Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  STRUCTURE OF A PHOP-DNA COMPLEX
 
Authors :  S. Wang
Date :  20 Oct 15  (Deposition) - 27 Apr 16  (Release) - 27 Apr 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.40
Chains :  Asym. Unit :  A,B,C,D,E,F,G,H
Biol. Unit 1:  A,B,C,D  (1x)
Biol. Unit 2:  E,F,G,H  (1x)
Keywords :  Protein-Dna Complex, Winged Helix-Turn-Helix, Direct Repeat, Tandem Dimer, Transcription-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  X. He, L. Wang, S. Wang
Structural Basis Of Dna Sequence Recognition By The Respons Regulator Phop In Mycobacterium Tuberculosis.
Sci Rep V. 6 24442 2016
PubMed-ID: 27079268  |  Reference-DOI: 10.1038/SREP24442

(-) Compounds

Molecule 1 - RESPONSE REGULATOR
    Chains: A, B, E, F
    EC Number: 3.1.3.1
    Engineered: YES
    Expression System: ESCHERICHIA COLI BL21(DE3)
    Expression System Plasmid: PET28A
    Expression System Taxid: 469008
    Expression System Vector Type: PLASMID
    Gene: PHOP, ABI38_13965, AC434_12840, BN1303_02986, ERS024750_01197, ERS024751_02016, ERS024758_01633, ERS124824_03492, ERS124825_03677, ERS124827_03481, ERS124828_03492, ERS124829_03387, ERS124830_03452, ERS124831_03570, ERS124832_03594, IQ38_16185, IQ42_15805, IQ45_15620, IQ47_15575, IQ48_15690, IU13_15815, IU15_16135, IU16_15745, IU17_15635, IU21_16005, T209_15560
    Organism Scientific: MYCOBACTERIUM TUBERCULOSIS
    Organism Taxid: 1773
    Synonym: PHOP FAMILY TRANSCRIPTIONAL REGULATOR
 
Molecule 2 - DNA (26-MER)
    Chains: C, G
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 3 - DNA (26-MER)
    Chains: D, H
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12345678
Asymmetric Unit : ABCDEFGH
Biological Unit 1 (1x): ABCD    
Biological Unit 2 (1x):     EFGH

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 11)

Asymmetric Unit (3, 11)
No.NameCountTypeFull Name
1CA6Ligand/IonCALCIUM ION
2CAC1Ligand/IonCACODYLATE ION
3EDO4Ligand/Ion1,2-ETHANEDIOL
Biological Unit 1 (1, 3)
No.NameCountTypeFull Name
1CA-1Ligand/IonCALCIUM ION
2CAC-1Ligand/IonCACODYLATE ION
3EDO3Ligand/Ion1,2-ETHANEDIOL
Biological Unit 2 (2, 2)
No.NameCountTypeFull Name
1CA-1Ligand/IonCALCIUM ION
2CAC1Ligand/IonCACODYLATE ION
3EDO1Ligand/Ion1,2-ETHANEDIOL

(-) Sites  (11, 11)

Asymmetric Unit (11, 11)
No.NameEvidenceResiduesDescription
01AC1SOFTWAREASP A:28 , ASP A:71 , MET A:73 , HOH A:422 , HOH A:438 , HOH A:447binding site for residue CA A 301
02AC2SOFTWARELEU A:199 , ASP A:200 , TRP A:203 , ARG A:204 , TYR A:205binding site for residue EDO A 302
03AC3SOFTWAREASN A:52 , GLY A:53 , PRO A:75 , MET A:77 , ARG E:247binding site for residue EDO A 303
04AC4SOFTWAREASP B:28 , ASP B:71 , MET B:73 , HOH B:406 , HOH B:424binding site for residue CA B 301
05AC5SOFTWAREASP B:200 , HOH B:416 , HOH B:419 , GLY E:76 , HOH E:441 , HOH E:457binding site for residue CA B 302
06AC6SOFTWARELYS B:195 , VAL B:239 , GLY B:240 , DG D:7binding site for residue EDO B 303
07AC7SOFTWAREASP E:28 , ASP E:71 , MET E:73 , HOH E:402 , HOH E:410 , HOH E:462binding site for residue CA E 301
08AC8SOFTWAREGLU E:164 , VAL E:165 , PRO E:171 , VAL E:172 , HOH E:430binding site for residue EDO E 302
09AC9SOFTWAREGLU E:62 , ARG E:150 , GLU E:157 , TRP E:166binding site for residue CAC E 303
10AD1SOFTWAREHOH A:404 , HOH A:413 , DT C:3 , GLU F:62binding site for residue CA F 301
11AD2SOFTWAREASP F:28 , ASP F:71 , MET F:73 , HOH F:403 , HOH F:419 , HOH F:424binding site for residue CA F 302

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5ED4)

(-) Cis Peptide Bonds  (4, 4)

Asymmetric Unit
No.Residues
1Lys A:121 -Pro A:122
2Lys B:121 -Pro B:122
3Lys E:121 -Pro E:122
4Lys F:121 -Pro F:122

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5ED4)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5ED4)

(-) Exons   (0, 0)

(no "Exon" information available for 5ED4)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:222
                                                                                                                                                                                                                                                              
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ....eeeee..hhhhhhhhhhhhhhh..eeeee.hhhhhhhhhhhhh..eeeee......hhhhhhhhhhhh.....eeeee....hhhhhhhhh....eeee...hhhhhhhhhhhhhhhh..eeee..eeee.....eee..eee..hhhhhhhhhhhhhh.....hhhhhhhhhh.......hhhhhhhhhhhhhhhh......eeee...eeee.... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 5ed4 A  18 TPEARVLVVDDEANIVELLSVSLKFQGFEVYTATNGAQALDRARETRPDAVILDVMMPGMDGFGVLRRLRADGIDAPALFLTARDSLQDKIAGLTLGGDDYVTKPFSLEEVVARLRVILRRAGVRLTFADIELDEETHEVWKAGQPVSLSPTEFTLLRYFVINAGTVLSKPKILDHVWRYDFGGDVNVVESYVSYLRRKIDTGEKRLLHTLRGVGYVLREPR 247
                                    27        37        47        57        67        77        87        97       107       117       127       137  ||   155       165       175       185       195       205       215       225       235       245  
                                                                                                                                                    140|                                                                                                  
                                                                                                                                                     149                                                                                                  


Chain B from PDB  Type:PROTEIN  Length:217
                                                                                                                                                                                                                                                         
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....eeeee..hhhhhhhhhhhhhhh..eeeee.hhhhhhhhhhhhh..eeeee......hhhhhhhhhhhhh....eeeeee...........eeeee..hhhhhhhhhhhhhhhhh..eee..eee......eee..eee..hhhhhhhhhhhhhh.....hhhhhhhhhh.......hhhhhhhhhhhhhhhh......eeee...eeee.... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ed4 B  18 TPEARVLVVDDEANIVELLSVSLKFQGFEVYTATNGAQALDRARETRPDAVILDVMMPGMDGFGVLRRLRADGIDAPALFLTARKIAGLTLGGDDYVTKPFSLEEVVARLRVILRRAGVRLTFADIELDEETHEVWKAGQPVSLSPTEFTLLRYFVINAGTVLSKPKILDHVWRYDFGGDVNVVESYVSYLRRKIDTGEKRLLHTLRGVGYVLREPR 247
                                    27        37        47        57        67        77        87        97   ||  112       122       132       150       160       170       180       190       200       210       220       230       240       
                                                                                                             101|                              140|                                                                                                  
                                                                                                              107                               149                                                                                                  


Chain C from PDB  Type:DNA  Length:26
                                                          
                 5ed4 C   1 GATTCACAGCTGATTCACAGCATCTA  26
                                    10        20      


Chain D from PDB  Type:DNA  Length:26
                                                          
                 5ed4 D   1 CTAGATGCTGTGAATCAGCTGTGAAT  26
                                    10        20      


Chain E from PDB  Type:PROTEIN  Length:224
                                                                                                                                                                                                                                                                
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....eeeee..hhhhhhhhhhhhhhh..eeeee.hhhhhhhhhhhhh..eeeee......hhhhhhhhhhhh.....eeeeee.....hhhhh......eeeee..hhhhhhhhhhhhhhhhh...eeee..eeee.....eee..ee...hhhhhhhhhhhhhh.....hhhhhhhhhh.......hhhhhhhhhhhhhhhh......eeee...eeee.... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ed4 E  18 TPEARVLVVDDEANIVELLSVSLKFQGFEVYTATNGAQALDRARETRPDAVILDVMMPGMDGFGVLRRLRADGIDAPALFLTARDSLQDKIAGLTLGGDDYVTKPFSLEEVVARLRVILRRAGRNVRLTFADIELDEETHEVWKAGQPVSLSPTEFTLLRYFVINAGTVLSKPKILDHVWRYDFGGDVNVVESYVSYLRRKIDTGEKRLLHTLRGVGYVLREPR 247
                                    27        37        47        57        67        77        87        97       107       117       127       137  ||   153       163       173       183       193       203       213       223       233       243    
                                                                                                                                                    140|                                                                                                    
                                                                                                                                                     147                                                                                                    


Chain F from PDB  Type:PROTEIN  Length:214
                                                                                                                                                                                                                                                      
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...eeeee..hhhhhhhhhhhhhhh..eeeee.hhhhhhhhhhhhh..eeeee......hhhhhhhhhhhh.....eeeee..........eeee...hhhhhhhhhhhhhhhhh.eeee..eeee.....eee..eee..hhhhhhhhhhhhhh.....hhhhhhhhhh.......hhhhhhhhhhhhhhhh......eeee...eeee.... Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ed4 F  19 PEARVLVVDDEANIVELLSVSLKFQGFEVYTATNGAQALDRARETRPDAVILDVMMPGMDGFGVLRRLRADGIDAPALFLTARAGLTLGGDDYVTKPFSLEEVVARLRVILRRAGVRLTFADIELDEETHEVWKAGQPVSLSPTEFTLLRYFVINAGTVLSKPKILDHVWRYDFGGDVNVVESYVSYLRRKIDTGEKRLLHTLRGVGYVLREPR 247
                                    28        38        48        58        68        78        88        98  ||   115       125       135    || 153       163       173       183       193       203       213       223       233       243    
                                                                                                            101|                            140|                                                                                                  
                                                                                                             109                             149                                                                                                  


Chain G from PDB  Type:DNA  Length:26
                                                          
                 5ed4 G   1 GATTCACAGCTGATTCACAGCATCTA  26
                                    10        20      


Chain H from PDB  Type:DNA  Length:26
                                                          
                 5ed4 H   1 CTAGATGCTGTGAATCAGCTGTGAAT  26
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5ED4)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5ED4)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5ED4)

(-) Gene Ontology  (14, 14)

Asymmetric Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    CAC  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    EDO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
    AD1  [ RasMol ]  +environment [ RasMol ]
    AD2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Lys A:121 - Pro A:122   [ RasMol ]  
    Lys B:121 - Pro B:122   [ RasMol ]  
    Lys E:121 - Pro E:122   [ RasMol ]  
    Lys F:121 - Pro F:122   [ RasMol ]  
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5ed4
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  P71814_MYCTU | P71814
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/TrEMBL
 
Access by Enzyme Classificator   (EC Number)
  3.1.3.1
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  P71814_MYCTU | P71814
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        P71814_MYCTU | P71814: 2pmu
UniProtKB/TrEMBL
        P71814_MYCTU | P71814: 3r0j

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5ED4)