Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE (I) OF NOVA-1 KH1/KH2 DOMAIN TANDEM WITH 25 NT RNA HAIRPIN
 
Authors :  L. Malinina, M. Teplova, K. Musunuru, A. Teplov, J. C. Darnell, S. K. Bur R. B. Darnell, D. J. Patel
Date :  11 Aug 05  (Deposition) - 24 Oct 06  (Release) - 02 Nov 11  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.30
Chains :  Asym./Biol. Unit :  A,B
Keywords :  Protein-Rna Complex, Rna-Binding Protein-Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  M. Teplova, L. Malinina, J. C. Darnell, J. Song, M. Lu, R. Abagyan, K. Musunuru, A. Teplov, S. K. Burley, R. B. Darnell, D. J. Patel
Protein-Rna And Protein-Protein Recognition By Dual Kh1/2 Domains Of The Neuronal Splicing Factor Nova-1.
Structure V. 19 930 2011
PubMed-ID: 21742260  |  Reference-DOI: 10.1016/J.STR.2011.05.002

(-) Compounds

Molecule 1 - 5'-R(*CP*GP*CP*GP*CP*GP*GP*AP*UP*CP*AP*GP*UP*CP*AP*CP*CP*CP *AP*AP*GP*CP*GP*CP*G)-3'
    ChainsB
    EngineeredYES
    SyntheticYES
 
Molecule 2 - NEURO-ONCOLOGICAL VENTRAL ANTIGEN 1
    ChainsA
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    FragmentKH1/KH2 DOMAINS
    GeneNOVA1
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SynonymNOVA-1, RNA-BINDING PROTEIN NOVA-1

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 3)

Asymmetric/Biological Unit (2, 3)
No.NameCountTypeFull Name
1K1Ligand/IonPOTASSIUM ION
2MG2Ligand/IonMAGNESIUM ION

(-) Sites  (3, 3)

Asymmetric Unit (3, 3)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREG B:6 , G B:7 , MG B:302 , MG B:303 , HOH B:304 , HOH B:306 , HOH B:307 , HOH B:314BINDING SITE FOR RESIDUE K B 301
2AC2SOFTWAREG B:7 , K B:301 , HOH B:305 , HOH B:306 , HOH B:307 , HOH B:309BINDING SITE FOR RESIDUE MG B 302
3AC3SOFTWAREG B:6 , K B:301 , HOH B:310 , HOH B:311 , HOH B:312 , HOH B:313 , HOH B:314BINDING SITE FOR RESIDUE MG B 303

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 2ANN)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 2ANN)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 2ANN)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1KH_TYPE_1PS50084 Type-1 KH domain profile.NOVA1_HUMAN49-119
174-240
424-491
  2A:5-72
A:103-169
-

(-) Exons   (0, 0)

(no "Exon" information available for 2ANN)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:148
 aligned with NOVA1_HUMAN | P51513 from UniProtKB/Swiss-Prot  Length:510

    Alignment length:212
                                    46        56        66        76        86        96       106       116       126       136       146       156       166       176       186       196       206       216       226       236       246  
          NOVA1_HUMAN    37 GSTKRTNTGEDGQYFLKVLIPSYAAGSIIGKGGQTIVQLQKETGATIKLSKLSKSKDFYPGTTERVCLIQGTVEALNAVHGFIAEKIREMPQNVAKTEPVSILQPQTTVNPDRIKQTLPSSPTTTKSSPSDPMTTSRANQVKIIVPNSTAGLIIGKGGATVKAVMEQSGAWVQLSQKPDGINLQERVVTVSGEPEQNRKAVELIIQKIQEDP 248
               SCOP domains d2          anna1 A:3-76 automated matches                                             ----                                           ------d2anna2 A:106-177 automated matches                                      SCOP domains
               CATH domains 2a          nnA01 A:3-80  [code=3.30.1370.10, no n   ame defined]                                                                     2annA02 A:100-177  [code=3.30.1370.10, no         name defined]                CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..----------.eeeeeeeehhhhhhhhh..hhhhhhhhhhhh.eeee.---..........eeeeeeeehhhhhhhhhhhhhhhhh...-------------------------------------------hhhh.eeeeeeehhhhhhhhh..hhhhhhhhhhhh.eeee.--------.eeeeeee.hhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------KH_TYPE_1  PDB: A:5-72 UniProt: 49-119                                 ------------------------------------------------------KH_TYPE_1  PDB: A:103-169 UniProt: 174-240                         -------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 2ann A   3 GS----------QYFLKVLIPSYAAGSIIGKGGQTIVQLQKETGATIKLS---KSKDFYPGTTERVCLIQGTIEALNAVHGFIAEKIREMP-------------------------------------------PDRANQVKIIVPNSTAGLIIGKGGATVKAIMEQSGAWVQLS--------QNRVVTVSGEPEQNRKAVELIIQKIQEDP 177
                             |       -  |     12        22        32        42   |    49        59        69        79|        -         -         -         -    |  105       115       125       135    |    -   |   155       165       175  
                             4          5                                   42  43                                   80                                         100                                     140      149                            

Chain B from PDB  Type:RNA  Length:23
                                                       
                 2ann B   3 CGCGGAUCAGUCACCCAAGCGCG  25
                                    12        22   

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 2ANN)

(-) Gene Ontology  (14, 14)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (NOVA1_HUMAN | P51513)
molecular function
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0003729    mRNA binding    Interacting selectively and non-covalently with messenger RNA (mRNA), an intermediate molecule between DNA and protein. mRNA includes UTR and coding sequences, but does not contain introns.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
biological process
    GO:0006396    RNA processing    Any process involved in the conversion of one or more primary RNA transcripts into one or more mature RNA molecules.
    GO:0008380    RNA splicing    The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA.
    GO:0007268    chemical synaptic transmission    The vesicular release of classical neurotransmitter molecules from a presynapse, across a chemical synapse, the subsequent activation of neurotransmitter receptors at the postsynapse of a target cell (neuron, muscle, or secretory cell) and the effects of this activation on the postsynaptic membrane potential and ionic composition of the postsynaptic cytosol. This process encompasses both spontaneous and evoked release of neurotransmitter and all parts of synaptic vesicle exocytosis. Evoked transmission starts with the arrival of an action potential at the presynapse.
    GO:0007626    locomotory behavior    The specific movement from place to place of an organism in response to external or internal stimuli. Locomotion of a whole organism in a manner dependent upon some combination of that organism's internal state and external conditions.
    GO:0000398    mRNA splicing, via spliceosome    The joining together of exons from one or more primary transcripts of messenger RNA (mRNA) and the excision of intron sequences, via a spliceosomal mechanism, so that mRNA consisting only of the joined exons is produced.
    GO:0051252    regulation of RNA metabolic process    Any process that modulates the frequency, rate or extent of the chemical reactions and pathways involving RNA.
    GO:0050684    regulation of mRNA processing    Any process that modulates the frequency, rate or extent of mRNA processing, those processes involved in the conversion of a primary mRNA transcript into a mature mRNA prior to its translation into polypeptide.
    GO:0021510    spinal cord development    The process whose specific outcome is the progression of the spinal cord over time, from its formation to the mature structure. The spinal cord primarily conducts sensory and motor nerve impulses between the brain and the peripheral nervous tissues.
cellular component
    GO:0043231    intracellular membrane-bounded organelle    Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane.
    GO:0005730    nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 2ann)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  2ann
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  NOVA1_HUMAN | P51513
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  NOVA1_HUMAN | P51513
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        NOVA1_HUMAN | P515131dt4 2anr

(-) Related Entries Specified in the PDB File

2anr CRYSTAL STRUCTURE (II) OF KH1/KH2 DOMAIN TANDEM WITH 25 NT RNA HAIRPIN.