Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  STRUCTURE OF TRMBL2, AN ARCHAEAL CHROMATIN PROTEIN, SHOWS A NOVEL MODE OF DNA BINDING.
 
Authors :  M. U. Ahmad, K. Diederichs, W. Welte
Date :  27 May 15  (Deposition) - 02 Sep 15  (Release) - 21 Sep 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.50
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F
Keywords :  Chromatin Binding Protein, Dna Binding Protein (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  M. U. Ahmad, I. Waege, W. Hausner, M. Thomm, W. Boos, K. Diederichs, W. Welte
Structural Insights Into Nonspecific Binding Of Dna By Trmbl2, An Archaeal Chromatin Protein.
J. Mol. Biol. V. 427 3216 2015
PubMed-ID: 26299937  |  Reference-DOI: 10.1016/J.JMB.2015.08.012

(-) Compounds

Molecule 1 - PUTATIVE HTH-TYPE TRANSCRIPTIONAL REGULATOR TRMBL2
    Chains: A, B, C, D
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PET24D
    Expression System Strain: BL21(DE3)
    Expression System Taxid: 469008
    Gene: TRMBL2, PF0496
    Organism Scientific: PYROCOCCUS FURIOSUS
    Organism Taxid: 2261
 
Molecule 2 - DNA TGM (25-MER)
    Chains: E
    Engineered: YES
    Organism Scientific: PYROCOCCUS FURIOSUS
    Organism Taxid: 2261
    Synthetic: YES
 
Molecule 3 - DNA (25-MER)
    Chains: F
    Engineered: YES
    Organism Scientific: PYROCOCCUS FURIOSUS
    Organism Taxid: 2261
    Synthetic: YES

 Structural Features

(-) Chains, Units

  123456
Asymmetric/Biological Unit : ABCDEF

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 10)

Asymmetric/Biological Unit (2, 10)
No.NameCountTypeFull Name
1GOL7Ligand/IonGLYCEROL
2MPD3Ligand/Ion(4S)-2-METHYL-2,4-PENTANEDIOL

(-) Sites  (9, 9)

Asymmetric Unit (9, 9)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREGLN A:86 , LYS C:140binding site for residue GOL A 301
2AC2SOFTWAREASP A:211 , LYS A:253 , TYR A:257binding site for residue MPD A 302
3AC3SOFTWAREGLU B:95 , ALA B:98 , LYS B:99 , GLU D:12 , HIS D:13binding site for residue GOL B 302
4AC4SOFTWAREASP B:211 , LYS B:253 , TYR B:257binding site for residue MPD B 303
5AC5SOFTWAREASN B:79 , GLN B:86 , THR D:136 , VAL D:160 , ASN D:161binding site for residue MPD B 304
6AC6SOFTWAREASP C:154 , ALA C:159 , GLU C:163 , LEU C:188 , ILE C:193binding site for residue GOL C 301
7AC7SOFTWAREARG B:245 , ASP C:211 , LYS C:253 , TYR C:257 , HOH C:421binding site for residue GOL C 302
8AC8SOFTWAREASP D:154 , ALA D:159 , HOH D:403binding site for residue GOL D 301
9AC9SOFTWAREARG A:245 , ASP D:211 , LYS D:253 , TYR D:257 , HOH D:418binding site for residue GOL D 302

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5BOX)

(-) Cis Peptide Bonds  (14, 14)

Asymmetric/Biological Unit
No.Residues
1Ile A:158 -Ala A:159
2Glu A:199 -Gly A:200
3Leu A:228 -Ala A:229
4Phe A:233 -Asn A:234
5Ala A:261 -Glu A:262
6Tyr B:121 -Gly B:122
7Gly C:67 -Lys C:68
8Glu C:117 -Val C:118
9Lys C:189 -Ala C:190
10Ala C:190 -Ser C:191
11Glu D:117 -Val D:118
12Val D:118 -Pro D:119
13Lys D:189 -Ala D:190
14Ile D:194 -Asp D:195

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5BOX)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5BOX)

(-) Exons   (0, 0)

(no "Exon" information available for 5BOX)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:263
                                                                                                                                                                                                                                                                                                       
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhh.hhhhhhhhhhhhhhh..hhhhhhhh...hhhhhhhhhhhhhhh..eeee.....eeee.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh...............eeee.hhhhhhhhhhhhhhh...eeeeee......hhhhhhhhhhhh..eeeeeee.hhhhhhh.hhhhhhhh....eeeee......eeee..eeeee....hhhhh....eeeeehhhhhhhhhhhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5box A   2 SKDRMVELLQEHFELNLYEARAYVALVAFGVLTPAELASVSEVPAPRTYDVLRSLEKKGFAMTQPGKTNKYRPVHPANVLEKFIQDWQERVKEELEAKKKAKEELLELMAPLIETEVPKYGVERVWVVRGIKNSTLKTKEMLEEAQNEILLADDGFIAVNLEDDIIKAVDRGVKTKILLTKNLLPRLKASKIIDYAKEGKLELRALDKFDLPMLICDEEVFFALEDLAARYFNYETQVWIKDHRVVALFKEKFNEYWEKAEKV 264
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261   


Chain B from PDB  Type:PROTEIN  Length:263
                                                                                                                                                                                                                                                                                                       
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhh.hhhhhhhhhhhhhhh..hhhhhhhh...hhhhhhhhhhhhhhh..eeee.....eeee.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh...............eeee.hhhhhhhhhhhhhhh...eeeeee.hhhhhhhhhhhhhhhhh..eeeeeee.hhhhhhh.hhhhhhhhhh..eeeee......eeee...eeee..hhhhhh.....eeee.hhhhhhhhhhhhhhhhh..ee. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5box B   2 SKDRMVELLQEHFELNLYEARAYVALVAFGVLTPAELASVSEVPAPRTYDVLRSLEKKGFAMTQPGKTNKYRPVHPANVLEKFIQDWQERVKEELEAKKKAKEELLELMAPLIETEVPKYGVERVWVVRGIKNSTLKTKEMLEEAQNEILLADDGFIAVNLEDDIIKAVDRGVKTKILLTKNLLPRLKASKIIDYAKEGKLELRALDKFDLPMLICDEEVFFALEDLAARYFNYETQVWIKDHRVVALFKEKFNEYWEKAEKV 264
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261   


Chain C from PDB  Type:PROTEIN  Length:263
                                                                                                                                                                                                                                                                                                       
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh..hhhhhhhhhhhhhhh..hhhhhhhhh..hhhhhhhhhhhhhhh..eee.......eee.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh..............eeeee.hhhhhhhhhhhhhh...eeeeee.......hhhhhhhhhhh..eeeeeee..hhhhh..............eeeee......eeee..eeeee..hhhhhhh...eeeeeehhhhhhhhhhhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5box C   2 SKDRMVELLQEHFELNLYEARAYVALVAFGVLTPAELASVSEVPAPRTYDVLRSLEKKGFAMTQPGKTNKYRPVHPANVLEKFIQDWQERVKEELEAKKKAKEELLELMAPLIETEVPKYGVERVWVVRGIKNSTLKTKEMLEEAQNEILLADDGFIAVNLEDDIIKAVDRGVKTKILLTKNLLPRLKASKIIDYAKEGKLELRALDKFDLPMLICDEEVFFALEDLAARYFNYETQVWIKDHRVVALFKEKFNEYWEKAEKV 264
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261   


Chain D from PDB  Type:PROTEIN  Length:263
                                                                                                                                                                                                                                                                                                       
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh..hhhhhhhhhhhhhhh..hhhhhhhhh..hhhhhhhhhhhhhhh..eee.......eee.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh..............eeeee.hhhhhhhhhhhhhh...eeeeee.......hhhhhhhhhhh..eeeeeee..hhhhh..............eeeee......eeee..eeeee..hhhhhhh...eeeeeehhhhhhhhhhhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5box D   2 SKDRMVELLQEHFELNLYEARAYVALVAFGVLTPAELASVSEVPAPRTYDVLRSLEKKGFAMTQPGKTNKYRPVHPANVLEKFIQDWQERVKEELEAKKKAKEELLELMAPLIETEVPKYGVERVWVVRGIKNSTLKTKEMLEEAQNEILLADDGFIAVNLEDDIIKAVDRGVKTKILLTKNLLPRLKASKIIDYAKEGKLELRALDKFDLPMLICDEEVFFALEDLAARYFNYETQVWIKDHRVVALFKEKFNEYWEKAEKV 264
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261   


Chain E from PDB  Type:DNA  Length:25
                                                         
                 5box E   1 GTAGTATCATCGATAGTGATACTAC  25
                                    10        20     


Chain F from PDB  Type:DNA  Length:25
                                                         
                 5box F   1 GTAGTATCACTATCGATGATACTAC  25
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5BOX)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5BOX)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5BOX)

(-) Gene Ontology  (3, 3)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    GOL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MPD  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Ala A:261 - Glu A:262   [ RasMol ]  
    Ala C:190 - Ser C:191   [ RasMol ]  
    Glu A:199 - Gly A:200   [ RasMol ]  
    Glu C:117 - Val C:118   [ RasMol ]  
    Glu D:117 - Val D:118   [ RasMol ]  
    Gly C:67 - Lys C:68   [ RasMol ]  
    Ile A:158 - Ala A:159   [ RasMol ]  
    Ile D:194 - Asp D:195   [ RasMol ]  
    Leu A:228 - Ala A:229   [ RasMol ]  
    Lys C:189 - Ala C:190   [ RasMol ]  
    Lys D:189 - Ala D:190   [ RasMol ]  
    Phe A:233 - Asn A:234   [ RasMol ]  
    Tyr B:121 - Gly B:122   [ RasMol ]  
    Val D:118 - Pro D:119   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5box
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  TMBL2_PYRFU | Q8U3H1
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  TMBL2_PYRFU | Q8U3H1
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        TMBL2_PYRFU | Q8U3H1: 5bpd 5bpi 5bqt

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5BOX)