOMAL PROTEIN L36, RIBOSOMAL PROTEIN L30, RIBOSOMAL PROTEIN L9, RIBOSOMAL PROTEIN L16, RIBOSOMAL PROTEIN L34, RIBOSOMAL PROTEIN L35, RIBOSOMAL PROTEIN L23, RIBOSOMAL PROTEIN L24, RIBOSOMAL PROTEIN L22, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L17, RIBOSOMAL PROTEIN L15, 5S RIBOSOMAL RNA, RIBOSOMAL PROTEIN L33, RIBOSOMAL PROTEIN L20, RIBOSOMAL PROTEIN L32, GENERAL STRESS PROTEIN CTC, RIBOSOMAL PROTEIN L27, RIBOSOMAL PROTEIN L14, RIBOSOMAL PROTEIN L19, RIBOSOMAL PROTEIN L13, RIBOSOMAL PROTEIN L29, RIBOSOMAL PROTEIN L31, RIBOSOMAL PROTEIN L4 RIBOSOME ABT-773, MACROLIDE, KETOLIDE, RIBOSOME, 50S, RIBOSOMAL SUBUNIT

77Y    5-(3-(2-(1H-INDOL-3-YL)ACETAMIDE-N-YL)-1-PROPEN-1-YL)- 2'-DEOXYURIDINE

Code	Class Resolution	Description
5luw	prot-nuc 1.69	5-(3-(2-(1H-INDOL-3-YL)ACETAMIDE-N-YL)-1-PROPEN-1-YL)- 2'-DEOXYURIDINE C22 H25 N4 O9 P	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN ALPHA-THROMBIN MODIFIED 15-MER DNA APTAMER CONTAINING 5-(3-(2-(1H-INDOL-3- ACETAMIDE-N-YL)-1-PROPEN-1-YL)-2'-DEOXYURIDINE RESIDUE GA63A - TBA MODIFIED APTAMER, PROTHROMBIN, PROTHROMBIN HYDROLASE/DNA ALPHA THROMBIN, APTAMER, THROMBIN-MTBA, COMPLEX, HYDROLASE-D COMPLEX

7BG    2-AMINO-7-BENZYL-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO- BETA-D-ARABINOFURANOSYL)-6-OXO-6,9-DIHYDRO-1H-PURIN-7- IUM

Code	Class Resolution	Description
4ymm	prot-nuc 2.20	2-AMINO-7-BENZYL-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO- BETA-D-ARABINOFURANOSYL)-6-OXO-6,9-DIHYDRO-1H-PURIN-7- IUM C17 H20 F N5 O7 P 1+	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH 7BG AS TEMPLATE BASE IN A 1-NUCLEOTIDE GAPPED DNA DNA POLYMERASE BETA, DNA 5-MER (DN-PRIMER), DNA 10-MER (UP-PRIMER), DNA 16-MER (TEMPLATE) TRANSFERASE/DNA DNA POLYMERASE, TRANSFERASE-DNA COMPLEX
4ymn	prot-nuc 2.59	2-AMINO-7-BENZYL-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO- BETA-D-ARABINOFURANOSYL)-6-OXO-6,9-DIHYDRO-1H-PURIN-7- IUM C17 H20 F N5 O7 P 1+	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH N7BG I TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP DNA 10-MER (UP-PRIMER), DNA 16-MER (TEMPLATE), DNA 5-MER (DN-PRIMER), DNA POLYMERASE BETA TRANSFERASE/DNA HUMAN DNA POLYMERASE BETA, TRANSFERASE-DNA COMPLEX
4ymo	prot-nuc 2.15	2-AMINO-7-BENZYL-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO- BETA-D-ARABINOFURANOSYL)-6-OXO-6,9-DIHYDRO-1H-PURIN-7- IUM C17 H20 F N5 O7 P 1+	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH N7BG I TEMPLATE OPPOSITE TO INCOMING NON-HYDROLYZABLE CTP WITH MAN THE ACTIVE SITE DNA 10-MER (UP-PRIMER), DNA 16-MER (TEMPLATE), DNA POLYMERASE BETA, DNA 5-MER (DN-PRIMER) TRANSFERASE/DNA HUMAN DNA POLYMERASE BETA, TRANSFERASE-DNA COMPLEX
4yn4	prot-nuc 2.24	2-AMINO-7-BENZYL-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO- BETA-D-ARABINOFURANOSYL)-6-OXO-6,9-DIHYDRO-1H-PURIN-7- IUM C17 H20 F N5 O7 P 1+	STRUCTURE OF HUMAN DNA POLYMERASE BETA COMPLEXED WITH N7BG I TEMPLATE OPPOSITE TO INCOMING NON-HYDROLYZABLE DTTP WITH MA THE ACTIVE SITE DNA 16-MER (TEMPLATE), DNA 10-MER (UP-PRIMER), DNA 5-MER (DN-PRIMER), DNA POLYMERASE BETA TRANSFERASE/DNA HUMAN DNA POLYMERASE BETA, TRANSFERASE-DNA COMPLEX

7DA    7-DEAZA-2'-DEOXYADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1u1k	prot-nuc 2.00	7-DEAZA-2'-DEOXYADENOSINE-5'-MONOPHOSPHATE C11 H15 N4 O6 P	CRYSTAL STRUCTURE OF UP1 COMPLEXED WITH D(TTAGGGTT 7DA GGG); A HUMAN TELOMERIC REPEAT CONTAINING 7-DEAZA-ADENINE 5'-D(*TP*AP*GP*GP*GP*TP*TP*(7DA)P*GP*GP*G)-3', HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A1 TRANSPORT PROTEIN/DNA PROTEIN-DNA COMPLEX, UP1, HUMAN TELOMERIC REPEAT, HTR, TR2- A(9)7DA, RRM, RNA RECOGNITION MOTIF, 7DA, 7-DEAZA-ADENINE, HNRNP A1, TRANSPORT PROTEIN/DNA COMPLEX

7GU    7-DEAZA-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1u1m	prot-nuc 2.00	7-DEAZA-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C11 H15 N4 O7 P	CRYSTAL STRUCTURE OF UP1 COMPLEXED WITH D(TTAGGGTTA 7GU GG); A HUMAN TELOMERIC REPEAT CONTAINING 7-DEAZA-GUANINE 5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*(7GU)P*GP*G)-3', HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A1 TRANSPORT PROTEIN/DNA PROTEIN-DNA COMPLEX, UP1, HUMAN TELOMERIC REPEAT, HTR, TR2- G(10)7GU, RRM, RNA RECOGNITION MOTIF, 7GU, 7-DEAZA-GUANINE, HNRNP A1, TRANSPORT PROTEIN/DNA COMPLEX
1yqm	prot-nuc 2.50	7-DEAZA-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C11 H15 N4 O7 P	CATALYTICALLY INACTIVE HUMAN 8-OXOGUANINE GLYCOSYLASE CROSSLINKED TO 7-DEAZAGUANINE CONTAINING DNA 5'-D(P*GP*TP*CP*CP*AP*(7GU)P*GP*TP*CP*TP*AP*C)- 3', N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, 5'-D(P*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*C)-3' HYDROLASE/DNA DISULFIDE CROSSLINKING, 8-OXOG ANALOG, HYDROLASE/DNA COMPLEX

7MG    7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1ip8	prot-nuc model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS IN THE PRE- TRANSLOCATIONAL STATE RIBOSOMAL PROTEIN L11, ELONGATION FACTOR G, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA RIBOSOME POSSIBLE INTERACTION BETWEEN SMALL AND LARGE RIBOSOMAL RNAS, MRNA AND TRNAS
1ipm	prot-nuc model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS ELONGATION FACTOR G, ELONGATION FACTOR TU, TRNAS BOUND TO A, P, AND R SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3', NASCENT POLYPEPTIDE, 23S RIBOSOMAL RNA, 16S RIBOSOMAL RNA TRANSLATION/RNA CODON RECOGNITION, SMALL RIBOSOMAL RNA, LARGE RIBOSOMAL RNA, MRNA, TRNA, EF-G, EF-TU
1jgo	prot-nuc 5.60	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, MESSENGER RNA MK27, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S11, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgp	prot-nuc 7.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, TRNA(PHE), 30S RIBOSOMAL PROTEIN S6, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S8, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MV36, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S2 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1jgq	prot-nuc 5.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE PATH OF MESSENGER RNA THROUGH THE RIBOSOME. THIS FILE, 1 CONTAINS THE 30S RIBOSOME SUBUNIT, THREE TRNA, AND MRNA MOL 50S RIBOSOME SUBUNIT IS IN THE FILE 1GIY 30S RIBOSOMAL PROTEIN S5, 30S 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, MESSENGER RNA MF36, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S7, TRNA(PHE), 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S4, TRNA(PHE), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S15 RIBOSOME RIBOSOME ASSEMBLY, PROTEIN SYNTHESIS, LIFE, RIBOSOME
1l1u	prot-nuc model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	TERNARY COMPLEX DOCKED IN THE DECODING SITE OF THE 30S RIBOSOMAL SUBUNIT 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S9, 5'-STACKED TRNA, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN THX, ELONGATION FACTOR TU, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S13, MESSENGER RNA IN THE D-SITE/ASITE, P-SITE AND E- SITE ON THE 30S RIBOSOME, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S7, 50S RIBOSOMAL PROTEIN L7/L12, 30S RIBOSOMAL PROTEIN S3, 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S6 RIBOSOME TRNA, 5'-STACK, ANTICODON, DECODING, ELONGATION, PROTEIN SYNTHESIS, TRANSORIENTATION
1mj1	prot-nuc 13.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	FITTING THE TERNARY COMPLEX OF EF-TU/TRNA/GTP AND RIBOSOMAL INTO A 13 A CRYO-EM MAP OF THE COLI 70S RIBOSOME S12 RIBOSOMAL PROTEIN, HELIX 69 OF 23S RRNA, SARCIN-RICIN LOOP OF 23SRRNA, PHE-TRNA, ELONGATION FACTOR TU, S13 RIBOSOMAL PROTEIN, L11 RIBOSOMAL PROTEIN RIBOSOME 70S RIBOSOME, LOW RESOLUTION MODEL TERNARY COMPLEX, EF-TU, R
1ml5	prot-nuc 14.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	STRUCTURE OF THE E. COLI RIBOSOMAL TERMINATION COMPLEX WITH FACTOR 2 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN THX, 50S 5S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S19, 50S RIBOSOMAL PROTEIN L22, 50S RIBOSOMAL PROTEIN L16, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S4, 50S RIBOSOMAL PROTEIN L25, 50S RIBOSOMAL PROTEIN L13, T-RNA(PHE), 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S14, A- AND P-SITE MESSENGER RNA CODONS, 50S RIBOSOMAL PROTEIN L18, 30S RIBOSOMAL PROTEIN S16, 50S RIBOSOMAL PROTEIN L19, 30S RIBOSOMAL PROTEIN S15, 50S RIBOSOMAL PROTEIN L1, 50S RIBOSOMAL PROTEIN L14, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 50S RIBOSOMAL PROTEIN L2, 50S RIBOSOMAL PROTEIN L24, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 50S RIBOSOMAL PROTEIN L5, 50S 23S RIBOSOMAL RNA, 30S 16S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L3, 50S RIBOSOMAL PROTEIN L4, 30S RIBOSOMAL PROTEIN S8, 50S RIBOSOMAL PROTEIN L15, 30S RIBOSOMAL PROTEIN S10, 50S RIBOSOMAL PROTEIN L30, 30S RIBOSOMAL PROTEIN S2, 50S RIBOSOMAL PROTEIN L23, 50S RIBOSOMAL PROTEIN L6, 50S RIBOSOMAL PROTEIN L29, PEPTIDE CHAIN RELEASE FACTOR 2, 30S RIBOSOMAL PROTEIN S13 RIBOSOME E. COLI, RIBOSOME, TERMINATION OF PROTEIN SYNTHESIS, RELEASE CRYO-ELETRON MICROSCOPY, ANGULAR RECONSTITUTION
1ob2	prot-nuc 3.35	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	E. COLI ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC KIRROMYCIN, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE/NUCLEAR PROTEIN HYDROLASE/NUCLEAR PROTEIN, HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA
1ob5	prot-nuc 3.10	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 3(C11 H18 N5 O8 P1)	T. AQUATICUS ELONGATION FACTOR EF-TU COMPLEXED WITH THE ANTIBIOTIC ENACYLOXIN IIA, A GTP ANALOG, AND PHE-TRNA ELONGATION FACTOR TU, TRANSFER-RNA, PHE HYDROLASE HYDROLASE, GTPASE, TRANSLATION ELONGATION FACTOR, TRANSFER RNA, GTP-BINDING, NUCLEOTIDE-BINDING, PROTEIN BIOSYNTHESIS
1sz1	prot-nuc 6.21	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	MECHANISM OF CCA-ADDING ENZYMES SPECIFICITY REVEALED BY CRYS STRUCTURES OF TERNARY COMPLEXES TRNA NUCLEOTIDYLTRANSFERASE, T-RNA (76-MER) TRANSFERASE/RNA CCA-ADDING ENZYME, SPECIFICITY, TRNA, COMPLEX, TRANSFERASE-R COMPLEX
1ttt	prot-nuc 2.70	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 3(C11 H18 N5 O8 P)	PHE-TRNA, ELONGATION FACTOR EF-TU:GDPNP TERNARY COMPLEX OF ELONGATION FACTOR TU (EF-TU), TRANSFER RIBONUCLEIC ACID (YEAST, PHE) COMPLEX (ELONGATION FACTOR/TRNA) PROTEIN SYNTHESIS, EF-TU, TRNA, RIBOSOME, 1EFT, 4TNA, PEPTID ELONGATION RIBONUCLEOPROTEIN, COMPLEX (ELONGATION FACTOR-TR COMPLEX (ELONGATION FACTOR-TRNA) COMPLEX
3deg	prot-nuc 10.90	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	COMPLEX OF ELONGATING ESCHERICHIA COLI 70S RIBOSOME AND EF4( GMPPNP 50S RNA HELIX 42-44, 30S RIBOSOMAL PROTEIN S12, 50S RIBOSOMAL PROTEIN L11, 30S RNA HELIX 8, P-TRNA, GTP-BINDING PROTEIN LEPA: EF4, 50S RNA HELIX 92, A/L-TRNA, 30S RNA HELIX 14, 50S RNA HELIX 95, 50S RNA HELIX 71 RIBOSOME RIBOSOME, TRANSLATION, LEPA, EF4, GTP-BINDING, MEMBRANE, NUC BINDING, ANTIBIOTIC RESISTANCE, RIBONUCLEOPROTEIN, RIBOSOMA PROTEIN, RNA-BINDING, RRNA-BINDING, TRNA-BINDING, METHYLATI
4cxg	prot-nuc 8.70	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT ROLLING: A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 18S RRNA - H44, 40S RIBOSOMAL PROTEIN US12, TRANSFER RNA, 28S RRNA - H95, 28S RRNA - H89, ELONGATION FACTOR 1A, MESSENGER RNA, 18S RRNA - H8, 18S RRNA - H5-H14 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX
4cxh	prot-nuc 8.90	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	REGULATION OF THE MAMMALIAN ELONGATION CYCLE BY 40S SUBUNIT A EUKARYOTIC-SPECIFIC RIBOSOME REARRANGEMENT 28S RRNA - H95, TRANSFER RNA, 40S RIBOSOMAL PROTEIN US12, 18S RRNA - H44, 18S RRNA - H8, 18S RRNA - H5-H14, MESSENGER RNA, ELONGATION FACTOR 1A, 28S RRNA - H89 TRANSLATION TRANSLATION, MAMMALIAN 80S RIBOSOME, ELONGATION CYCLE, TRNA SELECTION, EUKARYOTIC TERNARY COMPLEX, ELONGATION FACTOR EE
4dr1	prot-nuc 3.60	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE APO 30S RIBOSOMAL SUBUNIT FROM THER THERMOPHILUS (HB8) 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dr2	prot-nuc 3.25	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr3	prot-nuc 3.35	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr4	prot-nuc 3.97	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, COGNATE TRANSFER RNA ANTICODON STEM-LOO MULTIPLE COPIES OF PAROMOMYCIN MOLECULES BOUND 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr5	prot-nuc 3.45	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED COGNATE RNA ANTICODON STEM-LOOP AND STREPTOMYCIN BOUND 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*U)-3', 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*UP*CP*CP*C CHAIN: W, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr6	prot-nuc 3.30	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, NEAR-COGNATE TRANSFER RNA ANTICODON STE MISMATCHED AT THE FIRST CODON POSITION AND STREPTOMYCIN BOU 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S11, 5'-R(*UP*UP*UP*U)-3', 5'-R(P*UP*UP*GP*AP*GP*GP*(PSU)P*GP*G)-3', 30S RIBOSOMAL PROTEIN S10, 5'-R(P*CP*UP*UP*GP*AP*GP*GP*(PSU)P*GP*GP*U)-3', 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 5'-R(*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dr7	prot-nuc 3.75	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS (HB8) 30S RIBO SUBUNIT WITH CODON, CRYSTALLOGRAPHICALLY DISORDERED NEAR-CO TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE SECOND C POSITION, AND STREPTOMYCIN BOUND 5'-R(P*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S11, 5'-R(*GP*CP*CP*UP*GP*GP*AP*AP*AP*GP*(PSU))-3', 5'-R(*UP*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S14, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S13, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S8, 5'-R(P*UP*UP*U)-3', 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4duy	prot-nuc 3.39	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4duz	prot-nuc 3.65	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U13C, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv0	prot-nuc 3.85	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv1	prot-nuc 3.85	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, U20G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv2	prot-nuc 3.65	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv3	prot-nuc 3.55	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, C912A, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv4	prot-nuc 3.65	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv5	prot-nuc 3.68	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A914G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4dv6	prot-nuc 3.30	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME
4dv7	prot-nuc 3.29	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL WITH A 16S RRNA MUTATION, A915G, BOUND WITH STREPTOMYCIN RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC DECODING, STREPTOMYCIN, RNA STRUCTURE, ANTIBIOTIC RESISTANCE RIBOSOME-ANTIBIOTIC COMPLEX
4ji0	prot-nuc 3.49	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji1	prot-nuc 3.14	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S13, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji2	prot-nuc 3.64	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji3	prot-nuc 3.35	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji4	prot-nuc 3.69	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji5	prot-nuc 3.85	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4ji6	prot-nuc 3.55	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji7	prot-nuc 3.50	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4ji8	prot-nuc 3.74	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT, RIBOSOME, STREPTOMYCIN, RNA STRUCTURE THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING, RIBOSOME-ANT COMPLEX
4kvb	prot-nuc 4.20	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	THERMUS THERMOPHILUS HB27 30S RIBOSOMAL SUBUNIT LACKING RIBO PROTEIN S17 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, TRANSLATION, 50S RIBOSOMAL SUBUNIT, R
4lf4	prot-nuc 3.34	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf5	prot-nuc 3.75	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf6	prot-nuc 3.31	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf7	prot-nuc 3.15	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf8	prot-nuc 3.15	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lf9	prot-nuc 3.28	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfa	prot-nuc 3.65	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfb	prot-nuc 3.01	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S18, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S4, 16S RRNA, RIBOSOMAL PROTEIN S8, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S5 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4lfc	prot-nuc 3.60	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER RIBOSOMAL PROTEIN S11, RIBOSOMAL PROTEIN S5, RIBOSOMAL PROTEIN S10, RIBOSOMAL PROTEIN S16, RIBOSOMAL PROTEIN S14, RIBOSOMAL PROTEIN S12, RIBOSOMAL PROTEIN S2, RIBOSOMAL PROTEIN S9, RIBOSOMAL PROTEIN S3, RIBOSOMAL PROTEIN S19, RIBOSOMAL PROTEIN THX, RIBOSOMAL PROTEIN S20, RIBOSOMAL PROTEIN S17, RIBOSOMAL PROTEIN S8, 16S RRNA, RIBOSOMAL PROTEIN S4, RIBOSOMAL PROTEIN S13, RIBOSOMAL PROTEIN S15, RIBOSOMAL PROTEIN S7, RIBOSOMAL PROTEIN S6, RIBOSOMAL PROTEIN S18 RIBOSOME 30S RIBOSOMAL SUBUNIT, RIBOSOME, KASUGAMYCIN, KSGA, RNA STRU THERMUS THERMOPHILUS, ANTIBIOTIC RESISTANCE, DECODING
4x62	prot-nuc 3.45	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 16S RRNA, 30S RIBOSOMAL PROTEIN S4, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), RNA (5'-D(*AP*AP*AP*UP*UP*U)-3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x64	prot-nuc 3.35	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, RNA (5'-D(*(MA6)P*AP*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x65	prot-nuc 3.35	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S5, RNA (5'-D(*AP*(MA6)P*AP*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S11, 30S RIBOSOMAL PROTEIN S17, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX
4x66	prot-nuc 3.45	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF 30S RIBOSOMAL SUBUNIT FROM THERMUS THER 30S RIBOSOMAL PROTEIN S8, 30S RIBOSOMAL PROTEIN S4, 16S RRNA, 30S RIBOSOMAL PROTEIN S13, 30S RIBOSOMAL PROTEIN S7, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S6, 30S RIBOSOMAL PROTEIN S18, 30S RIBOSOMAL PROTEIN S11, RNA (5'-D(*AP*AP*(MA6)P*UP*UP*U)-3'), RNA (5'-D(P*GP*AP*CP*UP*(70U)P*UP*UP*(12A)P*AP*(P 3'), 30S RIBOSOMAL PROTEIN S5, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S16, 30S RIBOSOMAL PROTEIN S9, 30S RIBOSOMAL PROTEIN S12, 30S RIBOSOMAL PROTEIN S14 TYPE Z, 30S RIBOSOMAL PROTEIN S2, 30S RIBOSOMAL PROTEIN S19, 30S RIBOSOMAL PROTEIN S3, 30S RIBOSOMAL PROTEIN THX, 30S RIBOSOMAL PROTEIN S20, 30S RIBOSOMAL PROTEIN S17 RIBOSOME/ANTIBIOTIC 30S RIBOSOMAL SUBUNIT M6A DECODING MRNA MODIFICATION, RIBOSO ANTIBIOTIC COMPLEX

7PE    2-(2-(2-(2-(2-(2-ETHOXYETHOXY)ETHOXY)ETHOXY)ETHOXY) ETHOXY)ETHANOL

Code	Class Resolution	Description
3v20	prot-nuc 2.35	2-(2-(2-(2-(2-(2-ETHOXYETHOXY)ETHOXY)ETHOXY)ETHOXY) ETHOXY)ETHANOL C14 H30 O7	CRYSTAL STRUCTURE OF TYPE IIF RESTRICTION ENDONUCLEASE BSE63 COGNATE DNA DNA (5'-D(*TP*CP*GP*CP*AP*CP*CP*GP*GP*TP*GP*CP*G) CHAIN: C, D, ENDONUCLEASE BSE634IR DNA BINDING PROTEIN, HYDROLASE/DNA RESTRICTION ENDONUCLEASE, PROTEIN-DNA COMPLEX, HYDROLASE, DN PROTEIN, HYDROLASE-DNA COMPLEX
5f7q	prot-nuc 2.40	2-(2-(2-(2-(2-(2-ETHOXYETHOXY)ETHOXY)ETHOXY)ETHOXY) ETHOXY)ETHANOL 2(C14 H30 O7)	ROK REPRESSOR LMO0178 FROM LISTERIA MONOCYTOGENES BOUND TO O OPERATOR, OPERATOR, LMO0178 PROTEIN TRANSCRIPTION/DNA REPRESSOR, OPEN READING FRAME, KINASE, STRUCTURAL GENOMICS, FOR STRUCTURAL GENOMICS OF INFECTIOUS DISEASES, CSGID, TRANSCRIPTION-DNA COMPLEX

84T    [(2S,4S,5R)-5-(6-AMINOPURIN-9-YL)-4-OXIDANYL- OXOLAN-2-YL]METHOXY-N-[(2S,3R)-4-METHYL-2,3- BIS(OXIDANYL)PENTANOYL]PHOSPHONAMIDIC ACID

Code	Class Resolution	Description
3zgz	prot-nuc 2.40	[(2S,4S,5R)-5-(6-AMINOPURIN-9-YL)-4-OXIDANYL- OXOLAN-2-YL]METHOXY-N-[(2S,3R)-4-METHYL-2,3- BIS(OXIDANYL)PENTANOYL]PHOSPHONAMIDIC ACID 2(C16 H25 N6 O8 P)	TERNARY COMPLEX OF E. COLI LEUCYL-TRNA SYNTHETASE, TRNA(LEU) AND TOXIC MOIETY FROM AGROCIN 84 (TM84) IN AMINOACYLATION- LIKE CONFORMATION LEUCINE--TRNA LIGASE, TRNA-LEU UAA ISOACCEPTOR LIGASE/RNA LIGASE-RNA COMPLEX, LIGASE, NUCLEOTIDE(ATP)-BINDING, PROTEIN BIOSYNTHESIS, CLASS I AMINOACYL-TRNA SYNTHETASE

88D    N-(2-METHYLPHENYL)-NALPHA-(SELENOPHENE-2-CARBONYL)-D- PHENYLALANINAMIDE

Code	Class Resolution	Description
5uhf	prot-nuc 4.35	N-(2-METHYLPHENYL)-NALPHA-(SELENOPHENE-2-CARBONYL)-D- PHENYLALANINAMIDE C21 H20 N2 O2 SE	CRYSTAL STRUCTURE OF MYCOBACTERIUM TUBERCULOSIS TRANSCRIPTIO INITIATION COMPLEX IN COMPLEX WITH D-IX336 DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, RNA POLYMERASE SIGMA FACTOR SIGA, DNA (5'- D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*TP*CP*AP*CP*GP G)-3'), DNA (5'-D(*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP*CP*CP 3'), DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA TRANSCRIPTION/DNA/RNA RNA POLYMERASE COMPLEX, TRANSCRIPTION, DNA, RNA, TRANSCRIPTI RNA COMPLEX

88G    NALPHA-(BENZENECARBONYL)-N-(2-METHYLPHENYL)-D- PHENYLALANINAMIDE

Code	Class Resolution	Description
5uhe	prot-nuc 4.04	NALPHA-(BENZENECARBONYL)-N-(2-METHYLPHENYL)-D- PHENYLALANINAMIDE C23 H22 N2 O2	CRYSTAL STRUCTURE OF MYCOBACTERIUM TUBERCULOSIS TRANSCRIPTIO INITIATION COMPLEX IN COMPLEX WITH D-AAP1 DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', RNA POLYMERASE SIGMA FACTOR SIGA, DNA (5'-D(*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP*CP*CP 3'), DNA (5'- D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*TP*CP*AP*CP*GP G)-3'), DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA TRANSCRIPTION/DNA/RNA RNA POLYMERASE COMPLEX, TRANSCRIPTION, DNA, RNA, TRANSCRIPTI RNA COMPLEX
5uhg	prot-nuc 3.97	NALPHA-(BENZENECARBONYL)-N-(2-METHYLPHENYL)-D- PHENYLALANINAMIDE C23 H22 N2 O2	CRYSTAL STRUCTURE OF MYCOBACTERIUM TUBERCULOSIS TRANSCRIPTIO INITIATION COMPLEX IN COMPLEX WITH D-AAP1 AND RIFAMPIN DNA (5'- D(*TP*AP*TP*AP*AP*TP*GP*GP*GP*AP*GP*CP*TP*GP*TP*CP*AP*CP*GP G)-3'), DNA (5'-D(*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP*CP*CP 3'), DNA-DIRECTED RNA POLYMERASE SUBUNIT OMEGA, DNA-DIRECTED RNA POLYMERASE SUBUNIT ALPHA, DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA', DNA-DIRECTED RNA POLYMERASE SUBUNIT BETA, RNA POLYMERASE SIGMA FACTOR SIGA TRANSCRIPTION/DNA/RNA RNA POLYMERASE COMPLEX, TRANSCRIPTION, DNA, RNA, TRANSCRIPTI RNA COMPLEX, ANTIBIOTIC

8AA    8-[ACETYL(ANTHRACEN-2-YL)AMINO]-2'-DEOXY-5'- O-(DIHYDROXYPHOSPHANYL)GUANOSINE

Code	Class Resolution	Description
5g34	prot-nuc 1.90	8-[ACETYL(ANTHRACEN-2-YL)AMINO]-2'-DEOXY-5'- O-(DIHYDROXYPHOSPHANYL)GUANOSINE 2(C26 H25 N6 O7 P)	STRUCTURE OF RAD14 IN COMPLEX WITH ACETYLAMINOANTHRACENE-C8- GUANINE CONTAINING DNA 5'-D(*GP*CP*TP*CP*TP*AP*6FKP*TP*CP*AP*TP*CP*AP*CP CHAIN: C, E, 5'-D(*GP*TP*GP*AP*TP*GP*AP*CP*GP*TP*AP*GP*AP*GP)- CHAIN: D, F, RAD14: UNP RESIDUES 188-306 CELL CYCLE CELL CYCLE, DNA REPAIR, NUCLEOTIDE EXCISION REPAIR

8AF    [(2~{R},3~{S},5~{R})-5-[2-AZANYL-8-(9~{H}-FLUOREN-3- YLAMINO)-6-OXIDANYLIDENE-3~{H}-PURIN-9-YL]-3-OXIDANYL- OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHITE

Code	Class Resolution	Description
5lcl	prot-nuc 2.20	[(2~{R},3~{S},5~{R})-5-[2-AZANYL-8-(9~{H}-FLUOREN-3- YLAMINO)-6-OXIDANYLIDENE-3~{H}-PURIN-9-YL]-3-OXIDANYL- OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHITE C23 H23 N6 O6 P	STRUCTURE OF THE RAD14 DNA-BINDING DOMAIN IN COMPLEX WITH C8 AMINOFLUORENE- GUANINE CONTAINING DNA DNA REPAIR PROTEIN RAD14, DNA (5'-D(*GP*TP*GP*AP*TP*GP*AP*CP*GP*TP*AP*GP*AP CHAIN: D, GCTCTAC(8AF)TCATCA, DNA REPAIR PROTEIN RAD14 DNA BINDING PROTEIN NUCLEOTIDE EXCISION REPAIR DNA DAMAGE RECOGNITION, DNA BINDI PROTEIN

8AG    8-[ACETYL(ANTHRACEN-2-YL)AMINO]-2'- DEOXYGUANOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2xgq	prot-nuc 2.70	8-[ACETYL(ANTHRACEN-2-YL)AMINO]-2'- DEOXYGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 2(C26 H27 N6 O8 P)	STRUCTURE OF YEAST DNA POLYMERASE ETA IN COMPLEX WITH C8-N- ACETYL-2-AMINOANTHRACENE CONTAINING DNA 5'-D(*GP*TP*GP*GP*AP*TP*GP*AP*G)-3', 5'-D(*CP*8AG*CP*TP*CP*AP*TP*CP*CP*AP*C)-3', DNA POLYMERASE ETA: RESIDUES 1-513 TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX, TRANSLESION DNA SYNTHESIS, DNA-BIND DAMAGE

8AN    3'-AMINO-3'-DEOXYADENOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
3cma	prot-nuc 2.80	3'-AMINO-3'-DEOXYADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C10 H15 N6 O6 P	THE STRUCTURE OF CCA AND CCA-PHE-CAP-BIO BOUND TO THE LARGE SUBUNIT OF HALOARCULA MARISMORTUI 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L32E, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L15E, 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L10E, RNA (5'-R(*CP*CP*A)-3'), 50S RIBOSOMAL PROTEIN L7AE, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L39E, RNA (5'-R(*CP*CP*(8AN))-3') RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, PEPTIDYL-TRNA HYDROLYSIS, RIBOSOME
3cme	prot-nuc 2.95	3'-AMINO-3'-DEOXYADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C10 H15 N6 O6 P	THE STRUCTURE OF CA AND CCA-PHE-CAP-BIO BOUND TO THE LARGE R SUBUNIT OF HALOARCULA MARISMORTUI 50S RIBOSOMAL PROTEIN L30P, 50S RIBOSOMAL PROTEIN L29P, 50S RIBOSOMAL PROTEIN L14P, 50S RIBOSOMAL PROTEIN L19E, 50S RIBOSOMAL PROTEIN L31E, 50S RIBOSOMAL PROTEIN L13P, 50S RIBOSOMAL PROTEIN L6P, 50S RIBOSOMAL PROTEIN L37AE, 50S RIBOSOMAL PROTEIN L24P, 50S RIBOSOMAL PROTEIN L24E, 50S RIBOSOMAL PROTEIN L4P, 50S RIBOSOMAL PROTEIN L23P, 50S RIBOSOMAL PROTEIN L18P, 50S RIBOSOMAL PROTEIN L15P, 50S RIBOSOMAL PROTEIN L3P, 50S RIBOSOMAL PROTEIN L11P, 50S RIBOSOMAL PROTEIN L39E, RNA (5'-R(*CP*CP*(8AN))-3'), 50S RIBOSOMAL PROTEIN L21E, 50S RIBOSOMAL PROTEIN L37E, 50S RIBOSOMAL PROTEIN L2P, 50S RIBOSOMAL PROTEIN L5P, 50S RIBOSOMAL PROTEIN L32E, 5S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L15E, 50S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L44E, RNA (5'-R(*C*CP*A)-3'), 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L18E, 50S RIBOSOMAL PROTEIN L22P, 50S RIBOSOMAL PROTEIN L7AE RIBOSOME RIBOSOME 50S, PROTEIN-PROTEIN COMPLEX, RNA-RNA COMPLEX, PROT COMPLEX, HYDROLYSIS OF PEPTIDYL-TRNA, RIBOSOME

8AZ    8-AZA-NEBULARINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
5ed1	prot-nuc 2.77	8-AZA-NEBULARINE-5'-MONOPHOSPHATE C9 H14 N5 O8 P	HUMAN ADENOSINE DEAMINASE ACTING ON DSRNA (ADAR2) MUTANT E48 TO DSRNA SEQUENCE DERIVED FROM S. CEREVISIAE BDF2 GENE RNA (5'-R(*UP*UP*CP*CP*CP*CP*AP*CP*AP*UP*UP*(8AZ) P*GP*AP*CP*GP*UP*UP*CP*AP*GP*UP*C)-3'), RNA (5'- R(*GP*AP*CP*UP*GP*AP*AP*CP*GP*AP*CP*CP*AP*AP*UP*GP*UP*GP*GP A)-3'), DOUBLE-STRANDED RNA-SPECIFIC EDITASE 1: A TO I EDITASE (UNP RESIDUES 327-729) HYDROLASE/RNA DEAMINASE, HUMAN, HYDROLASE-RNA COMPLEX
5ed2	prot-nuc 2.95	8-AZA-NEBULARINE-5'-MONOPHOSPHATE 2(C9 H14 N5 O8 P)	HUMAN ADENOSINE DEAMINASE ACTING ON DSRNA (ADAR2) MUTANT E48 TO DSRNA SEQUENCE DERIVED FROM HUMAN GLI1 GENE RNA (5'-R(P*GP*CP*UP*CP*GP*CP*GP*AP*UP*GP*CP*UP*( P*GP*AP*GP*GP*GP*CP*UP*CP*UP*G)-3'), RNA (5'- R(P*CP*AP*GP*AP*GP*CP*CP*CP*CP*CP*CP*AP*GP*CP*AP*UP*CP*GP*C *C)-3'), DOUBLE-STRANDED RNA-SPECIFIC EDITASE 1: A TO I EDITASE (UNP RESIDUES 327-729) HYDROLASE/RNA DEAMINASE, HUMAN, HYDROLASE-RNA COMPLEX
5hp2	prot-nuc 2.98	8-AZA-NEBULARINE-5'-MONOPHOSPHATE C9 H14 N5 O8 P	HUMAN ADENOSINE DEAMINASE ACTING ON DSRNA (ADAR2) BOUND TO D SEQUENCE DERIVED FROM S. CEREVISIAE BDF2 GENE WITH AU BASEP REACTION SITE DOUBLE-STRANDED RNA-SPECIFIC EDITASE 1: UNP RESIDUES 299-701, RNA (5'- R(*GP*AP*CP*UP*GP*AP*AP*CP*GP*AP*CP*UP*AP*AP*UP*GP*UP*GP*GP A)-3'), RNA (5'-R(*UP*UP*CP*CP*CP*CP*AP*CP*AP*UP*UP*(8AZ) P*GP*AP*CP*GP*UP*UP*CP*AP*GP*UP*C)-3') HYDROLASE/RNA DEAMINASE, HUMAN, HYDROLASE-RNA COMPLEX
5hp3	prot-nuc 3.09	8-AZA-NEBULARINE-5'-MONOPHOSPHATE C9 H14 N5 O8 P	HUMAN ADENOSINE DEAMINASE ACTING ON DSRNA (ADAR2) BOUND TO D SEQUENCE DERIVED FROM S. CEREVISIAE BDF2 GENE WITH AC MISMA REACTION SITE RNA (5'- R(*GP*AP*CP*UP*GP*AP*AP*CP*GP*AP*CP*CP*AP*AP*UP*GP*UP*GP*GP A)-3'), RNA (5'-R(*UP*UP*CP*CP*CP*CP*AP*CP*AP*UP*UP*(8AZ) P*GP*AP*CP*GP*UP*UP*CP*AP*GP*UP*C)-3'), DOUBLE-STRANDED RNA-SPECIFIC EDITASE 1: UNP RESIDUES 299-701 HYDROLASE/RNA DEAMINASE, HUMAN, HYDROLASE-RNA COMPLEX

8B4    (1S)-1-(4-AMINOIMIDAZO[2,1-F][1,2,4]TRIAZIN-7-YL)-1,4- ANHYDRO-2-DEOXY-2-FLUORO-5-O-[(S)- HYDROXY(PHOSPHONOOXY)PHOSPHORYL]-2-METHYL-D-RIBITOL

Code	Class Resolution	Description
5uj2	prot-nuc 2.90	(1S)-1-(4-AMINOIMIDAZO[2,1-F][1,2,4]TRIAZIN-7-YL)-1,4- ANHYDRO-2-DEOXY-2-FLUORO-5-O-[(S)- HYDROXY(PHOSPHONOOXY)PHOSPHORYL]-2-METHYL-D-RIBITOL C11 H16 F N5 O9 P2	CRYSTAL STRUCTURE OF HCV NS5B GENOTYPE 2A JFH-1 ISOLATE WITH E87Q C223H V321I MUTATIONS AND DELTA8 NETA HAIRPOIN LOOP DE COMPLEX WITH GS-639476 (DIPHSOHATE VERSION OF GS-9813), MN2 SYMMETRICAL PRIMER TEMPLATE 5'-AUAAAUUU RNA (5'-R(*AP*UP*AP*AP*AP*UP*UP*U)-3'), GENOME POLYPROTEIN IMMUNE SYSTEM/RNA HCV, VIRAL, NS5B, RDRP, RESISTANCE MUTATION, SOFOSBUVIR, SOV VIRUNON, GS7977-DP, GS-639476, TEMPLATE, PRIMER, IMMUNE SYS COMPLEX

8BA    8-BROMO-DEOXYADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
4i29	prot-nuc 2.20	8-BROMO-DEOXYADENOSINE-5'-MONOPHOSPHATE C10 H15 BR N5 O6 P	BINARY COMPLEX OF MOUSE TDT WITH SSDNA AND MN++ 5'-D(*AP*AP*(8BA)P*AP*A)-3', DNA NUCLEOTIDYLEXOTRANSFERASE: SEE REMARK 999 TRANSFERASE/DNA TERMINAL TRANSFERASE, TRANSFERASE-DNA COMPLEX

8DG    8-OXO-2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE

Code	Class Resolution	Description
3mby	prot-nuc 2.00	8-OXO-2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	TERNARY COMPLEX OF DNA POLYMERASE BETA WITH TEMPLATE BASE A 8OXODGTP IN THE ACTIVE SITE WITH A DIDEOXY TERMINATED PRIME DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(DOC))-3'), DNA (5'-D(*CP*CP*GP*AP*CP*AP*GP*CP*GP*CP*AP*TP*CP 3'), DNA POLYMERASE BETA, DNA (5'-D(P*GP*TP*CP*GP*G)-3') TRANSFERASE, LYASE/DNA NUCLEOTIDYL TRANSFERASE, DNA POLYMERASE, A:(SYN)8OXODGTP, A: TRANSVERSION, TRANSFERASE, LYASE-DNA COMPLEX
4uaw	prot-nuc 1.90	8-OXO-2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	DNA POLYMERASE BETA SUBSTRATE COMPLEX WITH A TEMPLATING ADEN INCOMING 8-OXODGTP, 0 S 5'-D(*CP*CP*GP*AP*CP*AP*GP*CP*GP*CP*AP*TP*CP*AP*G CHAIN: T, DNA POLYMERASE BETA, 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3', 5'-D(P*GP*TP*CP*GP*G)-3' TRANSFERASE, LYASE/DNA DNA POLYMERASE, TRANSFERASE, LYASE-DNA COMPLEX
4uaz	prot-nuc 1.88	8-OXO-2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	DNA POLYMERASE BETA REACTANT COMPLEX WITH A TEMPLATING ADENI INCOMING 8-OXODGTP, 20 S 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*CP*(8OG))-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*AP*GP*CP*GP*CP*AP*TP*CP*AP*G CHAIN: T, DNA POLYMERASE BETA TRANSFERASE, LYASE/DNA DNA POLYMERASE, TRANSFERASE, LYASE-DNA COMPLEX
4ub5	prot-nuc 2.15	8-OXO-2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	DNA POLYMERASE BETA SUBSTRATE COMPLEX WITH A TEMPLATING CYTO INCOMING 8-OXODGTP, AND MN2+, 5 S 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*CP*GP*CP*GP*CP*AP*TP*CP*AP*G CHAIN: T, DNA POLYMERASE BETA TRANSFERASE, LYASE/DNA DNA POLYMERASE, TRANSFERASE, LYASE-DNA COMPLEX
4ubb	prot-nuc 1.90	8-OXO-2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	DNA POLYMERASE BETA REACTANT COMPLEX WITH A TEMPLATING CYTOS INCOMING 8-OXODGTP, 40 S 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*CP*(8OG))-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*CP*GP*CP*GP*CP*AP*TP*CP*AP*G CHAIN: T, DNA POLYMERASE BETA TRANSFERASE, LYASE/DNA DNA POLYMERASE, TRANSFERASE, LYASE-DNA COMPLEX
4ubc	prot-nuc 2.00	8-OXO-2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	DNA POLYMERASE BETA SUBSTRATE COMPLEX WITH A TEMPLATING CYTO INCOMING 8-OXODGTP, 0 S 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*C)-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*CP*CP*GP*AP*CP*CP*GP*CP*GP*CP*AP*TP*CP*AP*G CHAIN: T, DNA POLYMERASE BETA TRANSFERASE, LYASE/DNA DNA POLYMERASE, TRANSFERASE, LYASE-DNA COMPLEX
4xa5	prot-nuc 1.90	8-OXO-2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE PRE-CATALYTIC TERNARY COMPLEX OF DN POLYMERASE LAMBDA WITH A TEMPLATING A AND AN INCOMING 8-OXO DOWNSTREAM PRIMER DNA (5'-D(P*GP*CP*CP*G)-3'), PRIMER DNA (5'-D(*CP*AP*GP*TP*AP*(DOC))-3'), TEMPLATE DNA (5'-D(*CP*GP*GP*CP*AP*GP*TP*AP*CP*TP CHAIN: T, DNA POLYMERASE LAMBDA TRANSFERASE/DNA DNA POLYMERASE LAMBDA, PROTEIN-DNA COMPLEX, HELIX-HAIRPIN-HE TRANSFERASE-DNA COMPLEX

8DT    5-(3-(ACETAMIDE-N-YL)-1-PROPEN-1-YL)-2'-DEOXYURIDINE

Code	Class Resolution	Description
5luy	prot-nuc 2.24	5-(3-(ACETAMIDE-N-YL)-1-PROPEN-1-YL)-2'-DEOXYURIDINE C14 H20 N3 O9 P	X-RAY STRUCTURE OF THE COMPLEX BETWEEN HUMAN ALPHA-THROMBIN MODIFIED 15-MER DNA APTAMER CONTAINING 5-(3-(ACETAMIDE-N-YL PROPEN-1-YL)-2'-DEOXYURIDINE RESIDUE PROTHROMBIN, PROTHROMBIN, GA68B2 - MODIFIED HUMAN THROMBIN BINDING APTAMER HYDROLASE/DNA ALPHA THROMBIN, APTAMER, THROMBIN-MTBA, COMPLEX, HYDROLASE-D COMPLEX

8FG    N-(5'-PHOSPHO-2'-DEOXYGUANOSIN-8-YL)-2- ACETYLAMINOFLUORENE

Code	Class Resolution	Description
1x9m	prot-nuc 2.10	N-(5'-PHOSPHO-2'-DEOXYGUANOSIN-8-YL)-2- ACETYLAMINOFLUORENE C25 H25 N6 O8 P	T7 DNA POLYMERASE IN COMPLEX WITH AN N-2- ACETYLAMINOFLUORENE-ADDUCTED DNA 5'- D(*GP*GP*AP*GP*AP*GP*TP*GP*AP*TP*TP*GP*GP*TP*AP*GP*TP*GP*TP *GP*AP*(2DT))-3', THIOREDOXIN 1, 5'-D(*CP*CP*CP*(8FG) P*AP*TP*CP*AP*CP*AP*CP*TP*AP*CP*CP*AP*AP*TP*CP*AP*CP*TP*CP* TP*CP*C)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA DNA PLOYMERASE, N-2-ACETYLAMINOFLUORENE, REPLICATION BLOCK, MUTAGENESIS, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
2xgp	prot-nuc 2.70	N-(5'-PHOSPHO-2'-DEOXYGUANOSIN-8-YL)-2- ACETYLAMINOFLUORENE 2(C25 H25 N6 O8 P)	YEAST DNA POLYMERASE ETA IN COMPLEX WITH C8-2- ACETYLAMINOFLUORENE CONTAINING DNA DNA POLYMERASE ETA: RESIDUES 1-513, 5'-D(*CP*8FG*CP*TP*CP*AP*TP*CP*CP*AP*C)-3', 5'-D(*GP*TP*GP*GP*AP*TP*GP*AP*G)-3' TRANSFERASE/DNA TRANSFERASE-DNA COMPLEX, TRANSLESION DNA SYNTHESIS, DNA-BIND DAMAGE
5a3d	prot-nuc 1.80	N-(5'-PHOSPHO-2'-DEOXYGUANOSIN-8-YL)-2- ACETYLAMINOFLUORENE C25 H25 N6 O8 P	STRUCTURAL INSIGHTS INTO THE RECOGNITION OF CISPLATIN AND AAF-DG LESIONS BY RAD14 (XPA) DNA REPAIR PROTEIN RAD14: DNA BINDING DOMAIN, 5'-D(*DG 5IUP*GP*A 5IUP*GP*AP*CP*G 5IUP*AP*GP*AP*DGP*AP)-3', 5'-D(*DTP*CP*TP*CP*TP*AP*C 8FGP*TP*CP*AP*TP*CP*DA CHAIN: C DNA BINDING PROTEIN DNA BINDING PROTEIN, XPA, RAD14, NER, AAF-DG, CISPLATIN

8G1    (3R)-8-[(3-CHLORO-4-FLUOROPHENYL)METHYL]-6-HYDROXY-1,5, 7-TRIOXO-1,2',3',5,7,8,9,10-OCTAHYDRO-2H- SPIRO[IMIDAZO[5,1-A][2,6]NAPHTHYRIDINE-3,1'-INDENE]- 7'-CARBONITRILE

Code	Class Resolution	Description
5uoq	prot-nuc 2.61	(3R)-8-[(3-CHLORO-4-FLUOROPHENYL)METHYL]-6-HYDROXY-1,5, 7-TRIOXO-1,2',3',5,7,8,9,10-OCTAHYDRO-2H- SPIRO[IMIDAZO[5,1-A][2,6]NAPHTHYRIDINE-3,1'-INDENE]- 7'-CARBONITRILE C26 H18 CL F N4 O4	CRYSTAL STRUCTURE OF THE PROTOTYPE FOAMY VIRUS INTASOME WITH PYRIDINONE AMINAL INHIBITOR (COMPOUND 31) INTEGRASE, NUCLEOTIDE PREPROCESSED PFV DONOR DNA (TRANSFERRE CHAIN: D, NUCLEOTIDE PREPROCESSED PFV DONOR DNA (NON-TRANSF STRAND) TRANSFERASE/DNA/INHIBITOR TRANSFERASE-DNA COMPLEX, DNA INTEGRATION, VIRAL PROTEIN, RECOMBINATION-INHIBITOR-DNA COMPLEX, TRANSFERASE-DNA-INHIBI COMPLEX

8G4    (1S,2S,5R)-8'-[(3-CHLORO-4-FLUOROPHENYL)METHYL]-2'-[2- (2,5-DIOXO-2,5-DIHYDRO-1H-PYRROL-1-YL)ETHYL]-6'- HYDROXY-9',10'-DIHYDRO-2'H-SPIRO[BICYCLO[3.1.0]HEXANE- 2,3'-IMIDAZO[5,1-A][2,6]NAPHTHYRIDINE]-1',5',7'(8'H)- TRIONE

Code	Class Resolution	Description
5uop	prot-nuc 2.85	(1S,2S,5R)-8'-[(3-CHLORO-4-FLUOROPHENYL)METHYL]-2'-[2- (2,5-DIOXO-2,5-DIHYDRO-1H-PYRROL-1-YL)ETHYL]-6'- HYDROXY-9',10'-DIHYDRO-2'H-SPIRO[BICYCLO[3.1.0]HEXANE- 2,3'-IMIDAZO[5,1-A][2,6]NAPHTHYRIDINE]-1',5',7'(8'H)- TRIONE C28 H24 CL F N4 O6	CRYSTAL STRUCTURE OF THE PROTOTYPE FOAMY VIRUS INTASOME WITH PYRIDINONE AMINAL INHIBITOR (COMPOUND 18) NUCLEOTIDE PREPROCESSED PFV DONOR DNA (NON-TRANSF STRAND), NUCLEOTIDE PREPROCESSED PFV DONOR DNA (TRANSFERRE CHAIN: D, INTEGRASE TRANSFERASE/DNA/INHIBITOR DNA INTEGRATION, VIRAL PROTEIN, RECOMBINATION-INHIBITOR-DNA TRANSFERASE-DNA-INHIBITOR COMPLEX

8GT    8-OXO-GUANOSINE-5'-TRIPHOSPHATE

Code	Class Resolution	Description
5c5j	prot-nuc 2.10	8-OXO-GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O15 P3	POYMERASE NUCLEOTIDE COMPLEX DNA POLYMERASE IV, DNA (5'- D(*TP*CP*TP*AP*GP*GP*GP*TP*CP*CP*TP*AP*GP*GP*AP*CP*CP*C)-3' CHAIN: G, H, B, C TRANSFERASE/DNA DNA POLYMERASE, REPLICATION, TRANSFERASE-DNA COMPLEX

8MX    1-CYCLOPROPYL-6-FLUORO-8-METHYL-7-[(4AS,7AS)-OCTAHYDRO- 6H-PYRROLO[3,4-B]PYRIDIN-6-YL]-4-OXO-1,4- DIHYDROQUINOLINE-3-CARBOXYLIC ACID

Code	Class Resolution	Description
5btl	prot-nuc 2.50	1-CYCLOPROPYL-6-FLUORO-8-METHYL-7-[(4AS,7AS)-OCTAHYDRO- 6H-PYRROLO[3,4-B]PYRIDIN-6-YL]-4-OXO-1,4- DIHYDROQUINOLINE-3-CARBOXYLIC ACID 2(C21 H24 F N3 O3)	CRYSTAL STRUCTURE OF A TOPOISOMERASE II COMPLEX DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA, DNA GYRASE SUBUNIT B: GYRB 426-675 WITH N-TERMINAL SNA TAG, DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC, DNA GYRASE SUBUNIT A: GYRA 2-500 WITH IGSG C-TERMINAL TAG ISOMERASE/DNA PROTEIN-DNA COMPLEX, TOPOISOMERASE II, ISOMERASE-DNA COMPLEX
5btn	prot-nuc 2.50	1-CYCLOPROPYL-6-FLUORO-8-METHYL-7-[(4AS,7AS)-OCTAHYDRO- 6H-PYRROLO[3,4-B]PYRIDIN-6-YL]-4-OXO-1,4- DIHYDROQUINOLINE-3-CARBOXYLIC ACID 2(C21 H24 F N3 O3)	CRYSTAL STRUCTURE OF A TOPOISOMERASE II COMPLEX DNA GYRASE SUBUNIT A: GYRA 2-500 WITH IGSG C-TERMINAL TAG, DNA SUBSTRATE 24-MER TTACGTGCATAGTCATTCATGACC, DNA GYRASE SUBUNIT B: GYRB 426-675 WITH N-TERMINAL SNA TAG, DNA SUBSTRATE 24-MER GGTCATGAATGACTATGCACGTAA ISOMERASE/DNA PROTEIN-DNA COMPLEX, TOPOISOMERASE II, ISOMERASE-DNA COMPLEX

8OG    8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1ebm	prot-nuc 2.10	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CRYSTAL STRUCTURE OF THE HUMAN 8-OXOGUANINE GLYCOSYLASE (HOGG1) BOUND TO A SUBSTRATE OLIGONUCLEOTIDE DNA (5'-D(*GP*CP*GP*TP*CP*CP*AP*(8OG) P*GP*TP*CP*TP*AP*CP*C)-3'), 8-OXOGUANINE DNA GLYCOSYLASE: CORE FRAGMENT (RESIDUES 12 TO 325), DNA (5'- D(*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3') LYASE/DNA DNA REPAIR, DNA GLYCOSYLASE, PROTEIN/DNA, LYASE/DNA COMPLEX
1lpq	prot-nuc 3.14	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	HUMAN DNA TOPOISOMERASE I (70 KDA) IN NON-COVALENT COMPLEX WITH A 22 BASE PAIR DNA DUPLEX CONTAINING AN 8-OXOG LESION 5'- D(*AP*AP*AP*AP*AP*TP*TP*TP*TP*TP*CP*CP*AP*AP*GP*TP*CP*TP*TP *TP*TP*T)-3', DNA TOPOISOMERASE I, 5'-D(*AP*AP*AP*AP*AP*GP*AP*CP*TP*TP*(8OG) P*GP*AP*AP*AP*AP*AP*TP*TP*TP*TP*T)-3' ISOMERASE/DNA PROTEIN-DNA COMPLEX, DNA DAMAGE, INDUCED CONFORMATIONAL CHANGE, ISOMERASE/DNA COMPLEX
1mq2	prot-nuc 3.10	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	HUMAN DNA POLYMERASE BETA COMPLEXED WITH GAPPED DNA CONTAINING AN 8-OXO-7,8-DIHYDRO-GUANINE AND DAMP DNA POLYMERASE BETA, 5'-D(*CP*CP*GP*AP*CP*(8OG) P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3', 5'-D(P*GP*TP*CP*GP*G)-3', 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(2DA))-3' TRANSFERASE/DNA TRANSFERASE, DNA, TRANSFERASE/DNA COMPLEX
1mq3	prot-nuc 2.80	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	HUMAN DNA POLYMERASE BETA COMPLEXED WITH GAPPED DNA CONTAINING AN 8-OXO-7,8-DIHYDRO-GUANINE TEMPLATE PAIRED WITH DCTP 5'-D(*CP*CP*GP*AP*CP*(8OG) P*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3', DNA POLYMERASE BETA, 5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(DOC))-3', 5'-D(P*GP*TP*CP*GP*G)-3' TRANSFERASE/DNA TRANSFERASE, DNA, TRANSFERASE/DNA COMPLEX
1n3c	prot-nuc 2.70	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	STRUCTURAL AND BIOCHEMICAL EXPLORATION OF A CRITICAL AMINO ACID IN HUMAN 8-OXOGUANINE GLYCOSYLASE DNA COMPLEMENT STRAND, N-GLYCOSYLASE/DNA LYASE: 3.2.2.-, 4.2.99.18, 8-OXOG-CONTAINING DNA HYDROLASE, LYASE/DNA HHH-GPD DNA GLYCOSYLASE DNA REPAIR OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
1q9y	prot-nuc 2.80	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CRYSTAL STRUCTURE OF ENTEROBACTERIA PHAGE RB69 GP43 DNA POLYMERASE COMPLEXED WITH 8-OXOGUANOSINE CONTAINING DNA DNA POLYMERASE, 5'-GCGGACTGCTTAC(DIDEOXYCYTIDINE)-3', 5'-AC(8-OXOGUANOSINE)GGTAAGCAGTCCGCG-3' TRANSFERASE, REPLICATION/DNA PROTEIN_DNA COMPLEX, TRANSFERASE, REPLICATION/DNA COMPLEX
1r2y	prot-nuc 2.34	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	MUTM (FPG) BOUND TO 8-OXOGUANINE (OXOG) CONTAINING DNA 5'- D(*AP*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3', 5'-D(*TP*GP*CP*GP*TP*CP*CP*AP*(8OG) P*GP*TP*CP*TP*AP*CP*C)-3', MUTM HYDROLASE/DNA DNA REPAIR, DNA GLYCOSYLASE, HYDROLASE/DNA COMPLEX
1rrq	prot-nuc 2.22	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	MUTY ADENINE GLYCOSYLASE IN COMPLEX WITH DNA CONTAINING AN A:OXOG PAIR 5'-D(AP*AP*GP*AP*CP*(8OG)P*TP*GP*GP*AP*C)-3', MUTY, 5'-D(*TP*GP*TP*CP*CP*AP*AP*GP*TP*CP*T)-3' HYDROLASE/DNA DNA REPAIR, DNA GLYCOSYLASE, 8-OXOGUANINE, PROTEIN-DNA COMPLEX, HYDROLASE/DNA COMPLEX
1rrs	prot-nuc 2.40	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	MUTY ADENINE GLYCOSYLASE IN COMPLEX WITH DNA CONTAINING AN ABASIC SITE MUTY, 5'-D(*TP*GP*TP*CP*CP*AP*(HPD)P*GP*TP*CP*T)-3', 5'-D(*AP*AP*GP*AP*CP*(8OG)P*TP*GP*GP*AP*C)-3' HYDROLASE/DNA DNA REPAIR, DNA GLYCOSYLASE, 8-OXOGUANINE, PROTEIN-DNA COMPLEX, HYDROLASE/DNA COMPLEX
1tk0	prot-nuc 2.30	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	T7 DNA POLYMERASE TERNARY COMPLEX WITH 8 OXO GUANOSINE AND DDCTP AT THE INSERTION SITE 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*A*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP* CP*AP*(DDG))-3', THIOREDOXIN 1, 5'-D(*CP*CP*CP*(8OG) P*CP*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP* TP*CP*G)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA 8 OXO GUANOSINE, DNA POLYMERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1tk8	prot-nuc 2.50	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	T7 DNA POLYMERASE TERNARY COMPLEX WITH 8 OXO GUANOSINE AND DAMP AT THE ELONGATION SITE THIOREDOXIN 1, 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*AP*(2DA))-3', 5'-D(*CP*CP*CP*AP*(8OG) P*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3', DNA POLYMERASE TRANSFERASE/ELECTRON TRANSPORT/DNA 8-OXOGUANOSINE DNA POLYMERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1tkd	prot-nuc 2.49	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	T7 DNA POLYMERASE TERNARY COMPLEX WITH 8 OXO GUANOSINE AND DCMP AT THE ELONGATION SITE DNA POLYMERASE, DNA (5'-D(*CP*CP*CP*AP*(8OG) P*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP* CP*G)-3'), DNA (5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*AP*(DOC))-3'), THIOREDOXIN 1 TRANSFERASE/ELECTRON TRANSPORT/DNA 8-OXOGUANOSINE DNA POLYMERASE, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
1u45	prot-nuc 2.01	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	8OXOGUANINE AT THE PRE-INSERTION SITE OF THE POLYMERASE ACTIVE SITE DNA POLYMERASE I: ANALOGOUS TO THE E. COLI KLENOW FRAGMENT, DNA TEMPLATE STRAND WITH 8-OXOGUANINE, DNA PRIMER STRAND TRANSFERASE/DNA DNA POLYMERASE I; DNA REPLICATION; KLENOW FRAGMENT; PROTEIN- DNA COMPLEX; 8OXOGUANINE; DNA LESION; TRANSLATION REPLICATION, TRANSFERASE/DNA COMPLEX
1u47	prot-nuc 2.00	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CYTOSINE-8-OXOGUANINE BASE PAIR AT THE POLYMERASE ACTIVE SITE DNA PRIMER STRAND, DNA TEMPLATE STRAND WITH 8-OXOGUANINE, DNA POLYMERASE I: ANALOGOUS TO THE E. COLI KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE I; DNA REPLICATION; KLENOW FRAGMENT; PROTEIN- DNA COMPLEX; 8OXOGUANINE; DNA LESION; TRANSLATION REPLICATION, TRANSFERASE/DNA COMPLEX
1u48	prot-nuc 2.10	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	EXTENSION OF A CYTOSINE-8-OXOGUANINE BASE PAIR DNA POLYMERASE I: ANALOGOUS TO THE E. COLI KLENOW FRAGMENT, DNA TEMPLATE STRAND WITH 8-OXOGUANINE, DNA PRIMER STRAND TRANSFERASE/DNA DNA POLYMERASE I; DNA REPLICATION; KLENOW FRAGMENT; PROTEIN- DNA COMPLEX; 8OXOGUANINE; DNA LESION; TRANSLATION REPLICATION, TRANSFERASE/DNA COMPLEX
1u49	prot-nuc 2.15	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	ADENINE-8OXOGUANINE MISMATCH AT THE POLYMERASE ACTIVE SITE DNA PRIMER STRAND, DNA TEMPLATE STRAND WITH 8-OXOGUANINE, DNA POLYMERASE I: ANALOGOUS TO THE E. COLI KLENOW FRAGMENT TRANSFERASE/DNA DNA POLYMERASE I; DNA REPLICATION; KLENOW FRAGMENT; PROTEIN- DNA COMPLEX; 8OXOGUANINE; DNA LESION; TRANSLATION REPLICATION, TRANSFERASE/DNA COMPLEX
1u4b	prot-nuc 1.60	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	EXTENSION OF AN ADENINE-8OXOGUANINE MISMATCH DNA PRIMER STRAND, DNA POLYMERASE I: ANALOGOUS TO THE E. COLI KLENOW FRAGMENT, DNA TEMPLATE STRAND WITH 8-OXOGUANINE TRANSFERASE/DNA DNA POLYMERASE I; DNA REPLICATION; KLENOW FRAGMENT; PROTEIN- DNA COMPLEX; 8OXOGUANINE; DNA LESION; TRANSLATION REPLICATION, TRANSFERASE/DNA COMPLEX
1vrl	prot-nuc 2.50	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	MUTY ADENINE GLYCOSYLASE IN COMPLEX WITH DNA AND SOAKED ADENINE FREE BASE 5'-D(*AP*AP*GP*AP*CP*(8OG)P*TP*GP*GP*AP*C)-3', 5'-D(*TP*GP*TP*CP*CP*AP*(HPD)P*GP*TP*CP*T)-3', MUTY HYDROLASE/DNA DNA REPAIR, DNA GLYCOSYLASE, 8-OXOGUANINE, PROTEIN-DNA COMPLEX, HYDROLASE/DNA COMPLEX
1yqr	prot-nuc 2.43	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CATALYTICALLY INACTIVE HUMAN 8-OXOGUANINE GLYCOSYLASE CROSSLINKED TO OXOG CONTAINING DNA 5'-D(P*CP*GP*TP*CP*CP*AP*(8OG) P*GP*TP*CP*TP*AP*CP*C)-3', N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, 5'-D(P*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*G)- 3' HYDROLASE/DNA DISULFIDE CROSSLINKING, CROSSLINKING VALIDATION, HYDROLASE/DNA COMPLEX
1zyq	prot-nuc 2.70	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	T7 DNA POLYMERASE IN COMPLEX WITH 8OG AND INCOMING DDATP THIOREDOXIN 1, 5'- D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP *CP*AP*(DDG))-3', DNA POLYMERASE, 5'-D(*CP*CP*CP*(8OG) P*CP*TP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP* TP*CP*G)-3' TRANSFERASE/ELECTRON TRANSPORT/DNA 8OG, FIDELITY, TRANSFERASE/ELECTRON TRANSPORT/DNA COMPLEX
2asd	prot-nuc 1.95	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	OXOG-MODIFIED INSERTION TERNARY COMPLEX DNA POLYMERASE IV, 5'-D(*GP*GP*TP*TP*GP*GP*AP*TP*GP*GP*TP*AP*(DDG))- CHAIN: D, H5'-D(*CP*T*AP*AP*CP*(8OG) P*CP*TP*AP*CP*CP*AP*TP*CP*CP*AP*AP*CP*C)-3' TRANSFERASE/DNA DNA POLYMERASE, 8-OXOGUANINE, Y-FAMILY, LESION BYPASS, TRANS DNA COMPLEX
2asl	prot-nuc 2.65	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	OXOG-MODIFIED POSTINSERTION BINARY COMPLEX DNA POLYMERASE IV, 5'-D(*GP*GP*TP*TP*GP*GP*AP*TP*GP*GP*TP*AP*GP*(DOC CHAIN: D, H5'-D(*CP*T*AP*AP*CP*(8OG) P*CP*TP*AP*CP*CP*AP*TP*CP*CP*AP*AP*CP*C)-3' TRANSFERASE/DNA DNA POLYMERASE, 8-OXOGUANINE, Y-FAMILY, LESION BYPASS, TRANS DNA COMPLEX
2c22	prot-nuc 2.56	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	EFFICIENT AND HIGH FIDELITY INCORPORATION OF DCTP OPPOSITE 7,8-DIHYDRO-8-OXODEOXYGUANOSINE BY SULFOLOBUS SOLFATARICUS DNA POLYMERASE DPO4 DNA POLYMERASE IV, 5'-D(TP*CP*AP*C 8OGP*GP*AP*AP*TP*CP*CP*TP *TP*CP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*C)-3' POLYMERASE POLYMERASE, P2 DNA POLYMERASE IV, 7, 8-DIHYDRO-8-OXODEOXYGUANOSINE, TRANSLESION DNA POLYMERASE, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA- BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, METAL - BINDING, MUTATOR PROTEIN
2c28	prot-nuc 2.27	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	EFFICIENT AND HIGH FIDELITY INCORPORATION OF DCTP OPPOSITE 7,8-DIHYDRO-8-OXODEOXYGUANOSINE BY SULFOLOBUS SOLFATARICUS DNA POLYMERASE DPO4 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*C)-3', 5'-D(TP*CP*AP*C 8OGP*GP*AP*AP*TP*CP*CP*TP *TP*CP*CP*CP*CP*C)-3', DNA POLYMERASE IV POLYMERASE POLYMERASE, 7, 8-DIHYDRO-8-OXODEOXYGUANOSINE, P2 DNA POLYMERASE IV, TRANSLESION DNA POLYMERASE, DDGTP, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA- BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, METAL- BINDING, MUTATOR PROTEIN
2c2d	prot-nuc 2.57	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	EFFICIENT AND HIGH FIDELITY INCORPORATION OF DCTP OPPOSITE 7,8-DIHYDRO-8-OXODEOXYGUANOSINE BY SULFOLOBUS SOLFATARICUS DNA POLYMERASE DPO4 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*C)-3', 5'-D(*TP*CP*AP*C 8OGP*GP*AP*AP*TP*CP*CP *TP*TP*CP*CP*CP*CP*C)-3', DNA POLYMERASE IV POLYMERASE POLYMERASE, P2 DNA POLYMERASE IV, 8-OXO-2P-DEOXY-GUANOSINE-5P- MONOPHOSPHATE, TRANSLESION DNA POLYMERASE, DATP, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA-BINDING, DNA-DIRECTED DNA POLYMERASE, METAL-BINDING, MUTATOR PROTEIN, MAGNESIUM
2c2e	prot-nuc 2.61	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	EFFICIENT AND HIGH FIDELITY INCORPORATION OF DCTP OPPOSITE 7,8-DIHYDRO-8-OXODEOXYGUANOSINE BY SULFOLOBUS SOLFATARICUS DNA POLYMERASE DPO4 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*CP*C)-3', 5'-D(*TP*CP*AP*C 8OGP*GP*AP*AP*TP*CP*CP *TP*TP*CP*CP*CP*CP*C)-3', DNA POLYMERASE IV POLYMERASE POLYMERASE, P2 DNA POLYMERASE IV, 7, 8-DIHYDRO-8-OXODEOXYGUANOSINE, TRANSLESION DNA POLYMERASE, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA- BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, CALCIUM, METAL-BINDING, MUTATOR PROTEIN
2c2r	prot-nuc 2.55	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	EFFICIENT AND HIGH FIDELITY INCORPORATION OF DCTP OPPOSITE 7,8-DIHYDRO-8-OXODEOXYGUANOSINE BY SULFOLOBUS SOLFATARICUS DNA POLYMERASE DPO4 5'-D(*TP*CP*AP*C 8OGP*GP*AP*AP*TP*CP*CP *TP*TP*CP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*C)-3', DNA POLYMERASE IV POLYMERASE POLYMERASE, P2 DNA POLYMERASE IV, 7, 8-DIHYDRO-8-OXODEOXYGUANOSINE, TRANSLESION DNA POLYMERASE, NUCLEOTIDYLTRANSFERASE, TRANSFERASE, DNA DAMAGE, DNA REPAIR, DNA REPLICATION, DNA- BINDING, DNA-DIRECTED DNA POLYMERASE, MAGNESIUM, CALCIUM, METAL-BINDING, MUTATOR PROTEIN
2f5q	prot-nuc 2.35	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CATALYTICALLY INACTIVE (E3Q) MUTM CROSSLINKED TO OXOG:C CONTAINING DNA CC2 FORMAMIDOPYRIMIDINE-DNA GLYCOSIDASE, 5'-D(*TP*GP*CP*G*TP*CP*CP*AP*(8OG) P*GP*TP*CP*TP*AP*CP*C)-3', 5'- D(*AP*GP*G*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3' HYDROLASE/DNA DISULFIDE CROSSLINK, DNA GLYCOSYLASE, DNA REPAIR, DAMAGE SEARCH, CONTROL COMPLEX, HYDROLASE/DNA COMPLEX
2f5s	prot-nuc 2.35	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CATALYTICALLY INACTIVE (E3Q) MUTM CROSSLINKED TO OXOG:C CONTAINING DNA CC1 5'- D(*AP*GP*GP*TP*AP*GP*AP*CP*TP*CP*GP*GP*AP*CP*GP*C)-3', 5'-D(*TP*GP*C*GP*TP*CP*CP*(8OG) P*AP*GP*TP*CP*TP*AP*CP*C)-3', FORMAMIDOPYRIMIDINE-DNA GLYCOSIDASE HYDROLASE/DNA DISULFIDE CROSSLINK, DNA GLYCOSYLASE, DNA REPAIR, DAMAGE SEARCH, CONTROL COMPLEX, HYDROLASE/DNA COMPLEX
2i5w	prot-nuc 2.60	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	STRUCTURE OF HOGG1 CROSSLINKED TO DNA SAMPLING A NORMAL G AD AN OXOG N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, DNA-(APURINIC OR AP SITE) LYASE, AP LYASE, 5'-D(P*CP*CP*AP*GP*(G42)P*TP*CP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*A)-3' HYDROLASE, LYASE/DNA DISULFIDE CROSSLINK, PROTEIN-DNA COMPLEX, DNA GLYCOSYLASE, H LYASE-DNA COMPLEX
2nob	prot-nuc 2.10	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	STRUCTURE OF CATALYTICALLY INACTIVE H270A HUMAN 8- OXOGUANINE GLYCOSYLASE CROSSLINKED TO 8-OXOGUANINE DNA 5'- D(*T*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3', N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, 5'-D(*G*CP*GP*TP*CP*CP*AP*(G42) P*GP*TP*CP*TP*AP*CP*C)-3' HYDROLASE, LYASE/DNA N-GLYCOSYLASE/DNA LYASE, DNA REPAIR, 8-OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
2noe	prot-nuc 2.20	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	STRUCTURE OF CATALYTICALLY INACTIVE G42A HUMAN 8-OXOGUANINE GLYCOSYLASE COMPLEXED TO 8-OXOGUANINE DNA 5'- D(*G*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3', 5'-D(*G*CP*GP*TP*CP*CP*AP*(G42) P*GP*TP*CP*TP*AP*CP*C)-3', N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE HYDROLASE, LYASE/DNA N-GLYCOSYLASE/DNA LYASE, DNA REPAIR, 8-OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
2nof	prot-nuc 2.35	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	STRUCTURE OF Q315F HUMAN 8-OXOGUANINE GLYCOSYLASE PROXIMAL CROSSLINK TO 8-OXOGUANINE DNA N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, 5'-D(*GP*CP*GP*TP*C*CP*AP*(G42) P*GP*TP*CP*TP*AP*CP*C)-3', 5'- D(*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3' HYDROLASE, LYASE/DNA N-GLYCOSYLASE/DNA LYASE, DNA REPAIR, 8-OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
2noh	prot-nuc 2.01	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	STRUCTURE OF CATALYTICALLY INACTIVE Q315A HUMAN 8- OXOGUANINE GLYCOSYLASE COMPLEXED TO 8-OXOGUANINE DNA N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, 5'-D(*GP*CP*GP*TP*CP*CP*AP*(G42) P*GP*TP*CP*TP*AP*CP*C)-3', 5'- D(*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3' HYDROLASE, LYASE/DNA N-GLYCOSYLASE/DNA LYASE, DNA REPAIR, 8-OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
2nol	prot-nuc 2.57	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	STRUCTURE OF CATALYTICALLY INACTIVE HUMAN 8-OXOGUANINE GLYCOSYLASE DISTAL CROSSLINK TO OXOG DNA 5'- D(*GP*GP*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3', 5'-D(*GP*CP*GP*TP*CP*CP*AP*(G42) P*GP*TP*CP*TP*AP*CP*C)-3', N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE HYDROLASE, LYASE/DNA N-GLYCOSYLASE/DNA LYASE, DNA REPAIR, 8-OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
2noz	prot-nuc 2.43	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	STRUCTURE OF Q315F HUMAN 8-OXOGUANINE GLYCOSYLASE DISTAL CROSSLINK TO 8-OXOGUANINE DNA N-GLYCOSYLASE/DNA LYASE: 8-OXOGUANINE DNA GLYCOSYLASE, DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE, 5'-D(*G*CP*GP*TP*CP*CP*AP*(G42) P*GP*TP*CP*TP*AP*CP*C)-3', 5'- D(*GP*G*TP*AP*GP*AP*CP*CP*TP*GP*GP*AP*CP*GP*C)-3' HYDROLASE, LYASE/DNA N-GLYCOSYLASE/DNA LYASE, DNA REPAIR, 8-OXOGUANINE, HYDROLASE, LYASE/DNA COMPLEX
2uvr	prot-nuc 2.90	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CRYSTAL STRUCTURES OF MUTANT DPO4 DNA POLYMERASES WITH 8- OXOG CONTAINING DNA TEMPLATE-PRIMER CONSTRUCTS 5'-D(*TP*CP*AP*CP*8OGP*GP*AP*AP*TP*CP *CP*TP*TP*CP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP *TP*TP*CP*C)-3', DNA POLYMERASE IV TRANSFERASE TRANSFERASE, DNA-DIRECTED DNA POLYMER