Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF FRANCISELLA NOVICIDA CAS9 IN COMPLEX WITH SGRNA AND TARGET DNA (TGG PAM)
 
Authors :  H. Hirano, H. Nishimasu, T. Nakane, R. Ishitani, O. Nureki
Date :  01 Feb 16  (Deposition) - 02 Mar 16  (Release) - 09 Mar 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  1.70
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Crispr-Cas9, Genome Engineering, Hydrolase-Rna-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  H. Hirano, J. S. Gootenberg, T. Horii, O. O. Abudayyeh, M. Kimura, P. D. Hsu, T. Nakane, R. Ishitani, I. Hatada, F. Zhang, H. Nishimasu, O. Nureki
Structure And Engineering Of Francisella Novicida Cas9
Cell V. 164 950 2016
PubMed-ID: 26875867  |  Reference-DOI: 10.1016/J.CELL.2016.01.039

(-) Compounds

Molecule 1 - CRISPR-ASSOCIATED ENDONUCLEASE CAS9
    Chains: A
    EC Number: 3.1.-.-
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PE-SUMO
    Expression System Strain: BL21(DE3) ROSETTA2
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: CAS9, FTN_0757
    Mutation: YES
    Organism Scientific: FRANCISELLA TULARENSIS SUBSP. NOVICIDA U112
    Organism Taxid: 401614
    Strain: U112
 
Molecule 2 - GUIDE RNA
    Chains: B
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Other Details: IN VITRO TRANSCRIPTION
    Synthetic: YES
 
Molecule 3 - TARGET DNA
    Chains: C
    Engineered: YES
    Organism Scientific: FRANCISELLA TULARENSIS SUBSP. NOVICIDA
    Organism Taxid: 264
    Other Details: CHEMICAL SYNTHESIS
    Synthetic: YES
 
Molecule 4 - DNA (5'-D(*TP*GP*GP*TP*AP*TP*CP*GP*G)-3')
    Chains: D
    Engineered: YES
    Organism Scientific: FRANCISELLA TULARENSIS SUBSP. NOVICIDA
    Organism Taxid: 264
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (7, 50)

Asymmetric/Biological Unit (7, 50)
No.NameCountTypeFull Name
1ACT2Ligand/IonACETATE ION
2CA17Ligand/IonCALCIUM ION
3CL2Ligand/IonCHLORIDE ION
4DU1Mod. Residue
5EDO23Ligand/Ion1,2-ETHANEDIOL
6NA4Ligand/IonSODIUM ION
7ZN1Ligand/IonZINC ION

(-) Sites  (49, 49)

Asymmetric Unit (49, 49)
No.NameEvidenceResiduesDescription
01AC1SOFTWARECYS A:460 , CYS A:657 , CYS A:814 , CYS A:817binding site for residue ZN A 1701
02AC2SOFTWAREPHE A:647 , ASP A:649 , HOH A:1916 , HOH A:2167 , HOH A:2247 , HOH A:2342binding site for residue NA A 1702
03AC3SOFTWAREASN A:1248 , HOH A:2356 , ACT B:120 , HOH B:278 , HOH B:314 , HOH B:518 , HOH B:526binding site for residue NA A 1703
04AC4SOFTWARELYS A:564 , PHE A:602 , HOH A:2229 , HOH A:2389binding site for residue CL A 1704
05AC5SOFTWARELYS A:366 , LYS A:370 , GLU A:399 , HOH A:2098binding site for residue CL A 1705
06AC6SOFTWAREASP A:11 , GLU A:903 , HIS A:1162 , HOH A:1819 , HOH A:1857binding site for residue CA A 1706
07AC7SOFTWAREASP A:66 , HOH A:2340 , A B:60 , HOH B:244 , HOH B:299 , HOH B:444 , HOH B:484binding site for residue CA A 1707
08AC8SOFTWAREHOH A:1807 , HOH A:2074 , HOH A:2372 , HOH A:2402 , HOH C:204 , HOH C:230 , HOH C:264binding site for residue CA A 1708
09AC9SOFTWAREASP A:66 , HOH A:1809 , HOH A:2070 , HOH B:283 , HOH B:317 , HOH B:381 , HOH B:444 , HOH B:513binding site for residue CA A 1709
10AD1SOFTWAREVAL A:402 , HOH A:2335 , U B:83 , HOH B:282 , HOH B:495binding site for residue CA A 1710
11AD2SOFTWAREHOH A:1898 , HOH A:1919 , HOH B:219 , HOH B:228 , HOH B:487 , HOH B:530binding site for residue CA A 1711
12AD3SOFTWARESER A:507 , HOH A:2320 , HOH A:2331 , HOH A:2347 , HOH B:386binding site for residue CA A 1712
13AD4SOFTWARELYS A:1415 , ASP A:1417 , HOH A:2081 , HOH A:2351 , HOH A:2368binding site for residue CA A 1713
14AD5SOFTWAREHOH A:2018 , HOH A:2089 , HOH A:2286 , HOH A:2352 , HOH B:388 , HOH C:206 , HOH C:260binding site for residue CA A 1714
15AD6SOFTWAREGLU A:1231 , ASN A:1234 , ASP A:1498 , SER A:1499binding site for residue CA A 1715
16AD7SOFTWARELYS A:45 , TYR A:48 , THR A:49 , LEU A:50 , LEU A:51 , VAL A:911 , HOH A:2046binding site for residue EDO A 1716
17AD8SOFTWAREGLY A:309 , HOH A:1853 , HOH A:2082 , G B:19 , G B:20 , HOH C:215binding site for residue EDO A 1717
18AD9SOFTWAREASP A:90 , THR A:91 , TYR A:332 , ASN A:335 , PHE A:336 , ASN A:339 , TYR A:345 , HOH A:1887 , HOH A:1996binding site for residue EDO A 1718
19AE1SOFTWAREHIS A:394 , LEU A:397 , GLY A:398 , HOH A:1937 , HOH A:2125 , HOH B:411binding site for residue EDO A 1719
20AE2SOFTWARELEU A:626 , TYR A:627 , ILE A:628 , TYR A:656 , ARG A:1093 , GLU A:1097 , HOH A:2076 , HOH A:2116binding site for residue EDO A 1720
21AE3SOFTWAREARG A:625 , LEU A:626 , TYR A:627 , SER A:1118 , PHE A:1119 , HOH A:1907 , HOH A:2065binding site for residue EDO A 1721
22AE4SOFTWARELYS A:459 , GLY A:645 , PHE A:647 , ASN A:658 , HOH A:1837 , HOH A:2244binding site for residue EDO A 1722
23AE5SOFTWAREPRO A:1251 , TYR A:1265 , TYR A:1329 , EDO B:110 , EDO B:115 , HOH B:379binding site for residue EDO A 1723
24AE6SOFTWARESER A:105 , ILE A:107 , ASP A:406 , PRO A:447 , PRO A:448 , HOH A:1953 , HOH A:2071binding site for residue EDO A 1724
25AE7SOFTWARESER A:21 , ALA A:22 , PHE A:23 , ASN A:37 , ASN A:877 , ASN A:880binding site for residue EDO A 1725
26AE8SOFTWAREGLN A:478 , TYR A:530 , LYS A:531 , ASP A:534binding site for residue EDO A 1726
27AE9SOFTWARESER A:899 , ALA A:901 , PHE A:904 , ASN A:1089binding site for residue EDO A 1727
28AF1SOFTWAREGLN A:92 , THR A:1458 , TRP A:1459 , ASP A:1460 , ASN A:1462 , HOH A:1964 , HOH A:2166 , A B:50binding site for residue ACT A 1728
29AF2SOFTWAREG B:28 , U B:30 , U B:45 , NA B:102 , HOH B:291 , HOH B:505 , HOH B:510binding site for residue NA B 101
30AF3SOFTWAREU B:45 , NA B:101 , HOH B:220 , HOH B:482 , HOH B:503 , HOH B:505 , HOH B:531 , HOH B:533binding site for residue NA B 102
31AF4SOFTWAREHOH B:211 , HOH B:238 , HOH B:247 , HOH B:249 , HOH B:273 , HOH B:294binding site for residue CA B 103
32AF5SOFTWAREHOH A:2358 , HOH A:2384 , U B:93 , HOH B:458 , HOH B:472 , HOH B:524binding site for residue CA B 104
33AF6SOFTWAREG B:74 , HOH B:306 , HOH B:324 , HOH B:342 , HOH B:369 , HOH B:501binding site for residue CA B 105
34AF7SOFTWAREHOH A:1803 , HOH B:234 , HOH B:255 , HOH B:271 , HOH B:405 , HOH B:528binding site for residue CA B 106
35AF8SOFTWAREHOH A:2060 , HOH A:2283 , HOH A:2415 , HOH B:239 , HOH B:350 , HOH B:377 , HOH B:497binding site for residue CA B 107
36AF9SOFTWAREHOH A:2395 , G B:20 , HOH B:240 , HOH B:248 , HOH B:353 , HOH B:365 , HOH B:527 , HOH B:529binding site for residue CA B 108
37AG1SOFTWAREU B:12 , G B:13 , HOH B:209 , HOH B:498 , HOH C:223binding site for residue CA B 109
38AG2SOFTWARETYR A:1265 , EDO A:1723 , C B:42 , G B:43 , HOH B:257 , HOH B:259binding site for residue EDO B 110
39AG3SOFTWAREARG A:1404 , G B:31 , C B:44 , U B:45 , HOH B:288 , HOH B:370binding site for residue EDO B 111
40AG4SOFTWAREARG A:59 , ARG A:62 , A B:61 , G B:62 , HOH B:244binding site for residue EDO B 112
41AG5SOFTWARESER A:105 , TYR A:449 , U B:17 , HOH B:222 , HOH B:360 , HOH B:384binding site for residue EDO B 113
42AG6SOFTWAREARG A:369 , G B:73 , C B:89 , HOH B:215 , HOH B:292 , HOH B:402binding site for residue EDO B 114
43AG7SOFTWARETYR A:1329 , EDO A:1723 , C B:34 , C B:35 , G B:41 , C B:42 , HOH B:259binding site for residue EDO B 115
44AG8SOFTWAREMET A:52 , ARG A:55 , LYS A:864 , HOH A:2330 , A B:64 , G B:69 , HOH B:269binding site for residue EDO B 116
45AG9SOFTWAREA B:71 , G B:94binding site for residue EDO B 117
46AH1SOFTWAREC B:32 , G B:33 , C B:34 , HOH B:289 , HOH B:481binding site for residue EDO B 118
47AH2SOFTWAREARG A:455 , LYS A:456 , A B:71 , C B:89 , HOH B:215 , HOH B:247binding site for residue EDO B 119
48AH3SOFTWAREASN A:1248 , SER A:1368 , ARG A:1370 , PHE A:1398 , NA A:1703 , C B:44 , HOH B:216 , HOH B:300 , HOH B:314binding site for residue ACT B 120
49AH4SOFTWAREGLY A:1090 , DC C:21 , DT C:22binding site for residue EDO C 101

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5B2O)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5B2O)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5B2O)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5B2O)

(-) Exons   (0, 0)

(no "Exon" information available for 5B2O)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:1455
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..eee..eeeee...eeeeeee.ee...hhhhh..eeeeeeee........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhh.............hhhhhhhhhhh.....hhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhh.hhhhhhhh...hhhhhhhhhhhhhhhhhhhhh...hhhhh.....hhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh....hhhhhhhhhhhhh......hhhhhhhhhhhhhh.hhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhh......hhhhh.....hhhhhhhhhhhhh...hhhhhhh..hhhhhh................eeehhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhhh........ee.....hhhhhh..eehhhhhhhhhhhhhh.hhhhh..hhhhhhhhhhhhhh..hhhhhhhhhhh..hhhhh..ee..ee...hhhhhhhhhhhhhhhhhh.....eeeeeee....eeeeeeeee.....eee......hhhhhhhhhhhhhhh.hhhhhhhhhh..hhhhhhhhhhhhh.hhhhhhhhhhhhhhhh..hhhhhhhhhhhhh...hhhhhhhhhhhhh...hhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhh.ee....ee.............hhhhhhhhhhhhhhhhhhhhhhhhhhhhh..eeeeeeeeeehhhhhhhhhhhhh....hhhhhhhhhhh.....hhhhhhhhhhh..eeee.......hhh.eeee..................hhhhhhhhhhhhhh...hhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhh......eeeeeee........hhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhhhhhh...................hhhhhh......eeeee...............eeeeeeeeee..eeee.....eeee.....eeee..ee..eehhhhhhhhhhhhhhh...........hhhhhhhhhhhh.......eeee..hhhhhhhhhhhhhhhhhh....hhhhhhhhhheeeeeeeee.hhhhhhhhhhhhhh.ee..ee..hhhhhhhhhhhhhhh...hhhhhhhhhh...............eeeeeee....eeeeee.....eeeeeeee..........eeeeee....eeeeee.hhhh...eee..............eee.....eeee..hhhhhh..eeeeeee.......eeeeee.....hhhhhhhhhhh......hhhhhhhhhh...eeeee....hhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                5b2o A    1 MNFKILPIAIDLGVKNTGVFSAFYQKGTSLERLDNKNGKVYELSKDSYTLLMNNRTARRHQRRGIDRKQLVKRLFKLIWTEQLNLEWDKDTQQAISFLFNRRGFSFITDGYSVKAILMDIFDDYNGEDDSYLKLATEQESKISEIYNKLMQKILEFKLMKLCTDIKDDTLKEITSYEFELLADYLANYSESLKTQKFYNIQEFLKRHATINDRILDTLLTDDLDIWNFNFELHHFVFAVNKIKSEMASGGRHRSQYFQEITNVLDENNHQEGYLKNFCENLHNKKYSNLSVKNLVNLIGNLSNLELKPLRKYFNDKIHAKADHWDEQKFTETYCHWILGEWRVGVKDQDKKDGAKYSYKDLCNELKQKVTKAGLVDFLLELDPCRTIPPYLDNNNRKPPKCQSLILNPKFLDNQYPNWQQYLQELKKLQSIQNYLDSFETDLKVLKSSKDQPYFVEYKSSNQQIASGQRDYKDLDARILQFIFDRVKASDELLLNEIYFQAKKLKQESSKKLDEVIANSQLSQILKSQHTNGIFEQGTFLHLVCKYYKQRQRARDSRLYIMPEYRYDKKLHKYNNTGRFDDDNQLLTYCNHKPRQKRYQLLNDLAGVLQVSPNFLKDKIGSDDDLFISKWLVEHIRGFKKACEDSLKIQKDNRGLLNHKINIARNTKGKCEKEIFNLICKIEGYKHGLAYELGVLLFGEPNEASKPEFDRKIKKFNSIYSFAQIQQIAFAERKGNANTCAVCSADNAHRMQQIKIILSAKAQRLPAIPTRIVDGAVKKMATILAKNIVDDNWQNIKQVLSAKHQLHIPIITESNAFEFEPALADVKGKSLKDRRKKALERISPENIFKDKNNRIKEFAEELDHIIPRTLNDEANLICVTGNRIFCLRDNYRSFINLTPQEQKAFRHALFLADENPIKQAVIRAINNRNRTFVNGTQRYFAEVLANNIYLRAKKENLNTDKISFDYFGIPTIGNGRGIAEIRQLYEKVDSDIQAYAKGDKPQASYSHLIDAMLAFCIAADEHRNDGSIGLEIDKNYSLYPDIFSQIKITDNEFSDKKLVRKKAIEGFNTHRQMTRDGIYAENYLPILIHKELNEVRKGYTWKNSEEIKIFKGKKYDIQQLNNLVYCLKFVDKPISIDIQISTLEELRNILTTNNIAATAEYYYINLKTQKLHEYYIENYNTALGYKKYSKEMEFLRSLAYRSERVKIKSIDDVKQVLDKDSNFIIGKITLPFKKEWQRLYREWQNTTIKDDYEFLKSFFNVKSITKLHKKVRKDFSLPISTNEGKFLVKRKTWDNNFIYQILNDSDSRADGTKPFIPAFDISKNEIVEAIIDSFTSKNIFWLPKNIELQKVDNKNIFAIDTSKWFEVETPSDLRDIGIATIQYKIDNNSRPKVRVKLDYVIDDDSKINYFMNHSLLKSRYPDKVLEILKQSTIIEFESSGFNKTIKEMLGMKLAGI 1622
                                    10        20        30        40        50        60        70        80        90       100       110 ||    130       142       152       162       172       187       197       207      |236       246       256       266||     299       309       319       329       339       349       359       369       379       389       399       409       419       429       439       449       459       469       479       489       499       509       519       529       539       549       559     ||578       588       598       608       618       628       638       648       658       668       678       688       698       708       718       728       738       748  ||   765       775       785       795       805       815       825    || 846       856       866       876       886       896       906       916       926       936       966      |982       999      1046      1056      1066      1076      1086      1096      1106      1116      1126      1136      1146      1156      1166      1176      1186      1207      1217      1227      1237      1247      1257      1267      1277      1287      1297      1307      1317      1327      1337      1347      1357      1367      1377      1387      1397      1407      1417      1427      1437      1447      1457      1467      1477      1487      1497      1507      1517      1527      1537      1547      1557      1567      1577      1587      1597      1607      1617     
                                                                                                                                         112|            138|                                    180|                         214|                              267|                                                                                                                                                                                                                                                                               565|                                                                                                                                                                             751|                                                                    830|                                                                                                   944|     973|        991|    1007|                                                                                                                                                  1195|                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                          123             141                                     186                          234                               291                                                                                                                                                                                                                                                                                575                                                                                                                                                                              759                                                                     842                                                                                                    965      980         999     1045                                                                                                                                                   1207                                                                                                                                                                                                                                                                                                                                                                                                                               


Chain B from PDB  Type:DNA/RNA  Length:94
                                                                                                                               
                5b2o B    1 GGGAAAUUAGGUGCGCUGGGGGUUUCAGUUGCGCCGAAAGGCGCUCUGUAAUCAUUxAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUG   94
                                    10        20        30        40        50      | 60        70        80        90    
                                                                                   57-DU                                  


Chain C from PDB  Type:DNA  Length:30
                                                               
                5b2o C    1 CCGATACCACCCCAGCGCACCTAATTTCCC   30
                                    10        20        30


Chain D from PDB  Type:DNA  Length:9
                                          
                5b2o D    1 TGGTATCGG    9
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5B2O)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5B2O)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5B2O)

(-) Gene Ontology  (9, 9)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ACT  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    CL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    DU  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    EDO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    NA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ZN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
    AD1  [ RasMol ]  +environment [ RasMol ]
    AD2  [ RasMol ]  +environment [ RasMol ]
    AD3  [ RasMol ]  +environment [ RasMol ]
    AD4  [ RasMol ]  +environment [ RasMol ]
    AD5  [ RasMol ]  +environment [ RasMol ]
    AD6  [ RasMol ]  +environment [ RasMol ]
    AD7  [ RasMol ]  +environment [ RasMol ]
    AD8  [ RasMol ]  +environment [ RasMol ]
    AD9  [ RasMol ]  +environment [ RasMol ]
    AE1  [ RasMol ]  +environment [ RasMol ]
    AE2  [ RasMol ]  +environment [ RasMol ]
    AE3  [ RasMol ]  +environment [ RasMol ]
    AE4  [ RasMol ]  +environment [ RasMol ]
    AE5  [ RasMol ]  +environment [ RasMol ]
    AE6  [ RasMol ]  +environment [ RasMol ]
    AE7  [ RasMol ]  +environment [ RasMol ]
    AE8  [ RasMol ]  +environment [ RasMol ]
    AE9  [ RasMol ]  +environment [ RasMol ]
    AF1  [ RasMol ]  +environment [ RasMol ]
    AF2  [ RasMol ]  +environment [ RasMol ]
    AF3  [ RasMol ]  +environment [ RasMol ]
    AF4  [ RasMol ]  +environment [ RasMol ]
    AF5  [ RasMol ]  +environment [ RasMol ]
    AF6  [ RasMol ]  +environment [ RasMol ]
    AF7  [ RasMol ]  +environment [ RasMol ]
    AF8  [ RasMol ]  +environment [ RasMol ]
    AF9  [ RasMol ]  +environment [ RasMol ]
    AG1  [ RasMol ]  +environment [ RasMol ]
    AG2  [ RasMol ]  +environment [ RasMol ]
    AG3  [ RasMol ]  +environment [ RasMol ]
    AG4  [ RasMol ]  +environment [ RasMol ]
    AG5  [ RasMol ]  +environment [ RasMol ]
    AG6  [ RasMol ]  +environment [ RasMol ]
    AG7  [ RasMol ]  +environment [ RasMol ]
    AG8  [ RasMol ]  +environment [ RasMol ]
    AG9  [ RasMol ]  +environment [ RasMol ]
    AH1  [ RasMol ]  +environment [ RasMol ]
    AH2  [ RasMol ]  +environment [ RasMol ]
    AH3  [ RasMol ]  +environment [ RasMol ]
    AH4  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5b2o)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5b2o
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  CAS9_FRATN | A0Q5Y3
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.1.-.-
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  CAS9_FRATN | A0Q5Y3
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        CAS9_FRATN | A0Q5Y3: 5b2p 5b2q

(-) Related Entries Specified in the PDB File

5b2p 5b2q