Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF ARCHAEOGLOBUS FULGIDUS ALANYL-TRNA SYNTHETASE IN COMPLEX WITH A TRNA(ALA) VARIANT HAVING A3.U70
 
Authors :  M. Naganuma, S. Sekine, S. Yokoyama
Date :  05 Feb 14  (Deposition) - 18 Jun 14  (Release) - 02 Jul 14  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.49
Chains :  Asym./Biol. Unit :  A,B,C
Keywords :  Aminoacyl-Trna Synthetases, Protein-Rna Complex, Homodimer, Ligase, Alanyladenylate Analogue, Ligase-Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  M. Naganuma, S. Sekine, Y. E. Chong, M. Guo, X. L. Yang, H. Gamper, Y. M. Hou, P. Schimmel, S. Yokoyama
The Selective Trna Aminoacylation Mechanism Based On A Single G. U Pair
Nature V. 510 507 2014
PubMed-ID: 24919148  |  Reference-DOI: 10.1038/NATURE13440

(-) Compounds

Molecule 1 - ALANINE--TRNA LIGASE
    Chains: A, B
    EC Number: 6.1.1.7
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PET26B
    Expression System Strain: ROSSETA2
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: AF_2255, ALAS
    Organism Scientific: ARCHAEOGLOBUS FULGIDUS
    Organism Taxid: 224325
    Strain: DSM 4304
    Synonym: ALANYL-TRNA SYNTHETASE, ALARS
 
Molecule 2 - RNA (75-MER)
    Chains: C
    Engineered: YES
    Organism Scientific: ARCHAEOGLOBUS FULGIDUS
    Organism Taxid: 224325
    Synthetic: YES

 Structural Features

(-) Chains, Units

  123
Asymmetric/Biological Unit : ABC

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 4)

Asymmetric/Biological Unit (2, 4)
No.NameCountTypeFull Name
1A5A2Ligand/Ion'5'-O-(N-(L-ALANYL)-SULFAMOYL)ADENOSINE
2ZN2Ligand/IonZINC ION

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREARG A:128 , LEU A:142 , PHE A:145 , MET A:147 , TRP A:191 , GLU A:209 , VAL A:210 , ALA A:211 , THR A:212 , ASP A:242 , THR A:243 , GLY A:244 , GLY A:246 , ARG A:249BINDING SITE FOR RESIDUE A5A A 1001
2AC2SOFTWAREHIS A:604 , CYS A:703BINDING SITE FOR RESIDUE ZN A 1002
3AC3SOFTWAREARG B:128 , ASP B:131 , HIS B:141 , LEU B:142 , PHE B:145 , MET B:147 , TRP B:191 , GLU B:209 , VAL B:210 , ALA B:211 , THR B:212 , ASP B:242 , THR B:243 , GLY B:244 , ARG B:249BINDING SITE FOR RESIDUE A5A B 1001
4AC4SOFTWAREHIS B:600 , HIS B:604 , CYS B:703BINDING SITE FOR RESIDUE ZN B 1002

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3WQZ)

(-) Cis Peptide Bonds  (6, 6)

Asymmetric/Biological Unit
No.Residues
1Cys A:40 -Gly A:41
2Pro A:43 -Pro A:44
3Gln A:105 -Pro A:106
4Asn A:118 -Pro A:119
5Gln B:105 -Pro B:106
6Asn B:118 -Pro B:119

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3WQZ)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_II_ALAPS50860 Alanyl-transfer RNA synthetases family profile.SYA_ARCFU60-746
 		  2A:60-746
B:60-746

(-) Exons   (0, 0)

(no "Exon" information available for 3WQZ)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:905
 aligned with SYA_ARCFU | O28029 from UniProtKB/Swiss-Prot  Length:906

    Alignment length:905
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901     
           SYA_ARCFU      2 TLDEEYLDITFLTENGFVRKRCPKCGKHFWTADPEREICGDPPCESYSFIGNPVFKKPFELDEMREYYLNFFERRGHGRIERYPVVARWRTDIYLTIASIADFQPFVTSGVAPPPANPLTISQPCIRLDDLDSVGRTGRHLTLFEMMAHHAFNYPGKEIYWKNETVAYCTELLNELGVKKEDIVYKEEPWAGGGNAGPCLEAIVGGLEVATLVFMNLEEHPEGDIEIKGARYRKMDNYIVDTGYGLERFVWASKGTPTVYDAIFPEVVDTIIDNSNVSFNREDERVRRIVAESSKLAGIMGELRGERLNQLRKSVADTVGVSVEELEGIVVPLEKVYSLADHTRCILFMLGDGLVPSNAGAGYLARLMIRRSLRLAEELELGLDLYDLVEMHKKILGFEFDVPLSTVQEILELEKERYRTTVSKGTRLVERLVERKKKLEKDDLIELYDSHGIPVELAVGIAAEKGAEVEMPKDIYAELAKRHSKAEKVQEKKITLQNEYPATEKLYYDDPTLLEFEAEVIGVEGDFVILNRSAFYPESGGQDNDVGYLIANGGKFEVVDVLEADGVVLHVVKGAKPEVGTKVKGVIDSDVRWRHMRHHSATHVLLYSLQKVLGNHVWQAGARKEFSKARLDVTHFRRPSEEEIKEIEMLANREILANKPIKWEWMDRIEAERKFGFRLYQGGVPPGRKIRVVQVGDDVQACGGTHCRSTGEIGMLKILKVESIQDGVIRFEFAAGEAAIEAVEEMERLLREASSILRVEPAKLPKTVERFFEEWKDQRKEIERLKSVIADLWADILMERAEEFDSMKVVAEVVDADMQALQKLAERLAEKGAVGCLMAKGEGKVFVVTFSGQKYDARELLREIGRVAKGSGGGRKDVAQGAVQQLLDREEMLDVIFRFLSEHEG  906
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhh.hhhhhhh..eeeee....eeeee............................hhhhhhhhhhhhhhh...ee..................hhhhhh...............eeeeeeee.hhhhhhh........eeeeee..eee.......hhhhhhhhhhhhhhh........eeeeeeeee..eeeeeeeeee..eeeeeeeeeeeee.....eee..eeeeeeeeeeeeeeeehhhhhhhhhh...hhhhhhhhhhhhhhhhh.......hhhhhhhhhhhh...hhhhhh...hhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhh.hhhhhhhhhhhh...........hhhhhhh....................ee..............eeeee..eeee.ee..............eee....eee..eeeee..eeeee................hhhhhhhhhhhhhhhhhhhhhhhhhh.....eeeee......eeee......hhhhhhhhhhhhhhhhhhh..eeeeeeehhhhhhhhhhhhhh.......eeeeeee..eee...............eeeeeeeeee..eeeeeeeehhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.eee..eeeeeee...hhhhhhhhhhhhhhh..eeeeeee....eeeeeee....hhhhhhhhh.......ee....eeeeee....hhhhhhhhhhhhhh.... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------AA_TRNA_LIGASE_II_ALA  PDB: A:60-746 UniProt: 60-746                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                3wqz A    2 TLDEEYLDITFLTENGFVRKRCPKCGKHFWTADPEREICGDPPCESYSFIGNPVFKKPFELDEMREYYLNFFERRGHGRIERYPVVARWRTDIYLTIASIADFQPFVTSGVAPPPANPLTISQPCIRLDDLDSVGRTGRHLTLFEMMAHHAFNYPGKEIYWKNETVAYCTELLNELGVKKEDIVYKEEPWAGGGNAGPCLEAIVGGLEVATLVFMNLEEHPEGDIEIKGARYRKMDNYIVDTGYGLERFVWASKGTPTVYDAIFPEVVDTIIDNSNVSFNREDERVRRIVAESSKLAGIMGELRGERLNQLRKSVADTVGVSVEELEGIVVPLEKVYSLADHTRCILFMLGDGLVPSNAGAGYLARLMIRRSLRLAEELELGLDLYDLVEMHKKILGFEFDVPLSTVQEILELEKERYRTTVSKGTRLVERLVERKKKLEKDDLIELYDSHGIPVELAVGIAAEKGAEVEMPKDIYAELAKRHSKAEKVQEKKITLQNEYPATEKLYYDDPTLLEFEAEVIGVEGDFVILNRSAFYPESGGQDNDVGYLIANGGKFEVVDVLEADGVVLHVVKGAKPEVGTKVKGVIDSDVRWRHMRHHSATHVLLYSLQKVLGNHVWQAGARKEFSKARLDVTHFRRPSEEEIKEIEMLANREILANKPIKWEWMDRIEAERKFGFRLYQGGVPPGRKIRVVQVGDDVQACGGTHCRSTGEIGMLKILKVESIQDGVIRFEFAAGEAAIEAVEEMERLLREASSILRVEPAKLPKTVERFFEEWKDQRKEIERLKSVIADLWADILMERAEEFDSMKVVAEVVDADMQALQKLAERLAEKGAVGCLMAKGEGKVFVVTFSGQKYDARELLREIGRVAKGSGGGRKDVAQGAVQQLLDREEMLDVIFRFLSEHEG  906
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901     


Chain B from PDB  Type:PROTEIN  Length:904
 aligned with SYA_ARCFU | O28029 from UniProtKB/Swiss-Prot  Length:906

    Alignment length:904
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790       800       810       820       830       840       850       860       870       880       890       900    
           SYA_ARCFU      1 MTLDEEYLDITFLTENGFVRKRCPKCGKHFWTADPEREICGDPPCESYSFIGNPVFKKPFELDEMREYYLNFFERRGHGRIERYPVVARWRTDIYLTIASIADFQPFVTSGVAPPPANPLTISQPCIRLDDLDSVGRTGRHLTLFEMMAHHAFNYPGKEIYWKNETVAYCTELLNELGVKKEDIVYKEEPWAGGGNAGPCLEAIVGGLEVATLVFMNLEEHPEGDIEIKGARYRKMDNYIVDTGYGLERFVWASKGTPTVYDAIFPEVVDTIIDNSNVSFNREDERVRRIVAESSKLAGIMGELRGERLNQLRKSVADTVGVSVEELEGIVVPLEKVYSLADHTRCILFMLGDGLVPSNAGAGYLARLMIRRSLRLAEELELGLDLYDLVEMHKKILGFEFDVPLSTVQEILELEKERYRTTVSKGTRLVERLVERKKKLEKDDLIELYDSHGIPVELAVGIAAEKGAEVEMPKDIYAELAKRHSKAEKVQEKKITLQNEYPATEKLYYDDPTLLEFEAEVIGVEGDFVILNRSAFYPESGGQDNDVGYLIANGGKFEVVDVLEADGVVLHVVKGAKPEVGTKVKGVIDSDVRWRHMRHHSATHVLLYSLQKVLGNHVWQAGARKEFSKARLDVTHFRRPSEEEIKEIEMLANREILANKPIKWEWMDRIEAERKFGFRLYQGGVPPGRKIRVVQVGDDVQACGGTHCRSTGEIGMLKILKVESIQDGVIRFEFAAGEAAIEAVEEMERLLREASSILRVEPAKLPKTVERFFEEWKDQRKEIERLKSVIADLWADILMERAEEFDSMKVVAEVVDADMQALQKLAERLAEKGAVGCLMAKGEGKVFVVTFSGQKYDARELLREIGRVAKGSGGGRKDVAQGAVQQLLDREEMLDVIFRFLSEH  904
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhh.........eeee......eeee............................hhhhhhhhhhhhhhh...ee...................hhhhh...............eeeeeeee.hhhh...........eeeeeeeeeee.......hhhhhhhhhhhhhhh........eeeeeee....eeeeeeeee......eeeeeeeeee.....eee..eeeeeeeeeeeeeeeehhhhhhhhhh..hhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhh.hhhhhh.hhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.eehhhhhhhhhhhhh.hhhhhhhhhhhh..ee....hhhhhhhhhh....................ee.........eeee.............ee.............eeee....eeee..eeee..eeee............eeeeehhhhhhhhhhhhhhhhhhhhhhhhhh.....eeeee......eeeee.....hhhhhhhhhhhhhhhhhhh....eeeeehhhhhhhhhhhhhh.......eeeeeee..eeee.......hhhhh......eeeeee..eeeee...hhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.eee..eeeeeee...hhhhhhhhhhhhhhhh.eeeeee.....eeeeeee....hhhhhhhhhhhhhheeeee...eeeeee....hhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -----------------------------------------------------------AA_TRNA_LIGASE_II_ALA  PDB: B:60-746 UniProt: 60-746                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                3wqz B    1 MTLDEEYLDITFLTENGFVRKRCPKCGKHFWTADPEREICGDPPCESYSFIGNPVFKKPFELDEMREYYLNFFERRGHGRIERYPVVARWRTDIYLTIASIADFQPFVTSGVAPPPANPLTISQPCIRLDDLDSVGRTGRHLTLFEMMAHHAFNYPGKEIYWKNETVAYCTELLNELGVKKEDIVYKEEPWAGGGNAGPCLEAIVGGLEVATLVFMNLEEHPEGDIEIKGARYRKMDNYIVDTGYGLERFVWASKGTPTVYDAIFPEVVDTIIDNSNVSFNREDERVRRIVAESSKLAGIMGELRGERLNQLRKSVADTVGVSVEELEGIVVPLEKVYSLADHTRCILFMLGDGLVPSNAGAGYLARLMIRRSLRLAEELELGLDLYDLVEMHKKILGFEFDVPLSTVQEILELEKERYRTTVSKGTRLVERLVERKKKLEKDDLIELYDSHGIPVELAVGIAAEKGAEVEMPKDIYAELAKRHSKAEKVQEKKITLQNEYPATEKLYYDDPTLLEFEAEVIGVEGDFVILNRSAFYPESGGQDNDVGYLIANGGKFEVVDVLEADGVVLHVVKGAKPEVGTKVKGVIDSDVRWRHMRHHSATHVLLYSLQKVLGNHVWQAGARKEFSKARLDVTHFRRPSEEEIKEIEMLANREILANKPIKWEWMDRIEAERKFGFRLYQGGVPPGRKIRVVQVGDDVQACGGTHCRSTGEIGMLKILKVESIQDGVIRFEFAAGEAAIEAVEEMERLLREASSILRVEPAKLPKTVERFFEEWKDQRKEIERLKSVIADLWADILMERAEEFDSMKVVAEVVDADMQALQKLAERLAEKGAVGCLMAKGEGKVFVVTFSGQKYDARELLREIGRVAKGSGGGRKDVAQGAVQQLLDREEMLDVIFRFLSEH  904
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790       800       810       820       830       840       850       860       870       880       890       900    


Chain C from PDB  Type:RNA  Length:75
                                                                                                            
                3wqz C 1601 GGACUCGUAGCUCAGCGGGAGAGCGCCGCCUUUGCGAGGCGGAGGCCGCGGGUUCAAAUCCCGCCGAGUCCACCA 1676
                                  1610     |1621      1631      1641      1651      1661      1671     
                                        1616|                                                          
                                         1618
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 3WQZ)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 3WQZ)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 3WQZ)

(-) Gene Ontology  (17, 17)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (SYA_ARCFU | O28029)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0004813    alanine-tRNA ligase activity    Catalysis of the reaction: ATP + L-alanine + tRNA(Ala) = AMP + diphosphate + L-alanyl-tRNA(Ala).
    GO:0002161    aminoacyl-tRNA editing activity    The hydrolysis of an incorrectly aminoacylated tRNA.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0016876    ligase activity, forming aminoacyl-tRNA and related compounds    Catalysis of the joining of an amino acid and a nucleic acid (usually tRNA) or poly(ribitol phosphate), with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate. The reaction forms an aminoacyl-tRNA or a related compound.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0000049    tRNA binding    Interacting selectively and non-covalently with transfer RNA.
    GO:0008270    zinc ion binding    Interacting selectively and non-covalently with zinc (Zn) ions.
biological process
    GO:0006419    alanyl-tRNA aminoacylation    The process of coupling alanine to alanyl-tRNA, catalyzed by alanyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA.
    GO:0006450    regulation of translational fidelity    Any process that modulates the ability of the translational apparatus to interpret the genetic code.
    GO:0043039    tRNA aminoacylation    The chemical reactions and pathways by which the various amino acids become bonded to their corresponding tRNAs. The most common route for synthesis of aminoacyl tRNA is by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, usually catalyzed by the cognate aminoacyl-tRNA ligase. A given aminoacyl-tRNA ligase aminoacylates all species of an isoaccepting group of tRNA molecules.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    A5A  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ZN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Asn A:118 - Pro A:119   [ RasMol ]  
    Asn B:118 - Pro B:119   [ RasMol ]  
    Cys A:40 - Gly A:41   [ RasMol ]  
    Gln A:105 - Pro A:106   [ RasMol ]  
    Gln B:105 - Pro B:106   [ RasMol ]  
    Pro A:43 - Pro A:44   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  3wqz
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  SYA_ARCFU | O28029
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  6.1.1.7
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  SYA_ARCFU | O28029
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        SYA_ARCFU | O28029: 2ztg 2zvf 3wqy

(-) Related Entries Specified in the PDB File

3wqy