Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Biological Unit 1
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE LAMBDA INTEGRASE (RESIDUES 75-356) BOUND TO DNA
 
Authors :  H. Aihara, H. J. Kwon, S. E. Nunes-Duby, A. Landy, T. Ellenberger
Date :  01 May 03  (Deposition) - 12 Aug 03  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.95
Chains :  Asym. Unit :  A,B,C,D,E,F
Biol. Unit 1:  A,C,D  (1x)
Biol. Unit 2:  B,E,F  (1x)
Keywords :  Protein-Dna Complex, Dna Binding Protein/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  H. Aihara, H. J. Kwon, S. E. Nunes-Duby, A. Landy, T. Ellenberger
A Conformational Switch Controls The Dna Cleavage Activity Of Lambda Integrase
Mol. Cell V. 12 187 2003
PubMed-ID: 12887904  |  Reference-DOI: 10.1016/S1097-2765(03)00268-5
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - 5'-D(*CP*AP*AP*TP*GP*CP*CP*AP*AP*CP*TP*TP*T)-3'
    Chains: C, E
    Engineered: YES
    Synthetic: YES
 
Molecule 2 - 26-MER
    Chains: D, F
    Engineered: YES
    Synthetic: YES
 
Molecule 3 - INTEGRASE
    Chains: A, B
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Fragment: RESIDUES 75-356
    Gene: INT
    Organism Scientific: ENTEROBACTERIA PHAGE LAMBDA
    Organism Taxid: 10710

 Structural Features

(-) Chains, Units

  123456
Asymmetric Unit : ABCDEF
Biological Unit 1 (1x): A CD  
Biological Unit 2 (1x):  B  EF

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 2)

Asymmetric Unit (1, 2)
No.NameCountTypeFull Name
1PTR2Mod. Amino AcidO-PHOSPHOTYROSINE
Biological Unit 1 (1, 1)
No.NameCountTypeFull Name
1PTR1Mod. Amino AcidO-PHOSPHOTYROSINE
Biological Unit 2 (1, 1)
No.NameCountTypeFull Name
1PTR1Mod. Amino AcidO-PHOSPHOTYROSINE

(-) Sites  (0, 0)

(no "Site" information available for 1P7D)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1P7D)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1P7D)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1P7D)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1P7D)

(-) Exons   (0, 0)

(no "Exon" information available for 1P7D)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:280
 aligned with VINT_LAMBD | P03700 from UniProtKB/Swiss-Prot  Length:356

    Alignment length:283
                                    83        93       103       113       123       133       143       153       163       173       183       193       203       213       223       233       243       253       263       273       283       293       303       313       323       333       343       353   
           VINT_LAMBD    74 VTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPLEDITTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQYRDDRGREWDKIEIK 356
               SCOP domains d1p7da_ A: Integrase (Int)                                                                                                                                                                                                                                                                  SCOP domains
               CATH domains 1p7dA01 A:74-174  [code=1.10.150.130, no na   me defined]                                            --1p7dA02 A:177-356 Intergrase catalytic core                                                                                                                                          CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhh.....---hhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhh..hhhhh...eeeee......eeeee...ee....eehhhhhhhhhhhh..............hhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhhhhhhh..................ee.... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1p7d A  74 MTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPL---TTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQyRDDRGREWDKIEIK 356
                                    83        93       103       113  |   |123       133       143       153       163       173       183       193       203       213       223       233       243       253       263       273       283       293       303       313       323       333       343       353   
                                                                    116 120                                                                                                                                                                                                                           342-PTR          

Chain B from PDB  Type:PROTEIN  Length:280
 aligned with VINT_LAMBD | P03700 from UniProtKB/Swiss-Prot  Length:356

    Alignment length:283
                                    83        93       103       113       123       133       143       153       163       173       183       193       203       213       223       233       243       253       263       273       283       293       303       313       323       333       343       353   
           VINT_LAMBD    74 VTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPLEDITTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQYRDDRGREWDKIEIK 356
               SCOP domains d1p7db_ B: Integrase (Int)                                                                                                                                                                                                                                                                  SCOP domains
               CATH domains 1p7dB01 B:74-174  [code=1.10.150.130, no na   me defined]                                            --1p7dB02 B:177-356 Intergrase catalytic core                                                                                                                                          CATH domains
           Pfam domains (1) -Ph---Phage_integr_N-1p7dB03 B:80-158                                                -------------------Phage_integrase-1p7dB01 B:178-349                                                                                                                                           ------- Pfam domains (1)
           Pfam domains (2) -Ph---Phage_integr_N-1p7dB04 B:80-158                                                -------------------Phage_integrase-1p7dB02 B:178-349                                                                                                                                           ------- Pfam domains (2)
         Sec.struct. author .hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhh.....---hhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhh..hhhhh...eeeee......eeeee...ee....eehhhhhhhhhhhh..............hhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhhhhhhh........................ Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1p7d B  74 MTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPL---TTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQyRDDRGREWDKIEIK 356
                                    83        93       103       113  |   |123       133       143       153       163       173       183       193       203       213       223       233       243       253       263       273       283       293       303       313       323       333       343       353   
                                                                    116 120                                                                                                                                                                                                                           342-PTR          

Chain C from PDB  Type:DNA  Length:13
                                             
                 1p7d C   1 CAATGCCAACTTT  13
                                    10   

Chain D from PDB  Type:DNA  Length:26
                                                          
                 1p7d D  14 TTTGCGAAGCAAAAAAGTTGGCATTG  39
                                    23        33      

Chain E from PDB  Type:DNA  Length:13
                                             
                 1p7d E   1 CAATGCCAACTTT  13
                                    10   

Chain F from PDB  Type:DNA  Length:26
                                                          
                 1p7d F  14 TTTGCGAAGCAAAAAAGTTGGCATTG  39
                                    23        33      

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric Unit

(-) CATH Domains  (2, 4)

Asymmetric Unit

(-) Pfam Domains  (3, 6)

Asymmetric Unit
(-)
Clan: DNA-mend (28)

(-) Gene Ontology  (9, 9)

Asymmetric Unit(hide GO term definitions)
Chain A,B   (VINT_LAMBD | P03700)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0008907    integrase activity    Catalysis of the integration of one segment of DNA into another.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
    GO:0015074    DNA integration    The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Intrachromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.
    GO:0075713    establishment of integrated proviral latency    A process by which the virus integrates into the host genome and establishes as a stable provirus or prophage.
    GO:0046718    viral entry into host cell    The process that occurs after viral attachment by which a virus, or viral nucleic acid, breaches the plasma membrane or cell envelope and enters the host cell. The process ends when the viral nucleic acid is released into the host cell cytoplasm.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    PTR  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
(no "Sites" information available for 1p7d)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1p7d)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1p7d
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  VINT_LAMBD | P03700
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  VINT_LAMBD | P03700
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        VINT_LAMBD | P03700: 1ae9 1kjk 1m97 1z19 1z1b 1z1g 2oxo 2wcc 5j0n

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1P7D)