Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE TIAS-TRNA(ILE2)-AMPCPP-AGMATINE COMPLEX
 
Authors :  T. Numata, T. Osawa
Date :  23 Aug 10  (Deposition) - 19 Oct 11  (Release) - 19 Jun 13  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.10
Chains :  Asym./Biol. Unit :  A,B
Keywords :  Tias, Trna(Ile2), Modification, Rna Binding Protein-Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  T. Osawa, S. Kimura, N. Terasaka, H. Inanaga, T. Suzuki, T. Numata
Structural Basis Of Trna Agmatinylation Essential For Aua Codon Decoding
Nat. Struct. Mol. Biol. V. 18 1275 2011
PubMed-ID: 22002223  |  Reference-DOI: 10.1038/NSMB.2144

(-) Compounds

Molecule 1 - PUTATIVE UNCHARACTERIZED PROTEIN
    Chains: A
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PET15B
    Expression System Strain: C41(DE3)
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: AF_2259
    Organism Scientific: ARCHAEOGLOBUS FULGIDUS
    Organism Taxid: 2234
    Synonym: TIAS
 
Molecule 2 - RNA (78-MER)
    Chains: B
    Engineered: YES
    Organism Scientific: ARCHAEOGLOBUS FULGIDUS
    Organism Taxid: 2234
    Other Details: IN VITRO TRANSCRIPTION USING T7 RNA POLYMERASE, SEQUENCE NATURALLY EXIST IN ARCHAEOGLOBUS FULGIDUS
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 3)

Asymmetric/Biological Unit (3, 3)
No.NameCountTypeFull Name
1AG21Ligand/IonAGMATINE
2APC1Ligand/IonDIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER
3TPO1Mod. Amino AcidPHOSPHOTHREONINE

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREASP A:8 , ASP A:9 , ASP A:11 , TPO A:18 , LEU A:45 , ILE A:49 , ASN A:56 , GLY A:57 , ALA A:112 , ASP A:115 , LEU A:117 , ARG A:140 , GLY A:141 , ILE A:143 , GLY A:144 , C B:34BINDING SITE FOR RESIDUE APC A 421
2AC2SOFTWAREASP A:193 , ASN A:194 , VAL A:203 , GLY A:215 , ARG A:217 , PRO A:398 , ARG A:401 , U B:33 , A B:35BINDING SITE FOR RESIDUE AG2 A 422

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3AMU)

(-) Cis Peptide Bonds  (2, 2)

Asymmetric/Biological Unit
No.Residues
1Tyr A:188 -Pro A:189
2Cys A:352 -Pro A:353

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3AMU)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 3AMU)

(-) Exons   (0, 0)

(no "Exon" information available for 3AMU)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:402
 aligned with TIAS_ARCFU | O28025 from UniProtKB/Swiss-Prot  Length:420

    Alignment length:421
                             1                                                                                                                                                                                                                                                                                                                                                                                                                                   
                             |       9        19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339       349       359       369       379       389       399       409       419 
           TIAS_ARCFU     - -MRVWVGIDDTDSSRGMCTTYLAVLAMERVERELGKVIGFPRLIRLNPTIPYKTRGNGAVSFLVEVDDVGELVDVVNEVIIEHAMLDDEKTNPGAVFVDEELAVKLKPFADKAIKDVLQIDEALFVIGKYFIPHLRHKKGRGLIGALAAVGAELEDFTLELIAYRYPERFGTEREYDEESFFDMDYELYPQTFDNVDWCNDVVVCIPNTPCPVLYGIRGESVEALYKAMESVKTEPVDRRMIFVTNHATDMHLIGEEEVHRLENYRSYRLRGRVTLEPYDIEGGHVFFEIDTKFGSVKCAAFEPTKQFRNVIRLLRKGDVVEVYGSMKKDTINLEKIQIVELAEIWVEKNPICPSCGRRMESAGRGQGFRCKKCRTKADEKLREKVERELQPGFYEVPPSARRHLSKPLIRMNVEGRHIFR 420
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .eeeeeeee........hhhhhhhhhhhhhhhhh.......eeee......-----.eeeeeeeee.hhhhhhhhhhhhhhhh..........eeeeee...hhhhhhhhhhhhhh..hhhhhhhhhhhh...eee.....hhhhhhhhh.......eeeeeee.hhhhh......hhhhhhhhhhhhh..ee...................eeeeeee.hhhhhhhhhhh........eeeeee.......eee.hhh.......eeeeeeeeeeeee......eeeeee....eeeeeehhhhhhhhhhhh......eeeeeeeee..eeeeeeeeeee...eee.......------.........--------......eee......eeee.hhhhh.....hhhhh....ee... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3amu A   0 HMRVWVGIDDTDSSRGMCtTYLAVLAMERVERELGKVIGFPRLIRLNPTIP-----NGAVSFLVEVDDVGELVDVVNEVIIEHAMLDDEKTNPGAVFVDEELAVKLKPFADKAIKDVLQIDEALFVIGKYFIPHLRHKKGRGLIGALAAVGAELEDFTLELIAYRYPERFGTEREYDEESFFDMDYELYPQTFDNVDWCNDVVVCIPNTPCPVLYGIRGESVEALYKAMESVKTEPVDRRMIFVTNHATDMHLIGEEEVHRLENYRSYRLRGRVTLEPYDIEGGHVFFEIDTKFGSVKCAAFEPTKQFRNVIRLLRKGDVVEVYGSMKKDTINLEKIQIVELAEIWVEKNPICP------ESAGRGQGF--------ADEKLREKVERELQPGFYEVPPSARRHLSKPLIRMNVEGRHIFR 420
                                     9        19        29        39        49|     | 59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339       349   |     -|       |-       379       389       399       409       419 
                                             18-TPO                          50    56                                                                                                                                                                                                                                                                                                      353    360     368      377                                           


Chain B from PDB  Type:RNA  Length:78
                                                                                                              
                 3amu B   1 GGGCCCGUAGCUUAGCCAGGUCAGAGCGCCCGGCUCAUAACCGGGCGGUCGAGGGUUCGAAUCCCUCCGGGCCCACCA  76
                                    10        20|||     28        38        48        58        68        
                                              21A||                                                       
                                               21B|                                                       
                                                21C
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 3AMU)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 3AMU)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 3AMU)

(-) Gene Ontology  (8, 8)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (TIAS_ARCFU | O28025)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0016879    ligase activity, forming carbon-nitrogen bonds    Catalysis of the joining of two molecules, or two groups within a single molecule, via a carbon-nitrogen bond, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
biological process
    GO:0008033    tRNA processing    The process in which a pre-tRNA molecule is converted to a mature tRNA, ready for addition of an aminoacyl group.
    GO:0002101    tRNA wobble cytosine modification    The process in which a cytosine in position 34 of a tRNA is post-transcriptionally modified.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    AG2  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    APC  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    TPO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Cys A:352 - Pro A:353   [ RasMol ]  
    Tyr A:188 - Pro A:189   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  3amu
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  TIAS_ARCFU | O28025
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  TIAS_ARCFU | O28025
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        TIAS_ARCFU | O28025: 3amt 3au7 4rvz

(-) Related Entries Specified in the PDB File

3amt 3au7