|
|
|
|
|
|
Summary Information (see also Sequences/Alignments below) |
NMR Structure (1, 2)
|
NMR Structure (2, 2)
|
(no "SS Bond" information available for 1CO0) |
(no "Cis Peptide Bond" information available for 1CO0) |
(no "SAP(SNP)/Variant" information available for 1CO0) |
(no "PROSITE Motif" information available for 1CO0) |
(no "Exon" information available for 1CO0) |
NMR StructureChain A from PDB Type:PROTEIN Length:105 aligned with TRPR_ECOLI | P0A881 from UniProtKB/Swiss-Prot Length:108 Alignment length:105 13 23 33 43 53 63 73 83 93 103 TRPR_ECOLI 4 QSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSD 108 SCOP domains d1co0a_ A: Trp repressor, TrpR SCOP domains CATH domains 1co0A00 A:4-108 Trp Operon Repressor; Chain A CATH domains Pfam domains --------------------------------------------------------------------------------------------------------- Pfam domains SAPs(SNPs) --------------------------------------------------------------------------------------------------------- SAPs(SNPs) PROSITE --------------------------------------------------------------------------------------------------------- PROSITE Transcript --------------------------------------------------------------------------------------------------------- Transcript 1co0 A 4 QSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSD 108 13 23 33 43 53 63 73 83 93 103 Chain B from PDB Type:PROTEIN Length:107 aligned with TRPR_ECOLI | P0A881 from UniProtKB/Swiss-Prot Length:108 Alignment length:107 108 13 23 33 43 53 63 73 83 93 103 | TRPR_ECOLI 4 QSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSD-- - SCOP domains d1co0b_ B: Trp repressor, TrpR SCOP domains CATH domains 1co0B00 B:4-108 Trp Operon Repressor; Chain A -- CATH domains Pfam domains ----------------------------------------------------------------------------------------------------------- Pfam domains SAPs(SNPs) ----------------------------------------------------------------------------------------------------------- SAPs(SNPs) PROSITE ----------------------------------------------------------------------------------------------------------- PROSITE Transcript ----------------------------------------------------------------------------------------------------------- Transcript 1co0 B 4 QSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSDWW 201 13 23 33 43 53 63 73 83 93 103 ||| 108|| 109| 201 Chain E from PDB Type:DNA Length:20 1co0 E 1 TGTACTCGTGTACTGGTACA 20 10 20 Chain F from PDB Type:DNA Length:20 1co0 F 1 TGTACCAGTACACGAGTACA 20 10 20
|
NMR Structure
|
NMR Structure |
(no "Pfam Domain" information available for 1CO0) |
NMR Structure(hide GO term definitions) Chain A,B (TRPR_ECOLI | P0A881)
|
|
|
|
|
|
|