Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  HUMAN DNA TOPOISOMERASE I (70 KDA) IN COMPLEX WITH THE POISON CAMPTOTHECIN AND COVALENT COMPLEX WITH A 22 BASE PAIR DNA DUPLEX
 
Authors :  B. L. Staker, M. D. Feese, M. Cushman, Y. Pommier, D. Zembower, L. Stewart, A. B. Burgin
Date :  12 May 04  (Deposition) - 31 May 05  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.00
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Complex (Isomerase/Dna), Dna, Topoisomerase I, Drug, Poison (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  B. L. Staker, M. D. Feese, M. Cushman, Y. Pommier, D. Zembower, L. Stewart, A. B. Burgin
Structures Of Three Classes Of Anticancer Agents Bound To The Human Topoisomerase I-Dna Covalent Complex
J. Med. Chem. V. 48 2336 2005
PubMed-ID: 15801827  |  Reference-DOI: 10.1021/JM049146P
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - 5'-D(*AP*AP*AP*AP*AP*GP*AP*CP*TP*T)-3'
    ChainsB
    EngineeredYES
    SyntheticYES
 
Molecule 2 - 5'-D(*(TGP)P*GP*AP*AP*AP*AP*AP*TP*TP*TP*TP*T)-3'
    ChainsC
    EngineeredYES
    SyntheticYES
 
Molecule 3 - 5'- D(*AP*AP*AP*AP*AP*TP*TP*TP*TP*TP*CP*CP*AP*AP*GP*TP*CP*TP*TP *TP*TP*T)-3'
    ChainsD
    EngineeredYES
    SyntheticYES
 
Molecule 4 - DNA TOPOISOMERASE I
    ChainsA
    EC Number5.99.1.2
    EngineeredYES
    Expression SystemSPODOPTERA FRUGIPERDA
    Expression System CommonFALL ARMYWORM
    Expression System Taxid7108
    Expression System Vector TypeBACULOVIRUS
    GeneTOP1
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 3)

Asymmetric/Biological Unit (3, 3)
No.NameCountTypeFull Name
1EHD1Ligand/Ion4-ETHYL-4-HYDROXY-1,12-DIHYDRO-4H-2-OXA-6,12A-DIAZA-DIBENZO[B,H]FLUORENE-3,13-DIONE
2PTR1Mod. Amino AcidO-PHOSPHOTYROSINE
3TGP1Mod. Nucleotide5'-THIO-2'-DEOXY-GUANOSINE PHOSPHONIC ACID

(-) Sites  (1, 1)

Asymmetric Unit (1, 1)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREARG A:364 , ASP A:533 , THR A:718 , ASN A:722 , DT B:10 , TGP C:11 , DG C:12 , DC D:112 , DA D:113BINDING SITE FOR RESIDUE EHD D 990

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1T8I)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1T8I)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (6, 6)

Asymmetric/Biological Unit (6, 6)
  dbSNPPDB
No.SourceVariant IDVariantUniProt IDStatusIDChainVariant
1UniProtVAR_052592G214STOP1_HUMANPolymorphism6029542AG214S
2UniProtVAR_036555K326RTOP1_HUMANUnclassified  ---AK326R
3UniProtVAR_010666M370TTOP1_HUMANUnclassified  ---AM370T
4UniProtVAR_007530D533GTOP1_HUMANUnclassified267607131AD533G
5UniProtVAR_010667N722STOP1_HUMANUnclassified  ---AN722S
6UniProtVAR_007531T729ATOP1_HUMANUnclassified  ---AT729A

  SNP/SAP Summary Statistics (UniProtKB/Swiss-Prot)

(-) PROSITE Motifs  (1, 1)

Asymmetric/Biological Unit (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1TOPOISOMERASE_I_EUKPS00176 Eukaryotic DNA topoisomerase I active site.TOP1_HUMAN710-728  1A:710-728

(-) Exons   (14, 14)

Asymmetric/Biological Unit (14, 14)
 ENSEMBLUniProtKBPDB
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength
1.1ENST000003613371ENSE00001174143chr20:39657458-39657740283TOP1_HUMAN1-11110--
1.2ENST000003613372ENSE00001174139chr20:39658071-3965809525TOP1_HUMAN12-2090--
1.3ENST000003613373ENSE00001159739chr20:39690034-3969013097TOP1_HUMAN20-52330--
1.4ENST000003613374ENSE00001037776chr20:39704811-39704934124TOP1_HUMAN52-93420--
1.5ENST000003613375ENSE00000844695chr20:39706222-3970627756TOP1_HUMAN94-112190--
1.6ENST000003613376ENSE00000844696chr20:39708725-3970882096TOP1_HUMAN112-144330--
1.7ENST000003613377ENSE00000844697chr20:39709805-3970988076TOP1_HUMAN144-169260--
1.8ENST000003613378ENSE00000844698chr20:39713102-39713208107TOP1_HUMAN170-205361A:201-2055
1.9ENST000003613379ENSE00000844699chr20:39721112-39721227116TOP1_HUMAN205-244401A:205-24440
1.10ENST0000036133710ENSE00000844700chr20:39725860-39725981122TOP1_HUMAN244-284411A:244-28441
1.11ENST0000036133711ENSE00000844701chr20:39726855-39726977123TOP1_HUMAN285-325411A:285-32541
1.12ENST0000036133712ENSE00000844702chr20:39728696-39728883188TOP1_HUMAN326-388631A:326-38863
1.13ENST0000036133713ENSE00000844703chr20:39729849-39729993145TOP1_HUMAN388-436491A:388-43649
1.14ENST0000036133714ENSE00000844704chr20:39741422-39741565144TOP1_HUMAN437-484481A:437-48448
1.15ENST0000036133715ENSE00000844706chr20:39742610-39742795186TOP1_HUMAN485-546621A:485-54662
1.16ENST0000036133716ENSE00000844709chr20:39744011-3974407969TOP1_HUMAN547-569231A:547-56923
1.17ENST0000036133717ENSE00000844711chr20:39744918-39745032115TOP1_HUMAN570-608391A:570-60839
1.18ENST0000036133718ENSE00000844712chr20:39746809-39746936128TOP1_HUMAN608-650431A:608-65043
1.19ENST0000036133719ENSE00000844716chr20:39750336-3975043095TOP1_HUMAN651-682321A:651-68232
1.20ENST0000036133720ENSE00000844717chr20:39750646-39750795150TOP1_HUMAN682-732511A:682-73251
1.21ENST0000036133721ENSE00001159738chr20:39751835-397531271293TOP1_HUMAN732-765341A:732-76534

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:565
 aligned with TOP1_HUMAN | P11387 from UniProtKB/Swiss-Prot  Length:765

    Alignment length:565
                                   210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760     
           TOP1_HUMAN   201 QKWKWWEEERYPEGIKWKFLEHKGPVFAPPYEPLPENVKFYYDGKVMKLSPKAEEVATFFAKMLDHEYTTKEIFRKNFFKDWRKEMTNEEKNIITNLSKCDFTQMSQYFKAQTEARKQMSKEEKLKIKEENEKLLKEYGFCIMDNHKERIANFKIEPPGLFRGRGNHPKMGMLKRRIMPEDIIINCSKDAKVPSPPPGHKWKEVRHDNKVTWLVSWTENIQGSIKYIMLNPSSRIKGEKDWQKYETARRLKKCVDKIRNQYREDWKSKEMKVRQRAVALYFIDKLALRAGNEKEEGETADTVGCCSLRVEHINLHPELDGQEYVVEFDFLGKDSIRYYNKVPVEKRVFKNLQLFMENKQPEDDLFDRLNTGILNKHLQDLMEGLTAKVFRTYNASITLQQQLKELTAPDENIPAKILSYNRANRAVAILCNHQRAPPKTFEKSMMNLQTKIDAKKEQLADARRDLKSAKADAKVMKDAKTKKVVESKKKAVQRLEEQLMKLEVQATDREENKQIALGTSKLNYLDPRITVAWCKKWGVPIEKIYNKTQREKFAWAIDMADEDYEF 765
               SCOP domains d1t8ia3 A:201-430 Eukaryotic DNA topoisomerase I, N-terminal DNA-binding fragment                                                                                                                                                     d1t8ia2 A:431-633,A:714-765 Eukaryotic DNA topoisomerase I, catalytic core                                                                                                                                 --d1t8ia1 A:636-712 Eukaryotic DNA topoisomerase I, dispensable insert domain  -d1t8ia2 A:431-633,A:714-765                          SCOP domains
               CATH domains 1t8iA01 A:201-231,A:320-431    1t8iA02 A:232-319 Yeast DNA topoisomerase - domain 1                                    1t8iA01 A:201-231,A:320-431 DNA Topoisomerase I, domain 2                                                       1t8iA03 A:432-586 Topoisomerase I; Chain A, domain 3                                                                                                       1t8iA04 A:587-765  [code=1.10.132.10, no name defined]                                                                                                                              CATH domains
               Pfam domains --------------Topoisom_I_N-1t8iA03 A:215-429                                                                                                                                                                                         -Topoisom_I-1t8iA01 A:431-668                                                                                                                                                                                                                  -------------------------Topo_C_assoc-1t8iA02 A:694-765                                           Pfam domains
         Sec.struct. author ...hhhhh...........ee..................eee..eee..hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh.hhhhhh...hhh.eehhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhheeee..eeee............................hhhh.eee.................eee........eeee......eeee.....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhh..................hhhhhhhh.eeeeeee..eeeeeeeeee.hhh.eeeeeee.hhhhhhhhhhhhh............hhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhh.............hhhhhhhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhh.hhhhhhhhhhhh..hhhhh.hhhhhhhhhhhhhh....... Sec.struct. author
                 SAPs(SNPs) -------------S---------------------------------------------------------------------------------------------------------------R-------------------------------------------T------------------------------------------------------------------------------------------------------------------------------------------------------------------G--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------S------A------------------------------------ SAPs(SNPs)
                    PROSITE -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TOPOISOMERASE_I_EUK------------------------------------- PROSITE
           Transcript 1 (1) 1.8  --------------------------------------Exon 1.10  PDB: A:244-284                Exon 1.11  PDB: A:285-325                Exon 1.12  PDB: A:326-388 UniProt: 326-388                     ------------------------------------------------Exon 1.14  PDB: A:437-484 UniProt: 437-484      Exon 1.15  PDB: A:485-546 UniProt: 485-546                    Exon 1.16              Exon 1.17  PDB: A:570-608              ------------------------------------------Exon 1.19  PDB: A:651-682       -------------------------------------------------Exon 1.21  PDB: A:732-765          Transcript 1 (1)
           Transcript 1 (2) ----Exon 1.9  PDB: A:205-244                -----------------------------------------------------------------------------------------------------------------------------------------------Exon 1.13  PDB: A:388-436 UniProt: 388-436       ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------Exon 1.18  PDB: A:608-650 UniProt: 608-650 -------------------------------Exon 1.20  PDB: A:682-732 UniProt: 682-732         --------------------------------- Transcript 1 (2)
                 1t8i A 201 QKWKWWEEERYPEGIKWKFLEHKGPVFAPPYEPLPENVKFYYDGKVMKLSPKAEEVATFFAKMLDHEYTTKEIFRKNFFKDWRKEMTNEEKNIITNLSKCDFTQMSQYFKAQTEARKQMSKEEKLKIKEENEKLLKEYGFCIMDNHKERIANFKIEPPGLFRGRGNHPKMGMLKRRIMPEDIIINCSKDAKVPSPPPGHKWKEVRHDNKVTWLVSWTENIQGSIKYIMLNPSSRIKGEKDWQKYETARRLKKCVDKIRNQYREDWKSKEMKVRQRAVALYFIDKLALRAGNEKEEGETADTVGCCSLRVEHINLHPELDGQEYVVEFDFLGKDSIRYYNKVPVEKRVFKNLQLFMENKQPEDDLFDRLNTGILNKHLQDLMEGLTAKVFRTYNASITLQQQLKELTAPDENIPAKILSYNRANRAVAILCNHQRAPPKTFEKSMMNLQTKIDAKKEQLADARRDLKSAKADAKVMKDAKTKKVVESKKKAVQRLEEQLMKLEVQATDREENKQIALGTSKLNyLDPRITVAWCKKWGVPIEKIYNKTQREKFAWAIDMADEDYEF 765
                                   210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720  |    730       740       750       760     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    723-PTR                                      

Chain B from PDB  Type:DNA  Length:10
                                          
                 1t8i B   1 AAAAAGACTT  10
                                    10

Chain C from PDB  Type:DNA  Length:12
                                            
                 1t8i C  11 gGAAAAATTTTT  22
                            |       20  
                           11-TGP       

Chain D from PDB  Type:DNA  Length:22
                                                      
                 1t8i D 101 AAAAATTTTTCCAAGTCTTTTT 122
                                   110       120  

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (3, 3)

Asymmetric/Biological Unit

(-) CATH Domains  (4, 4)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)
(-)
Class: Mainly Beta (13760)

(-) Pfam Domains  (3, 3)

Asymmetric/Biological Unit
(-)
Clan: DNA-mend (28)

(-) Gene Ontology  (30, 30)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (TOP1_HUMAN | P11387)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003916    DNA topoisomerase activity    Catalysis of the transient cleavage and passage of individual DNA strands or double helices through one another, resulting a topological transformation in double-stranded DNA.
    GO:0003917    DNA topoisomerase type I activity    Catalysis of a DNA topological transformation by transiently cleaving one DNA strand at a time to allow passage of another strand; changes the linking number by +1 per catalytic cycle.
    GO:0003918    DNA topoisomerase type II (ATP-hydrolyzing) activity    Catalysis of a DNA topological transformation by transiently cleaving a pair of complementary DNA strands to form a gate through which a second double-stranded DNA segment is passed, after which the severed strands in the first DNA segment are rejoined; product release is coupled to ATP binding and hydrolysis; changes the linking number in multiples of 2.
    GO:0003682    chromatin binding    Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase.
    GO:0001046    core promoter sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is part of a core promoter region composed of the transcription start site and binding sites for the basal transcription machinery. The transcribed region might be described as a gene, cistron, or operon.
    GO:0016853    isomerase activity    Catalysis of the geometric or structural changes within one molecule. Isomerase is the systematic name for any enzyme of EC class 5.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
biological process
    GO:0006260    DNA replication    The cellular metabolic process in which a cell duplicates one or more molecules of DNA. DNA replication begins when specific sequences, known as origins of replication, are recognized and bound by initiation proteins, and ends when the original DNA molecule has been completely duplicated and the copies topologically separated. The unit of replication usually corresponds to the genome of the cell, an organelle, or a virus. The template for replication can either be an existing DNA molecule or RNA.
    GO:0006265    DNA topological change    The process in which a transformation is induced in the topological structure of a double-stranded DNA helix, resulting in a change in linking number.
    GO:0006338    chromatin remodeling    Dynamic structural changes to eukaryotic chromatin occurring throughout the cell division cycle. These changes range from the local changes necessary for transcriptional regulation to global changes necessary for chromosome segregation.
    GO:0007059    chromosome segregation    The process in which genetic material, in the form of chromosomes, is organized into specific structures and then physically separated and apportioned to two or more sets. In eukaryotes, chromosome segregation begins with the condensation of chromosomes, includes chromosome separation, and ends when chromosomes have completed movement to the spindle poles.
    GO:0032922    circadian regulation of gene expression    Any process that modulates the frequency, rate or extent of gene expression such that an expression pattern recurs with a regularity of approximately 24 hours.
    GO:0007623    circadian rhythm    Any biological process in an organism that recurs with a regularity of approximately 24 hours.
    GO:0040016    embryonic cleavage    The first few specialized divisions of an activated animal egg.
    GO:0016310    phosphorylation    The process of introducing a phosphate group into a molecule, usually with the formation of a phosphoric ester, a phosphoric anhydride or a phosphoric amide.
    GO:0012501    programmed cell death    A process which begins when a cell receives an internal or external signal and activates a series of biochemical events (signaling pathway). The process ends with the death of the cell.
    GO:0016925    protein sumoylation    The process in which a SUMO protein (small ubiquitin-related modifier) is conjugated to a target protein via an isopeptide bond between the carboxyl terminus of SUMO with an epsilon-amino group of a lysine residue of the target protein.
    GO:0042493    response to drug    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a drug stimulus. A drug is a substance used in the diagnosis, treatment or prevention of a disease.
    GO:0048511    rhythmic process    Any process pertinent to the generation and maintenance of rhythms in the physiology of an organism.
    GO:0016032    viral process    A multi-organism process in which a virus is a participant. The other participant is the host. Includes infection of a host cell, replication of the viral genome, and assembly of progeny virus particles. In some cases the viral genetic material may integrate into the host genome and only subsequently, under particular circumstances, 'complete' its life cycle.
cellular component
    GO:0000932    P-body    A focus in the cytoplasm where mRNAs may become inactivated by decapping or some other mechanism. Protein and RNA localized to these foci are involved in mRNA degradation, nonsense-mediated mRNA decay (NMD), translational repression, and RNA-mediated gene silencing.
    GO:0005694    chromosome    A structure composed of a very long molecule of DNA and associated proteins (e.g. histones) that carries hereditary information.
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0000228    nuclear chromosome    A chromosome that encodes the nuclear genome and is found in the nucleus of a eukaryotic cell during the cell cycle phases when the nucleus is intact.
    GO:0005730    nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
    GO:0043204    perikaryon    The portion of the cell soma (neuronal cell body) that excludes the nucleus.
    GO:0031298    replication fork protection complex    A protein complex conserved in eukaryotes and associated with the replication fork; the complex stabilizes stalled replication forks and is thought to be involved in coordinating leading- and lagging-strand synthesis and in replication checkpoint signaling.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    EHD  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    PTR  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    TGP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1t8i)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1t8i
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  TOP1_HUMAN | P11387
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  5.99.1.2
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  0083
    Age Related InformationGenAge
  0201
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  TOP1_HUMAN | P11387
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        TOP1_HUMAN | P113871a31 1a35 1a36 1ej9 1k4s 1k4t 1lpq 1nh3 1r49 1rr8 1rrj 1sc7 1seu 1tl8

(-) Related Entries Specified in the PDB File

1k4t SAME PROTEIN, SAME DNA