Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF A LAMBDA INTEGRASE TETRAMER BOUND TO A HOLLIDAY JUNCTION
 
Authors :  T. Biswas, H. Aihara, M. Radman-Livaja, D. Filman, A. Landy, T. Ellenbe
Date :  03 Mar 05  (Deposition) - 28 Jun 05  (Release) - 13 Jul 11  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  4.40
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F,G,H,I,J,K,L
Keywords :  Protein-Dna Complex, Dna Binding Protein-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  T. Biswas, H. Aihara, M. Radman-Livaja, D. Filman, A. Landy, T. Ellenberger
A Structural Basis For Allosteric Control Of Dna Recombination By Lambda Integrase.
Nature V. 435 1059 2005
PubMed-ID: 15973401  |  Reference-DOI: 10.1038/NATURE03657

(-) Compounds

Molecule 1 - 29-MER
    Chains: I
    Engineered: YES
    Synthetic: YES
 
Molecule 2 - 29-MER
    Chains: J
    Engineered: YES
    Synthetic: YES
 
Molecule 3 - 29-MER
    Chains: K
    Engineered: YES
    Synthetic: YES
 
Molecule 4 - 29-MER
    Chains: L
    Engineered: YES
    Synthetic: YES
 
Molecule 5 - 5'-D(*AP*CP*AP*GP*GP*TP*CP*AP*CP*TP*AP*TP*CP*AP*GP*TP*CP*AP *AP*AP*AP*TP*AP*CP*C)-3'
    Chains: E, G
    Engineered: YES
    Synthetic: YES
 
Molecule 6 - 25-MER
    Chains: F, H
    Engineered: YES
    Synthetic: YES
 
Molecule 7 - INTEGRASE
    Chains: A, B, C, D
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Strain: BL21(DE3)-RIL
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: INT
    Mutation: YES
    Organism Scientific: ENTEROBACTERIA PHAGE LAMBDA
    Organism Taxid: 10710

 Structural Features

(-) Chains, Units

  123456789101112
Asymmetric/Biological Unit : ABCDEFGHIJKL

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 26)

Asymmetric/Biological Unit (1, 26)
No.NameCountTypeFull Name
1MSE26Mod. Amino AcidSELENOMETHIONINE

(-) Sites  (0, 0)

(no "Site" information available for 1Z1G)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1Z1G)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1Z1G)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1Z1G)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1Z1G)

(-) Exons   (0, 0)

(no "Exon" information available for 1Z1G)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:349
 aligned with VINT_LAMBD | P03700 from UniProtKB/Swiss-Prot  Length:356

    Alignment length:349
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257       267       277       287       297       307       317       327       337       347         
           VINT_LAMBD     8 ERRDLPPNLYIRNNGYYCYRDPRTGKEFGLGRDRRIAITEAIQANIELFSGHKHKPLTARINSDNSVTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPLEDITTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQYRDDRGREWDKIEIK 356
               SCOP domains ---d1z1ga1 A:11-59                                  ---------------------------------------------------------------------------------------------------------------------d1z1ga2 A:177-355 Integrase (Int)                                                                                                                                                  - SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ........eee.....eeee......eee...hhhhhhhhhhhhhhhh.........hhhhhh....hhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhh......hhhhh............hhhhhhhhhhhhhhh.hhhhhhhhhhhhhh.hhhhhhhhhhh.ee..eeeee......eeeee...ee....eehhhhhhhhhhhh..............hhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhhhhhhh..................ee.... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1z1g A   8 ERRDLPPNLYIRNNGYYCYRDPRTGKEFGLGRDRRIAITEAIQANIELFSGHKHKPLTARINSDNSVTLHSWLDRYEKILASRGIKQKTLINYmSKIKAIRRGLPDAPLEDITTKEIAAmLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAmELAVVTGQRVGDLCEmKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISmKETLDKCKEILGGETIIASTRREPLSSGTVSRYFmRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTmASQFRDDRGREWDKIEIK 356
                                    17        27        37        47        57        67        77        87        97   |   107       117       127       137       147       157       167       177       187       197     | 207       217 |     227       237       247       257       267       277       287  |    297       307       317       327       337|      347         
                                                                                                                       101-MSE                   127-MSE                                                                     203-MSE         219-MSE                             255-MSE                            290-MSE                                         338-MSE              


Chain B from PDB  Type:PROTEIN  Length:336
 aligned with VINT_LAMBD | P03700 from UniProtKB/Swiss-Prot  Length:356

    Alignment length:347
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339       349       
           VINT_LAMBD    10 RDLPPNLYIRNNGYYCYRDPRTGKEFGLGRDRRIAITEAIQANIELFSGHKHKPLTARINSDNSVTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPLEDITTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQYRDDRGREWDKIEIK 356
               SCOP domains -d1z1gb1 B:11-59                                  ---------------------------------------------------------------------------------------------------------------------d1z1gb2 B:177-355 Integrase (Int)                                                                                                                                                  - SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ......eee.....eeee......eee...hhhhhhhhhhhhhhhh...................hhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhh......hhhhh............hhhhhhhhhhhhhhh.hhhhhhhhhhhhhh.hhhhhhhhhhh.ee..eeeee......eeeee...ee....eehhhhhhhhhhhh..............hhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhhhhhhh.....-----------........ Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1z1g B  10 RDLPPNLYIRNNGYYCYRDPRTGKEFGLGRDRRIAITEAIQANIELFSGHKHKPLTARINSDNSVTLHSWLDRYEKILASRGIKQKTLINYmSKIKAIRRGLPDAPLEDITTKEIAAmLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAmELAVVTGQRVGDLCEmKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISmKETLDKCKEILGGETIIASTRREPLSSGTVSRYFmRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDT-----------EWDKIEIK 356
                                    19        29        39        49        59        69        79        89        99 |     109       119       129       139       149       159       169       179       189       199   |   209       219       229       239       249     | 259       269       279       289|      299       309       319       329       | -       349       
                                                                                                                     101-MSE                   127-MSE                                                                     203-MSE         219-MSE                             255-MSE                            290-MSE                                        337         349       


Chain C from PDB  Type:PROTEIN  Length:349
 aligned with VINT_LAMBD | P03700 from UniProtKB/Swiss-Prot  Length:356

    Alignment length:349
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257       267       277       287       297       307       317       327       337       347         
           VINT_LAMBD     8 ERRDLPPNLYIRNNGYYCYRDPRTGKEFGLGRDRRIAITEAIQANIELFSGHKHKPLTARINSDNSVTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPLEDITTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQYRDDRGREWDKIEIK 356
               SCOP domains ---d1z1gc1 C:11-59                                  ---------------------------------------------------------------------------------------------------------------------d1z1gc2 C:177-355 Integrase (Int)                                                                                                                                                  - SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ........eee.....eeee......eee...hhhhhhhhhhhhhhhh.......hhhhhhhh....hhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhh......hhhhh............hhhhhhhhhhhh...hhhhhhhhhhhhhhh.hhhhhhhhhhh.ee..eeeee......eeeee...ee....eehhhhhhhhhhhh..............hhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhhhhhh......................... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1z1g C   8 ERRDLPPNLYIRNNGYYCYRDPRTGKEFGLGRDRRIAITEAIQANIELFSGHKHKPLTARINSDNSVTLHSWLDRYEKILASRGIKQKTLINYmSKIKAIRRGLPDAPLEDITTKEIAAmLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAmELAVVTGQRVGDLCEmKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISmKETLDKCKEILGGETIIASTRREPLSSGTVSRYFmRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTmASQFRDDRGREWDKIEIK 356
                                    17        27        37        47        57        67        77        87        97   |   107       117       127       137       147       157       167       177       187       197     | 207       217 |     227       237       247       257       267       277       287  |    297       307       317       327       337|      347         
                                                                                                                       101-MSE                   127-MSE                                                                     203-MSE         219-MSE                             255-MSE                            290-MSE                                         338-MSE              


Chain D from PDB  Type:PROTEIN  Length:336
 aligned with VINT_LAMBD | P03700 from UniProtKB/Swiss-Prot  Length:356

    Alignment length:347
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339       349       
           VINT_LAMBD    10 RDLPPNLYIRNNGYYCYRDPRTGKEFGLGRDRRIAITEAIQANIELFSGHKHKPLTARINSDNSVTLHSWLDRYEKILASRGIKQKTLINYMSKIKAIRRGLPDAPLEDITTKEIAAMLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAMELAVVTGQRVGDLCEMKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISMKETLDKCKEILGGETIIASTRREPLSSGTVSRYFMRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDTMASQYRDDRGREWDKIEIK 356
               SCOP domains -d1z1gd1 D:11-59                                  ---------------------------------------------------------------------------------------------------------------------d1z1gd2 D:177-355 Integrase (Int)                                                                                                                                                  - SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
           Pfam domains (1) Phage_integ_N-1z1gD09 D:10-76                                      ---Phage_integr_N-1z1gD05 D:80-158                                                -------------------Phage_integrase-1z1gD01 D:178-349                                                                                                                                           ------- Pfam domains (1)
           Pfam domains (2) Phage_integ_N-1z1gD10 D:10-76                                      ---Phage_integr_N-1z1gD06 D:80-158                                                -------------------Phage_integrase-1z1gD02 D:178-349                                                                                                                                           ------- Pfam domains (2)
           Pfam domains (3) Phage_integ_N-1z1gD11 D:10-76                                      ---Phage_integr_N-1z1gD07 D:80-158                                                -------------------Phage_integrase-1z1gD03 D:178-349                                                                                                                                           ------- Pfam domains (3)
           Pfam domains (4) Phage_integ_N-1z1gD12 D:10-76                                      ---Phage_integr_N-1z1gD08 D:80-158                                                -------------------Phage_integrase-1z1gD04 D:178-349                                                                                                                                           ------- Pfam domains (4)
         Sec.struct. author ......eee.....eeee......eee...hhhhhhhhhhhhhhhh...................hhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhh......hhhhh............hhhhhhhhhhhhhhh.hhhhhhhhhhhhhh.hhhhhhhhhhh.ee..eeeee......eeeee...ee....eehhhhhhhhhhhh..............hhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhhhhhh......-----------..ee.... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1z1g D  10 RDLPPNLYIRNNGYYCYRDPRTGKEFGLGRDRRIAITEAIQANIELFSGHKHKPLTARINSDNSVTLHSWLDRYEKILASRGIKQKTLINYmSKIKAIRRGLPDAPLEDITTKEIAAmLNGYIDEGKAASAKLIRSTLSDAFREAIAEGHITTNHVAATRAAKSEVRRSRLTADEYLKIYQAAESSPCWLRLAmELAVVTGQRVGDLCEmKWSDIVDGYLYVEQSKTGVKIAIPTALHIDALGISmKETLDKCKEILGGETIIASTRREPLSSGTVSRYFmRARKASGLSFEGDPPTFHELRSLSARLYEKQISDKFAQHLLGHKSDT-----------EWDKIEIK 356
                                    19        29        39        49        59        69        79        89        99 |     109       119       129       139       149       159       169       179       189       199   |   209       219       229       239       249     | 259       269       279       289|      299       309       319       329       | -       349       
                                                                                                                     101-MSE                   127-MSE                                                                     203-MSE         219-MSE                             255-MSE                            290-MSE                                        337         349       


Chain E from PDB  Type:DNA  Length:24
                                                        
                 1z1g E   1 ACAGGTCACTATCAGTCAAAATAC  24
                                    10        20    


Chain F from PDB  Type:DNA  Length:25
                                                         
                 1z1g F   1 GGTATTTTGACTGATAGTGACCTGT  25
                                    10        20     


Chain G from PDB  Type:DNA  Length:24
                                                        
                 1z1g G   1 ACAGGTCACTATCAGTCAAAATAC  24
                                    10        20    


Chain H from PDB  Type:DNA  Length:25
                                                         
                 1z1g H   1 GGTATTTTGACTGATAGTGACCTGT  25
                                    10        20     


Chain I from PDB  Type:DNA  Length:29
                                                             
                 1z1g I   1 AACTCTGCTTTTTACAACAAAGTTGGATC  29
                                    10        20         


Chain J from PDB  Type:DNA  Length:29
                                                             
                 1z1g J   1 CGCTCAAGTTTATATTAAAAAGCAGAGTT  29
                                    10        20         


Chain K from PDB  Type:DNA  Length:29
                                                             
                 1z1g K   1 TTGCCAGCTTTATTATATAAACTTGAGCG  29
                                    10        20         


Chain L from PDB  Type:DNA  Length:29
                                                             
                 1z1g L   1 GATCCAACTTTGTTGAATAAAGCTGGCAA  29
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 8)

Asymmetric/Biological Unit
(-)
Class: Alpha and beta proteins (a+b) (23004)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 1Z1G)

(-) Pfam Domains  (3, 12)

Asymmetric/Biological Unit
(-)
Clan: DNA-mend (28)
(-)
Clan: l-integrase_N (5)
(-)
Clan: no clan defined [family: Phage_integ_N] (7)

(-) Gene Ontology  (9, 9)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B,C,D   (VINT_LAMBD | P03700)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0008907    integrase activity    Catalysis of the integration of one segment of DNA into another.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
    GO:0015074    DNA integration    The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Intrachromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.
    GO:0075713    establishment of integrated proviral latency    A process by which the virus integrates into the host genome and establishes as a stable provirus or prophage.
    GO:0046718    viral entry into host cell    The process that occurs after viral attachment by which a virus, or viral nucleic acid, breaches the plasma membrane or cell envelope and enters the host cell. The process ends when the viral nucleic acid is released into the host cell cytoplasm.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    MSE  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
(no "Sites" information available for 1z1g)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1z1g)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1z1g
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  VINT_LAMBD | P03700
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  VINT_LAMBD | P03700
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        VINT_LAMBD | P03700: 1ae9 1kjk 1m97 1p7d 1z19 1z1b 2oxo 2wcc 5j0n

(-) Related Entries Specified in the PDB File

1kjk 1p7d 1z19 1z1b