2IS2 | PD0899 - JenaLib

Asymmetric/Biological Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:PROTEIN  Length:642
 aligned with UVRD_ECOLI | P03018 from UniProtKB/Swiss-Prot  Length:720

    Alignment length:645
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641     
           UVRD_ECOLI     2 DVSYLLDSLNDKQREAVAAPRSNLLVLAGAGSGKTRVLVHRIAWLMSVENCSPYSIMAVTFTNKAAAEMRHRIGQLMGTSQGGMWVGTFHGLAHRLLRAHHMDANLPQDFQILDSEDQLRLLKRLIKAMNLDEKQWPPRQAMWYINSQKDEGLRPHHIQSYGNPVEQTWQKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPHILQHYRERFTNILVDEFQDTNNIQYAWIRLLAGDTGKVMIVGDDDQSIYGWRGAQVENIQRFLNDFPGAETIRLEQNYRSTSNILSAANALIENNNGRLGKKLWTDGADGEPISLYCAFNELDEARFVVNRIKTWQDNGGALAECAILYRSNAQSRVLEEALLQASMPYRIYGGMRFFERQEIKDALSYLRLIANRNDDAAFERVVNTPTRGIGDRTLDVVRQTSRDRQLTLWQACRELLQEKALAGRAASALQRFMELIDALAQETADMPLHVQTDRVIKDSGLRTMYEQEKGEKGQTRIENLEELVTATRQFSYNEEDEDLMPLQAFLSHAALEAGEGQADTWQDAVQLMTLHSAKGLEFPQVFIVGMEEGMFPSQMSLDEGGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPEECVEEVRL 646
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains 2is2A01 A:2-110,A:190-279 P-loop containing nucleotide triphosphate hydrolases                               2is2A02 A:111-189  [code=1.10.10.160, no name defined]                         2is2A01 A:2-110,A:190-279 P-loop containing nucleotide triphosphate hydrolases            2is2A03 A:280-381,A:550-646 P-loop containing nucleotide triphosphate hydrolases                      2is2A04 A:382-549 PCRA; domain 4                                                                                                                                        2is2A03 A:280-381,A:550-646 P-loop containing nucleotide triphosphate hydrolases                  CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .........hhhhhhhhh.....eeeee....hhhhhhhhhhhhhhhh.......eeeee.hhhhhhhhhhhhhhhh.......eeeehhhhhhhhhhhhhhhhh.....eeehhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhh...........hhhhhhhhhhhhhhhhhhhhhheeehhhhhhhhhhhhhhhhhhhhhhhhhh.eeee.hhhhhhhhhhhhhhhh.....eeeeeehhhhh.........hhhhhhhhhh...eeeee......hhhhhhhhhhhhh...................eeee...hhhhhhhhhhhhhhhhhhh..hhh.eeeee.hhhhhhhhhhhhhhh...eee....hhhhhhhhhhhhhhhhhhhh..hhhhhhhhh.......hhhhhhhhhhhhhhhh.hhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhh..---....hhhhhhhhhhhhh............eeeee.hhhh...eeeeee..........hhhhhh..hhhhhhhhhhhhhh.eeeeeeee....eee..eee....hhhhhhhhhh.ee.... Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------UVRD_HELICASE_ATP_BIND  PDB: A:8-286 UniProt: 8-286                                                                                                                                                                                                                                    UVRD_HELICASE_CTER  PDB: A:287-564 UniProt: 287-564                                                                                                                                                                                                                                   ---------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 2is2 A   2 DVSYLLDSLNDKQREAVAAPRSNLLVLAGAGSGKTRVLVHRIAWLMSVENCSPYSIMAVTFTNKAAAEMRHRIGQLMGTSQGGMWVGTFHGLAHRLLRAHHMDANLPQDFQILDSEDQLRLLKRLIKAMNLDEKQWPPRQAMWYINSQKDEGLRPHHIQSYGNPVEQTWQKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPHILQHYRERFTNILVDEFQDTNNIQYAWIRLLAGDTGKVMIVGDDDQSIYGWRGAQVENIQRFLNDFPGAETIRLEQNYRSTSNILSAANALIENNNGRLGKKLWTDGADGEPISLYCAFNELDEARFVVNRIKTWQDNGGALAECAILYRSNAQSRVLEEALLQASMPYRIYGGMRFFERQEIKDALSYLRLIVNRNDDAAFERVVNTPTRGIGDRTLDVVRQTSRDRQLTLWQACRELLQEKALAGRAASALQRFMELIDALAQETADMPLHVQTDRVIKDSGLRTMYEQEKGEKGQTRIENLEELVTATRQFSY---DEDLMPLQAFLSHAALEAGEGQADTWQDAVQLMTLHSAKGLEFPQVFIVGMEEGMFPSQMSLDEGGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPEECVEEVRL 646
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521   |   531       541       551       561       571       581       591       601       611       621       631       641     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 521 525

Chain B from PDB  Type:PROTEIN  Length:642
 aligned with UVRD_ECOLI | P03018 from UniProtKB/Swiss-Prot  Length:720

    Alignment length:645
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641     
           UVRD_ECOLI     2 DVSYLLDSLNDKQREAVAAPRSNLLVLAGAGSGKTRVLVHRIAWLMSVENCSPYSIMAVTFTNKAAAEMRHRIGQLMGTSQGGMWVGTFHGLAHRLLRAHHMDANLPQDFQILDSEDQLRLLKRLIKAMNLDEKQWPPRQAMWYINSQKDEGLRPHHIQSYGNPVEQTWQKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPHILQHYRERFTNILVDEFQDTNNIQYAWIRLLAGDTGKVMIVGDDDQSIYGWRGAQVENIQRFLNDFPGAETIRLEQNYRSTSNILSAANALIENNNGRLGKKLWTDGADGEPISLYCAFNELDEARFVVNRIKTWQDNGGALAECAILYRSNAQSRVLEEALLQASMPYRIYGGMRFFERQEIKDALSYLRLIANRNDDAAFERVVNTPTRGIGDRTLDVVRQTSRDRQLTLWQACRELLQEKALAGRAASALQRFMELIDALAQETADMPLHVQTDRVIKDSGLRTMYEQEKGEKGQTRIENLEELVTATRQFSYNEEDEDLMPLQAFLSHAALEAGEGQADTWQDAVQLMTLHSAKGLEFPQVFIVGMEEGMFPSQMSLDEGGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPEECVEEVRL 646
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains 2is2B01 B:2-110,B:190-279 P-loop containing nucleotide triphosphate hydrolases                               2is2B02 B:111-189  [code=1.10.10.160, no name defined]                         2is2B01 B:2-110,B:190-279 P-loop containing nucleotide triphosphate hydrolases            2is2B03 B:280-381,B:550-646 P-loop containing nucleotide triphosphate hydrolases                      2is2B04 B:382-549 PCRA; domain 4                                                                                                                                        2is2B03 B:280-381,B:550-646 P-loop containing nucleotide triphosphate hydrolases                  CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .........hhhhhhhhh.......ee.....hhhhhhhhhhhhhhh.........eeee.hhhhhhhhhhhhhhhh.......eeeehhhhhhhhhhhh..........eeehhhhhhhhhhhhhhh........hhhhhhhhhhhhhh............hhhhhhhhhhhhhhhhhhhhhheeehhhhhhhhhhhh..hhhhhhhhhh...ee...hhhhhhhhhhhhhhhhh....ee..eehhhhh.........hhhhhhhhhh..............hhhhhhhhhhhhhh..................ee...eeehhhhhhhhhhhhhhhhhh........eee.hhhhhhhhhhhhhh...........hhhhhhhhhhhhhhhhhhhh..hhhhhhhhh.......hhhhhhhhhhhhhhh..hhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhh...---....hhhhhhhhhhhh................ee.hhhh.......ee...ee....hhhhh....hhhhhhhhhhhhhh......ee..eee..........eehhhhhh.....ee.... Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------UVRD_HELICASE_ATP_BIND  PDB: B:8-286 UniProt: 8-286                                                                                                                                                                                                                                    UVRD_HELICASE_CTER  PDB: B:287-564 UniProt: 287-564                                                                                                                                                                                                                                   ---------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 2is2 B   2 DVSYLLDSLNDKQREAVAAPRSNLLVLAGAGSGKTRVLVHRIAWLMSVENCSPYSIMAVTFTNKAAAEMRHRIGQLMGTSQGGMWVGTFHGLAHRLLRAHHMDANLPQDFQILDSEDQLRLLKRLIKAMNLDEKQWPPRQAMWYINSQKDEGLRPHHIQSYGNPVEQTWQKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPHILQHYRERFTNILVDEFQDTNNIQYAWIRLLAGDTGKVMIVGDDDQSIYGWRGAQVENIQRFLNDFPGAETIRLEQNYRSTSNILSAANALIENNNGRLGKKLWTDGADGEPISLYCAFNELDEARFVVNRIKTWQDNGGALAECAILYRSNAQSRVLEEALLQASMPYRIYGGMRFFERQEIKDALSYLRLIVNRNDDAAFERVVNTPTRGIGDRTLDVVRQTSRDRQLTLWQACRELLQEKALAGRAASALQRFMELIDALAQETADMPLHVQTDRVIKDSGLRTMYEQEKGEKGQTRIENLEELVTATRQFSY---DEDLMPLQAFLSHAALEAGEGQADTWQDAVQLMTLHSAKGLEFPQVFIVGMEEGMFPSQMSLDEGGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPEECVEEVRL 646
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521   |   531       541       551       561       571       581       591       601       611       621       631       641     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 521 525

Chain C from PDB  Type:DNA  Length:33
                                                                 
                 2is2 C   1 CGAGCACTGCACTCGAGTGCAGTGCTCGTTGTT  33
                                    10        20        30

Chain D from PDB  Type:DNA  Length:33
                                                                 
                 2is2 D   1 CGAGCACTGCACTCGAGTGCAGTGCTCGTTGTT  33
                                    10        20        30

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Asymmetric/Biological Unit(hide GO term definitions)

Chain A,B (UVRD_ECOLI | P03018)

molecular function
	GO:0005524	ATP binding	Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
	GO:0004003	ATP-dependent DNA helicase activity	Catalysis of the reaction: ATP + H2O = ADP + phosphate; this reaction drives the unwinding of the DNA helix.
	GO:0003677	DNA binding	Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
	GO:0003678	DNA helicase activity	Catalysis of the reaction: NTP + H2O = NDP + phosphate, to drive the unwinding of a DNA helix.
	GO:0015616	DNA translocase activity	Catalysis of the reaction: ATP + H2O = ADP + phosphate, to drive movement along a single- or double-stranded DNA molecule.
	GO:0004386	helicase activity	Catalysis of the reaction: NTP + H2O = NDP + phosphate, to drive the unwinding of a DNA or RNA helix.
	GO:0016787	hydrolase activity	Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
	GO:0000166	nucleotide binding	Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
	GO:0005515	protein binding	Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
	GO:0017116	single-stranded DNA-dependent ATP-dependent DNA helicase activity	Catalysis of the reaction: ATP + H2O = ADP + phosphate, in the presence of single-stranded DNA; drives the unwinding of a DNA helix.
biological process
	GO:0032508	DNA duplex unwinding	The process in which interchain hydrogen bonds between two strands of DNA are broken or 'melted', generating a region of unpaired single strands.
	GO:0006281	DNA repair	The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway.
	GO:0006260	DNA replication	The cellular metabolic process in which a cell duplicates one or more molecules of DNA. DNA replication begins when specific sequences, known as origins of replication, are recognized and bound by initiation proteins, and ends when the original DNA molecule has been completely duplicated and the copies topologically separated. The unit of replication usually corresponds to the genome of the cell, an organelle, or a virus. The template for replication can either be an existing DNA molecule or RNA.
	GO:0006268	DNA unwinding involved in DNA replication	The process in which interchain hydrogen bonds between two strands of DNA are broken or 'melted', generating unpaired template strands for DNA replication.
	GO:0009432	SOS response	An error-prone process for repairing damaged microbial DNA.
	GO:0006974	cellular response to DNA damage stimulus	Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism.
	GO:0006298	mismatch repair	A system for the correction of errors in which an incorrect base, which cannot form hydrogen bonds with the corresponding base in the parent strand, is incorporated into the daughter strand. The mismatch repair system promotes genomic fidelity by repairing base-base mismatches, insertion-deletion loops and heterologies generated during DNA replication and recombination.
	GO:0006289	nucleotide-excision repair	A DNA repair process in which a small region of the strand surrounding the damage is removed from the DNA helix as an oligonucleotide. The small gap left in the DNA helix is filled in by the sequential action of DNA polymerase and DNA ligase. Nucleotide excision repair recognizes a wide range of substrates, including damage caused by UV irradiation (pyrimidine dimers and 6-4 photoproducts) and chemicals (intrastrand cross-links and bulky adducts).
	GO:0051260	protein homooligomerization	The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of identical component monomers. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer.
	GO:0031297	replication fork processing	The process in which a DNA replication fork that has stalled is restored to a functional state and replication is restarted. The stalling may be due to DNA damage, DNA secondary structure, bound proteins, dNTP shortage, or other causes.
	GO:0070581	rolling circle DNA replication	A DNA-dependent DNA replication process in which a single-stranded DNA molecule is synthesized from a circular duplex template. Replication typically does not cease when one circumference has been replicated, but continues around the circumference several more times, producing a long single strand comprising multimers of the replicon.
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
	GO:0005829	cytosol	The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (2, 2)

Sites (2, 2)

SS Bonds (0, 0)

Cis Peptide Bonds (4, 4)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (2, 4)

Exons (0, 0)

Sequences/Alignments

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (3, 8)

Pfam Domains (0, 0)

Gene Ontology (23, 23)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File