1IPN - JenaLib

Theoretical Model (Jmol Viewer)

Title :   RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS

Authors :   K. Nagano, N. Nagano

Date :   17 May 01 (Deposition) - 30 Sep 03 (Release) - 30 Sep 03 (Revision)

Method :   THEORETICAL MODEL

Resolution :   NOT APPLICABLE

Chains :   Theor. Model : A,B,C,D,E

Keywords :   Termination, Small Ribosomal Rna, Large Ribosomal Rna, Mrna, Trna, Release Factor (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   K. Nagano, N. Nagano
Stereochemical Mechanism Of Translocation, Termination And Codon Recognition Of E. Coli 16S And 23S Ribosomal Rnas
To Be Published
PubMed: search
(for further references see the PDB file header)

Molecule 1 - 16S RIBOSOMAL RNA
	Chains	:	A
	Organism Common	:	BACTERIA
	Organism Scientific	:	ESCHERICHIA COLI

*Molecule 2 - 5'-R(PUPUPUPUPUPUPUPAPAPUPUPU)-3'*
	Chains	:	B
	Organism Common	:	BACTERIA
	Organism Scientific	:	ESCHERICHIA COLI
	Other Details	:	MESSENGER RNA

Molecule 3 - TRANSFER RNA
	Chains	:	C
	Organism Common	:	BACTERIA
	Organism Scientific	:	ESCHERICHIA COLI

Molecule 4 - 23S RIBOSOMAL RNA
	Chains	:	D
	Organism Common	:	BACTERIA
	Organism Scientific	:	ESCHERICHIA COLI

Molecule 5 - PEPTIDE CHAIN RELEASE FACTOR 1
	Chains	:	E
	Organism Common	:	BACTERIA
	Organism Scientific	:	ESCHERICHIA COLI


Theoretical Model	:

Summary Information (see also Sequences/Alignments below)

Theoretical Model (2, 2)

No.	Name	Count	Type	Full Name
1	OMC	1	Mod. Nucleotide	O2'-METHYLYCYTIDINE-5'-MONOPHOSPHATE
2	OMG	1	Mod. Nucleotide	O2'-METHYLGUANOSINE-5'-MONOPHOSPHATE

(no "Site" information available for 1IPN)

(no "SS Bond" information available for 1IPN)

(no "Cis Peptide Bond" information available for 1IPN)

(no "SAP(SNP)/Variant" information available for 1IPN)

(no "PROSITE Motif" information available for 1IPN)

(no "Exon" information available for 1IPN)

Theoretical Model

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:45
                                                                              
                1ipn A 1057 GGCUGUCGUCAGCUCGUGUUGGGUUAAGUCCCGUGACGUCAAGUC 1200
                                  1066      1086      1096  ||  1195     
                                           1075|         1099|           
                                            1086          1189

Chain B from PDB  Type:RNA  Length:12
                                             
                1ipn B 1623 UUUUUUUAAUUU 1634
                                  1632

Chain C from PDB  Type:RNA  Length:6
                                       
                1ipn C 1831 AcUgAA 1836
                             | |  
                          1832-OMC
                            1834-OMG

Chain D from PDB  Type:RNA  Length:9
                                          
                1ipn D 4655 GUACGAGAG 4663

Chain E from PDB  Type:PROTEIN  Length:3
 aligned with RF1_ECO57 | P0A7I2 from UniProtKB/Swiss-Prot  Length:360

    Alignment length:3
           RF1_ECO57    188 PAT  190
               SCOP domains --- SCOP domains
               CATH domains --- CATH domains
               Pfam domains --- Pfam domains
         Sec.struct. author ... Sec.struct. author
                 SAPs(SNPs) --- SAPs(SNPs)
                    PROSITE --- PROSITE
                 Transcript --- Transcript
                1ipn E 8701 PAT 8703

Chain E from PDB  Type:PROTEIN  Length:3
 aligned with RF1_ECOL6 | P0A7I1 from UniProtKB/Swiss-Prot  Length:360

    Alignment length:3
           RF1_ECOL6    188 PAT  190
               SCOP domains --- SCOP domains
               CATH domains --- CATH domains
               Pfam domains --- Pfam domains
         Sec.struct. author ... Sec.struct. author
                 SAPs(SNPs) --- SAPs(SNPs)
                    PROSITE --- PROSITE
                 Transcript --- Transcript
                1ipn E 8701 PAT 8703

Chain E from PDB  Type:PROTEIN  Length:3
 aligned with RF1_ECOLI | P0A7I0 from UniProtKB/Swiss-Prot  Length:360

    Alignment length:3
           RF1_ECOLI    188 PAT  190
               SCOP domains --- SCOP domains
               CATH domains --- CATH domains
               Pfam domains --- Pfam domains
         Sec.struct. author ... Sec.struct. author
                 SAPs(SNPs) --- SAPs(SNPs)
                    PROSITE --- PROSITE
                 Transcript --- Transcript
                1ipn E 8701 PAT 8703

Chain E from PDB  Type:PROTEIN  Length:3
 aligned with RF1_SHIFL | P0A7I3 from UniProtKB/Swiss-Prot  Length:360

    Alignment length:3
           RF1_SHIFL    188 PAT  190
               SCOP domains --- SCOP domains
               CATH domains --- CATH domains
               Pfam domains --- Pfam domains
         Sec.struct. author ... Sec.struct. author
                 SAPs(SNPs) --- SAPs(SNPs)
                    PROSITE --- PROSITE
                 Transcript --- Transcript
                1ipn E 8701 PAT 8703

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

(no "SCOP Domain" information available for 1IPN)

(no "CATH Domain" information available for 1IPN)

(no "Pfam Domain" information available for 1IPN)

Theoretical Model(hide GO term definitions)

Chain E (RF1_ECO57 | P0A7I2)

molecular function
	GO:0003747	translation release factor activity	Involved in catalyzing the release of a nascent polypeptide chain from a ribosome.
	GO:0016149	translation release factor activity, codon specific	A translation release factor that is specific for one or more particular termination codons; acts at the ribosomal A-site and require polypeptidyl-tRNA at the P-site.
biological process
	GO:0006412	translation	The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
	GO:0006415	translational termination	The process resulting in the release of a polypeptide chain from the ribosome, usually in response to a termination codon (UAA, UAG, or UGA in the universal genetic code).
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

Chain E (RF1_ECOLI | P0A7I0)

molecular function
	GO:0043022	ribosome binding	Interacting selectively and non-covalently with any part of a ribosome.
	GO:0003747	translation release factor activity	Involved in catalyzing the release of a nascent polypeptide chain from a ribosome.
	GO:0016149	translation release factor activity, codon specific	A translation release factor that is specific for one or more particular termination codons; acts at the ribosomal A-site and require polypeptidyl-tRNA at the P-site.
biological process
	GO:0006412	translation	The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
	GO:0006415	translational termination	The process resulting in the release of a polypeptide chain from the ribosome, usually in response to a termination codon (UAA, UAG, or UGA in the universal genetic code).
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
	GO:0005829	cytosol	The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.

Chain E (RF1_SHIFL | P0A7I3)

molecular function
	GO:0003747	translation release factor activity	Involved in catalyzing the release of a nascent polypeptide chain from a ribosome.
	GO:0016149	translation release factor activity, codon specific	A translation release factor that is specific for one or more particular termination codons; acts at the ribosomal A-site and require polypeptidyl-tRNA at the P-site.
biological process
	GO:0006412	translation	The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
	GO:0006415	translational termination	The process resulting in the release of a polypeptide chain from the ribosome, usually in response to a termination codon (UAA, UAG, or UGA in the universal genetic code).
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

Chain E (RF1_ECOL6 | P0A7I1)

molecular function
	GO:0003747	translation release factor activity	Involved in catalyzing the release of a nascent polypeptide chain from a ribosome.
	GO:0016149	translation release factor activity, codon specific	A translation release factor that is specific for one or more particular termination codons; acts at the ribosomal A-site and require polypeptidyl-tRNA at the P-site.
biological process
	GO:0006412	translation	The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
	GO:0006415	translational termination	The process resulting in the release of a polypeptide chain from the ribosome, usually in response to a termination codon (UAA, UAG, or UGA in the universal genetic code).
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

Theoretical Model
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		OMC	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		OMG	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
(no "Sites" information available for 1ipn)

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1ipn)

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Theoretical Model PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Access by PDB/NDB ID
	1ipn
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	RF1_ECO57 \| P0A7I2
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt
	RF1_ECOL6 \| P0A7I1
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt
	RF1_ECOLI \| P0A7I0
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt
	RF1_SHIFL \| P0A7I3
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	RF1_ECO57 \| P0A7I2
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)
	RF1_ECOL6 \| P0A7I1
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)
	RF1_ECOLI \| P0A7I0
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)
	RF1_SHIFL \| P0A7I3
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)

UniProtKB/Swiss-Prot
	RF1_ECOLI \| P0A7I0	:	2b3t 5j30 5j3c 5j4d

1ip8	MODEL 1
1ipl	MODEL 2
1ipm	MODEL 3
1ipo	MODEL 5
1ipq	MODEL 6
1ipr	MODEL 7
1ipu	MODEL 8
1ipv	MODEL 9
1ipx	MODEL 10
1ipy	MODEL 11
1ipz	MODEL 12

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (2, 2)

Sites (0, 0)

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (7, 22)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File