Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asym.Unit - manually
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asym.Unit - manually
Asym.Unit - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)

(-) Description

Authors :  B. Benoff, H. Yang, C. L. Lawson, G. Parkinson, J. Liu, E. Blatter, Y. W. Ebright, H. M. Berman, R. H. Ebright
Date :  01 Apr 02  (Deposition) - 06 Sep 02  (Release) - 24 Feb 09  (Revision)
Resolution :  3.10
Chains :  Asym. Unit :  A,B,E,J,K
Biol. Unit 1:  A,B,E,J,K  (2x)
Keywords :  Protein-Dna Complex, Gene-Regulatory, Gene Regulation/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  B. Benoff, H. Yang, C. L. Lawson, G. Parkinson, J. Liu, E. Blatter, Y. W. Ebright, H. M. Berman, R. H. Ebright
Structural Basis Of Transcription Activation: The Cap-Alpha Ctd-Dna Complex.
Science V. 297 1562 2002
PubMed-ID: 12202833  |  Reference-DOI: 10.1126/SCIENCE.1076376
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - 5'- D(*CP*TP*TP*TP*TP*TP*TP*CP*CP*TP*AP*AP*AP*AP*TP*GP*TP*GP*AP *T)-3'
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism ScientificESCHERICHIA COLI
    Organism Taxid562
    ChainsB, E
    EC Number2.7.7.6
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism ScientificESCHERICHIA COLI
    Organism Taxid562

 Structural Features

(-) Chains, Units

Asymmetric Unit ABEJK
Biological Unit 1 (2x)ABEJK

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 1)

Asymmetric Unit (1, 1)
No.NameCountTypeFull Name
Biological Unit 1 (1, 2)
No.NameCountTypeFull Name

(-) Sites  (1, 1)

Asymmetric Unit (1, 1)
1AC1SOFTWAREILE A:30 , VAL A:49 , LEU A:61 , ILE A:70 , GLY A:71 , GLU A:72 , LEU A:73 , ARG A:82 , SER A:83 , ALA A:84 , TYR A:99 , THR A:127 , SER A:128BINDING SITE FOR RESIDUE CMP A 679

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1LB2)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1LB2)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1LB2)

(-) PROSITE Motifs  (5, 5)

Asymmetric Unit (5, 5)
1CNMP_BINDING_3PS50042 cAMP/cGMP binding motif profile.CRP_ECOLI24-124  1A:23-123
2CNMP_BINDING_1PS00888 Cyclic nucleotide-binding domain signature 1.CRP_ECOLI30-46  1A:29-45
3CNMP_BINDING_2PS00889 Cyclic nucleotide-binding domain signature 2.CRP_ECOLI71-89  1A:70-88
4HTH_CRP_2PS51063 Crp-type HTH domain profile.CRP_ECOLI138-210  1A:137-209
5HTH_CRP_1PS00042 Crp-type HTH domain signature.CRP_ECOLI168-191  1A:167-190
Biological Unit 1 (5, 10)
1CNMP_BINDING_3PS50042 cAMP/cGMP binding motif profile.CRP_ECOLI24-124  2A:23-123
2CNMP_BINDING_1PS00888 Cyclic nucleotide-binding domain signature 1.CRP_ECOLI30-46  2A:29-45
3CNMP_BINDING_2PS00889 Cyclic nucleotide-binding domain signature 2.CRP_ECOLI71-89  2A:70-88
4HTH_CRP_2PS51063 Crp-type HTH domain profile.CRP_ECOLI138-210  2A:137-209
5HTH_CRP_1PS00042 Crp-type HTH domain signature.CRP_ECOLI168-191  2A:167-190

(-) Exons   (0, 0)

(no "Exon" information available for 1LB2)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:201
 aligned with CRP_ECOLI | P0ACJ8 from UniProtKB/Swiss-Prot  Length:210

    Alignment length:201
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209 
               SCOP domains d1lb2a2 A:9-137 Catabolite gene activator protein, N-terminal domain                                                             d1lb2a1 A:138-209                                                        SCOP domains
               CATH domains 1lb2A01 A:9-137 Jelly Rolls                                                                                                      1lb2A02 A:138-206 'winged helix' repressor DNA binding domain        --- CATH domains
               Pfam domains -----------cNMP_binding-1lb2A02 A:20-111                                                               -----------------------------------------------------Crp-1lb2A01 A:165-196           ------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                PROSITE (1) --------------CNMP_BINDING_3  PDB: A:23-123 UniProt: 24-124                                                        -------------HTH_CRP_2  PDB: A:137-209 UniProt: 138-210                                PROSITE (1)
                PROSITE (2) --------------------CNMP_BINDING_1   ------------------------CNMP_BINDING_2     ------------------------------------------------------------------------------HTH_CRP_1  PDB: A:167-19------------------- PROSITE (2)
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    18        28        38        48        58        68        78        88        98       108       118       128       138       148       158       168       178       188       198       208 

Chain B from PDB  Type:PROTEIN  Length:72
 aligned with RPOA_ECOLI | P0A7Z4 from UniProtKB/Swiss-Prot  Length:329

    Alignment length:72
                                   259       269       279       289       299       309       319  
               SCOP domains d1lb2b_ B: C-terminal domain of RNA polymerase alpha subunit             SCOP domains
               CATH domains 1lb2B00 B:250-321 5' to 3' exonuclease, C-terminal subdomain             CATH domains
               Pfam domains ------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ......hhhhhh.hhhhhhhhhhh...hhhhhhh.hhhhhhhh...hhhhhhhhhhhhhhh........... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------ Transcript
                                   259       269       279       289       299       309       319  

Chain E from PDB  Type:PROTEIN  Length:66
 aligned with RPOA_ECOLI | P0A7Z4 from UniProtKB/Swiss-Prot  Length:329

    Alignment length:66
                                   259       269       279       289       299       309      
               SCOP domains d1lb2e_ E: C-terminal domain of RNA polymerase alpha subunit       SCOP domains
               CATH domains 1lb2E00 E:250-315 5' to 3' exonuclease, C-terminal subdomain       CATH domains
           Pfam domains (1) RNA_pol_A_CTD-1lb2E01 E:250-309                             ------ Pfam domains (1)
           Pfam domains (2) RNA_pol_A_CTD-1lb2E02 E:250-309                             ------ Pfam domains (2)
         Sec.struct. author .hhhhhhhhhhh.hhhhhhhhhh....hhhhhhh.hhhhhhh....hhhhhhhhhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------ Transcript
                                   259       269       279       289       299       309      

Chain J from PDB  Type:DNA  Length:24
                 1lb2 J  10 CTAGATCACATTTTAGGAAAAAAG  33
                                    19        29    

Chain K from PDB  Type:DNA  Length:20
                 1lb2 K  33 CTTTTTTCCTAAAATGTGAT  14
                             31|||||| 22||||||  
                              30|||||  21|||||  
                               29||||   20||||  
                                28|||    19|||  
                                 27||     18||  
                                  26|      17|  
                                   25       16  

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (3, 4)

Asymmetric Unit

(-) CATH Domains  (3, 4)

Asymmetric Unit
Class: Mainly Beta (13760)

(-) Pfam Domains  (3, 4)

Asymmetric Unit
Clan: HTH (544)

(-) Gene Ontology  (19, 23)

Asymmetric Unit(hide GO term definitions)
Chain A   (CRP_ECOLI | P0ACJ8)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0030552    cAMP binding    Interacting selectively and non-covalently with cAMP, the nucleotide cyclic AMP (adenosine 3',5'-cyclophosphate).
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0045013    carbon catabolite repression of transcription    A transcription regulation process in which the presence of one carbon source leads to a decrease in the frequency, rate, or extent of transcription of specific genes involved in the metabolism of other carbon sources. Carbon catabolite repression is a mechanism of genetic regulation which the accumulation of catabolites of one substance in the cell represses the formation of enzymes that contribute to the catabolism of other substances.
    GO:0045892    negative regulation of transcription, DNA-templated    Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0045893    positive regulation of transcription, DNA-templated    Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.
    GO:0005622    intracellular    The living contents of a cell; the matter contained within (but not including) the plasma membrane, usually taken to exclude large vacuoles and masses of secretory or ingested material. In eukaryotes it includes the nucleus and cytoplasm.

Chain B,E   (RPOA_ECOLI | P0A7Z4)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003899    DNA-directed 5'-3' RNA polymerase activity    Catalysis of the reaction: nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1). Utilizes a DNA template, i.e. the catalysis of DNA-template-directed extension of the 3'-end of an RNA strand by one nucleotide at a time. Can initiate a chain 'de novo'.
    GO:0016779    nucleotidyltransferase activity    Catalysis of the transfer of a nucleotidyl group to a reactant.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0046983    protein dimerization activity    The formation of a protein dimer, a macromolecular structure consists of two noncovalently associated identical or nonidentical subunits.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
    GO:0008270    zinc ion binding    Interacting selectively and non-covalently with zinc (Zn) ions.
biological process
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.
    GO:0016020    membrane    A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    CMP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1lb2)
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        CRP_ECOLI | P0ACJ81cgp 1g6n 1hw5 1i5z 1i6x 1j59 1o3q 1o3r 1o3s 1o3t 1run 1ruo 1zrc 1zrd 1zre 1zrf 2cgp 2gap 2gzw 2wc2 3fwe 3hif 3iyd 3kcc 3n4m 3qop 3rdi 3rou 3rpq 3ryp 3ryr 4bh9 4bhp 4ft8 4hzf 4i01 4i02 4i09 4i0a 4i0b 4r8h 5ciz
        RPOA_ECOLI | P0A7Z41bdf 1coo 1xs9 2jzb 3iyd 3k4g 3lu0 3n4m 3n97 4jk1 4jk2 4kmu 4kn4 4kn7 4mex 4mey 4s20 4xsx 4xsy 4xsz 4yg2 4yln 4ylo 4ylp 4zh2 4zh3 4zh4 5byh 5ciz 5ezk 5ipl 5ipm 5ipn 5ms0 5my1 5nsr 5nss 5uac 5uag 5uah 5uaj 5ual 5uaq 5up6 5upc 5vsw 5w1s 5w1t

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1LB2)