Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF SMALL RNA METHYLTRANSFERASE HEN1
 
Authors :  Y. Huang, L. -J. Ji, Q. -C. Huang, D. G. Vassylyev, X. -M. Chen, J. -B. Ma
Date :  12 Jun 09  (Deposition) - 29 Sep 09  (Release) - 27 Oct 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.10
Chains :  Asym. Unit :  A,B,C,D,E,F
Biol. Unit 1:  A,B,C  (1x)
Biol. Unit 2:  D,E,F  (1x)
Keywords :  Hen1, Small Rna Methyltransferase, Protein-Rna Complex, Sam Binding Protein, Transferase/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  Y. Huang, L. Ji, Q. Huang, D. G. Vassylyev, X. Chen, J. B. Ma
Structural Insights Into Mechanisms Of The Small Rna Methyltransferase Hen1.
Nature V. 461 823 2009
PubMed-ID: 19812675  |  Reference-DOI: 10.1038/NATURE08433
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - HEN1
    Chains: A, D
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PET28A
    Expression System Strain: BL21(DE3)
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: HEN1
    Mutation: YES
    Organism Scientific: ARABIDOPSIS THALIANA
    Organism Taxid: 3702
 
Molecule 2 - 5'- R(*GP*AP*UP*UP*UP*CP*UP*CP*UP*CP*UP*GP*CP*AP*AP*GP*CP*GP*AP *AP*AP*G)-3'
    Chains: B, E
    Engineered: YES
    Synthetic: YES
 
Molecule 3 - 5'- R(P*UP*UP*CP*GP*CP*UP*UP*GP*CP*AP*GP*AP*GP*AP*GP*AP*AP*AP*U P*CP*AP*C)-3'
    Chains: C, F
    Engineered: YES
    Synthetic: YES

 Structural Features

(-) Chains, Units

  123456
Asymmetric Unit : ABCDEF
Biological Unit 1 (1x): ABC   
Biological Unit 2 (1x):    DEF

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 4)

Asymmetric Unit (2, 4)
No.NameCountTypeFull Name
1MG2Ligand/IonMAGNESIUM ION
2SAH2Ligand/IonS-ADENOSYL-L-HOMOCYSTEINE
Biological Unit 1 (1, 1)
No.NameCountTypeFull Name
1MG-1Ligand/IonMAGNESIUM ION
2SAH1Ligand/IonS-ADENOSYL-L-HOMOCYSTEINE
Biological Unit 2 (1, 1)
No.NameCountTypeFull Name
1MG-1Ligand/IonMAGNESIUM ION
2SAH1Ligand/IonS-ADENOSYL-L-HOMOCYSTEINE

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREGLU A:796 , GLU A:799 , HIS A:800 , HIS A:860 , G B:22BINDING SITE FOR RESIDUE MG A 950
2AC2SOFTWAREARG A:701 , GLY A:721 , GLY A:723 , SER A:726 , ASP A:745 , ILE A:746 , SER A:747 , GLY A:777 , SER A:778 , ILE A:779 , LEU A:780 , LEU A:795 , GLU A:796 , VAL A:797 , HIS A:800 , G B:22BINDING SITE FOR RESIDUE SAH A 951
3AC3SOFTWAREGLU D:796 , GLU D:799 , HIS D:800 , HIS D:860 , G E:22BINDING SITE FOR RESIDUE MG D 950
4AC4SOFTWAREGLY D:721 , CYS D:722 , SER D:724 , SER D:726 , ASP D:745 , ILE D:746 , SER D:747 , GLY D:777 , SER D:778 , ILE D:779 , LEU D:795 , GLU D:796 , VAL D:797 , HOH D:949 , G E:22BINDING SITE FOR RESIDUE SAH D 951

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3HTX)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 3HTX)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3HTX)

(-) PROSITE Motifs  (1, 2)

Asymmetric Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1HTH_LAPS50961 La-type HTH domain profile.HEN1_ARATH93-204
 		  2A:93-204
D:93-204
Biological Unit 1 (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1HTH_LAPS50961 La-type HTH domain profile.HEN1_ARATH93-204
 		  1A:93-204
-
Biological Unit 2 (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1HTH_LAPS50961 La-type HTH domain profile.HEN1_ARATH93-204
 		  1-
D:93-204

(-) Exons   (0, 0)

(no "Exon" information available for 3HTX)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:779
 aligned with HEN1_ARATH | Q9C5Q8 from UniProtKB/Swiss-Prot  Length:942

    Alignment length:927
                                    16        26        36        46        56        66        76        86        96       106       116       126       136       146       156       166       176       186       196       206       216       226       236       246       256       266       276       286       296       306       316       326       336       346       356       366       376       386       396       406       416       426       436       446       456       466       476       486       496       506       516       526       536       546       556       566       576       586       596       606       616       626       636       646       656       666       676       686       696       706       716       726       736       746       756       766       776       786       796       806       816       826       836       846       856       866       876       886       896       906       916       926       
           HEN1_ARATH     7 HTPTPKAIIHQKFGAKASYTVEEVHDSSQSGCLGLAIPQKGPCLYRCHLQLPEFSVVSNVFKKKKDSEQSAAELALDKLGIRPQNDDLTVDEARDEIVGRIKYIFSDEFLSAEHPLGAHLRAALRRDGERCGSVPVSVIATVDAKINSRCKIINPSVESDPFLAISYVMKAAAKLADYIVASPHGLRRKNAYPSEIVEALATHVSDSLHSREVAAVYIPCIDEEVVELDTLYISSNRHYLDSIAERLGLKDGNQVMISRMFGKASCGSECRLYSEIPKKYLDNSSDASGTSNEDSSHIVKSRNARASYICGQDIHGDAILASVGYRWKSDDLDYDDVTVNSFYRICCGMSPNGIYKISRQAVIAAQLPFAFTTKSNWRGPLPREILGLFCHQHRLAEPILSSSTAPVKSLSDIFRSHKKLKVSGVDDANENLSRQKEDTPGLGHGFRCEVKIFTKSQDLVLECSPRKFYEKENDAIQNASLKALLWFSKFFADLDVDGEQSCDTDDDQDTKSSSPNVFAAPPILQKEHSSESKNTNVLSAEKRVQSITNGSVVSICYSLSLAVDPEYSSDGESPREDNESNEEMESEYSANCESSVELIESNEEIEFEVGTGSMNPHIESEVTQMTVGEYASFRMTPPDAAEALILAVGSDTVRIRSLLSERPCLNYNILLLGVKGPSEERMEAAFFKPPLSKQRVEYALKHIRESSASTLVDFGCGSGSLLDSLLDYPTSLQTIIGVDISPKGLARAAKMLHVKLNKEACNVKSATLYDGSILEFDSRLHDVDIGTCLEVIEHMEEDQACEFGEKVLSLFHPKLLIVSTPNYEFNTILQRSTPETQEENNSEPQLPKFRNHDHKFEWTREQFNQWASKLGKRHNYSVEFSGVGGSGEVEPGFASQIAIFRREASSVENVAESSMQPYKVIWEWKKE 933
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhheeeeeee...................eeeeeee....eee.....hhhhhhhhhhhhhhh...........hhhhhhhhhhhhhhhhh.hhhhhh..hhhhhhhhhhhhhhhhh.eehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh...eeee..eeee....hhhhhhhhhhh...---.eeeeeeee........eeeeeee....hhhhhhhhhh.......eee....hhhhhh...eeeee.hhhhhh.------------.......hhhhhhhhh......eeeeeeee......eeee..hhhhhhhhhhh.hhhhhhhhhhh....................hhhhhhhhhhhh......eee...--------------------------------------------.eeeeee..eeeeee.......hhhhhhhhhhhhhhhhhhh.....----------------------------------...ee..----------.....eeeeeeeeeeeee..----------------------------...eeeeeeeeeeeee.....hhhhhhhhh......eeeeee.....hhhhhhhhh.hhhhhhhhh...eeeeeeeeeeeee..............hhhhhhhhhhhhhhhhh...eeeee....hhhhhhhh.......eeeeee.hhhhhhhhhhhhhhhh........eeeeee..............eeeee.hhhhhhhhhhhhhhhhhhhh....eeeeee.hhhhhhhhh..------------..............hhhhhhhhhhhhhhhh.eeeeeeee...........eeeeeeee...-----.........eeeeee.. Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------HTH_LA  PDB: A:93-204 UniProt: 93-204                                                                           --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3htx A   7 HTPTPKAIIHQKFGAKASYTVEEVHDSSQSGCPGLAIPQKGPCLYRCHLQLPEFSVVSNVFKKKKDSEQSAAELALDKLGIRPQNDDLTVDEARDEIVGRIKYIFSDEFLSAEHPLGAHLRAALRRDGERCGSVPVSVIATVDAKINSRCKIINPSVESDPFLAISYVMKAAAKLADYIVASPHGLRRKNAYPSEIVEALATHVSD---SREVAAVYIPCIDEEVVELDTLYISSNRHYLDSIAERLGLKDGNQVMISRMFGKASCGSECRLYSEIPKKYLDN------------SHIVKSRNARASYICGQDIHGDAILASVGYRWKSDDLDYDDVTVNSFYRICCGMSPNGIYKISRQAVIAAQLPFAFTTKSNWRGPLPREILGLFCHQHRLAEPILSSST--------------------------------------------EVKIFTKSQDLVLECSPRKFYEKENDAIQNASLKALLWFSKFFADL----------------------------------SSESKNT----------SITNGSVVSICYSLSLAVDP----------------------------SSVEPIESNEEIEFEVGTGSMNPHIESEVTQMTVGEYASFKMTPPDAAEALILAVGSDTVRIRSLLSERPCLNYNILLLGVKGPSEERMEAAFFKPPLSKQRVEYALKHIRESSASTLVDFGCGSGSLLDSLLDYPTSLQTIIGVDISPKGLARAAKMLHVKLNKEACNVKSATLYDGSILEFDSRLHDVDIGTCLEVIEHMEEDQACEFGEKVLSLFHPKLLIVSTPNYEFNTILQRS------------QLPKFRNHDHKFEWTREQFNQWASKLGKRHNYSVEFSGVGGSGEVEPGFASQIAIFRREAS-----AESSMQPYKVIWEWKKE 933
                                    16        26        36        46        56        66        76        86        96       106       116       126       136       146       156       166       176       186       196       206     | 216       226       236       246       256       266       276       286  |      -     | 306       316       326       336       346       356       366       376       386       396       406   |     -         -         -         -       456       466       476       486       496   |     -         -         -       536    |    -     | 556       566    |    -         -         -   |   606       616       626       636       646       656       666       676       686       696       706       716       726       736       746       756       766       776       786       796       806       816       826       836 |       -    |  856       866       876       886       896       906    |    -|      926       
                                                                                                                                                                                                                                       212 216                                                                      289          302                                                                                                         410                                          455                                          500                                535   541        552                571                          600                                                                                                                                                                                                                                           838          851                                                         911   917                


Chain B from PDB  Type:RNA  Length:22
                                                      
                 3htx B   1 GAUUUCUCUCUGCAAGCGAAAG  22
                                    10        20  


Chain C from PDB  Type:RNA  Length:22
                                                      
                 3htx C   1 UUCGCUUGCAGAGAGAAAUCAC  22
                                    10        20  


Chain D from PDB  Type:PROTEIN  Length:795
 aligned with HEN1_ARATH | Q9C5Q8 from UniProtKB/Swiss-Prot  Length:942

    Alignment length:927
                                    16        26        36        46        56        66        76        86        96       106       116       126       136       146       156       166       176       186       196       206       216       226       236       246       256       266       276       286       296       306       316       326       336       346       356       366       376       386       396       406       416       426       436       446       456       466       476       486       496       506       516       526       536       546       556       566       576       586       596       606       616       626       636       646       656       666       676       686       696       706       716       726       736       746       756       766       776       786       796       806       816       826       836       846       856       866       876       886       896       906       916       926       
           HEN1_ARATH     7 HTPTPKAIIHQKFGAKASYTVEEVHDSSQSGCLGLAIPQKGPCLYRCHLQLPEFSVVSNVFKKKKDSEQSAAELALDKLGIRPQNDDLTVDEARDEIVGRIKYIFSDEFLSAEHPLGAHLRAALRRDGERCGSVPVSVIATVDAKINSRCKIINPSVESDPFLAISYVMKAAAKLADYIVASPHGLRRKNAYPSEIVEALATHVSDSLHSREVAAVYIPCIDEEVVELDTLYISSNRHYLDSIAERLGLKDGNQVMISRMFGKASCGSECRLYSEIPKKYLDNSSDASGTSNEDSSHIVKSRNARASYICGQDIHGDAILASVGYRWKSDDLDYDDVTVNSFYRICCGMSPNGIYKISRQAVIAAQLPFAFTTKSNWRGPLPREILGLFCHQHRLAEPILSSSTAPVKSLSDIFRSHKKLKVSGVDDANENLSRQKEDTPGLGHGFRCEVKIFTKSQDLVLECSPRKFYEKENDAIQNASLKALLWFSKFFADLDVDGEQSCDTDDDQDTKSSSPNVFAAPPILQKEHSSESKNTNVLSAEKRVQSITNGSVVSICYSLSLAVDPEYSSDGESPREDNESNEEMESEYSANCESSVELIESNEEIEFEVGTGSMNPHIESEVTQMTVGEYASFRMTPPDAAEALILAVGSDTVRIRSLLSERPCLNYNILLLGVKGPSEERMEAAFFKPPLSKQRVEYALKHIRESSASTLVDFGCGSGSLLDSLLDYPTSLQTIIGVDISPKGLARAAKMLHVKLNKEACNVKSATLYDGSILEFDSRLHDVDIGTCLEVIEHMEEDQACEFGEKVLSLFHPKLLIVSTPNYEFNTILQRSTPETQEENNSEPQLPKFRNHDHKFEWTREQFNQWASKLGKRHNYSVEFSGVGGSGEVEPGFASQIAIFRREASSVENVAESSMQPYKVIWEWKKE 933
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhh....eeeeee...................eeeeeee....eee.....hhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhhh..hhhhh.hhhhhhhhhhh..hhhhh.eehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....eeee..eeee....hhhhhhhhh.........eeeeeeee........eeeeeee....hhhhhhhhh....hhh.eee....hhhhhh...eeeee..........------------.....hhhhhhhhh......eeeeeeee......eeee..hhhhhhhhhhhhhhhhhhhhhh.....................hhhhhhhhhhhhh..eeeeee..-------------------------------------------...eeeeee..eeeeee........hhhhhhhhhhhhhhhhhhhh...-------------------.........------..ee.-------...........eeeeeeeeeee.....-------------------------....eeeeeeeeeeee.......hhhhhhhhh.....eeeeee.....hhhhhhh...hhhhhhhhhhh..eeeeeeeeeeee..............hhhhhhhhhhhhhhhhh...eeeee....hhhhhhhhh......eeeeee.hhhhhhhhhhhhhhhhhhh.....eeeeee..............eeee.......hhhhhhhhhhhhhhhh...eeee.ee...hhhhhhhhh------------.............hhhhhhhhhhhhhhhh.eeeeeeeeee.......eeeeeeeeee.--------..........eeee.. Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------HTH_LA  PDB: D:93-204 UniProt: 93-204                                                                           --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3htx D   7 HTPTPKAIIHQKFGAKASYTVEEVHDSSQSGCPGLAIPQKGPCLYRCHLQLPEFSVVSNVFKKKKDSEQSAAELALDKLGIRPQNDDLTVDEARDEIVGRIKYIFSDEFLSAEHPLGAHLRAALRRDGERCGSVPVSVIATVDAKINSRCKIINPSVESDPFLAISYVMKAAAKLADYIVASPHGLRRKNAYPSEIVEALATHVSDSLHSREVAAVYIPCIDEEVVELDTLYISSNRHYLDSIAERLGLKDGNQVMISRMFGKASCGSECRLYSEIPKKYLDNSS------------IVKSRNARASYICGQDIHGDAILASVGYRWKSDDLDYDDVTVNSFYRICCGMSPNGIYKISRQAVIAAQLPFAFTTKSNWRGPLPREILGLFCHQHRLAEPILSSS-------------------------------------------RCEVKIFTKSQDLVLECSPRKFYEKENDAIQNASLKALLWFSKFFADL-------------------SPNVFAAPP------SSESK-------EKRVQSITNGSVVSICYSLSLAVDPEY-------------------------ESSVEPIESNEEIEFEVGTGSMNPHIESEVTQMTVGEYASFKMTPPDAAEALILAVGSDTVRIRSLLSERPCLNYNILLLGVKGPSEERMEAAFFKPPLSKQRVEYALKHIRESSASTLVDFGCGSGSLLDSLLDYPTSLQTIIGVDISPKGLARAAKMLHVKLNKEACNVKSATLYDGSILEFDSRLHDVDIGTCLEVIEHMEEDQACEFGEKVLSLFHPKLLIVSTPNYEFNTILQRST------------LPKFRNHDHKFEWTREQFNQWASKLGKRHNYSVEFSGVGGSGEVEPGFASQIAIFRRE--------ESSMQPYKVIWEWKKE 933
                                    16        26        36        46        56        66        76        86        96       106       116       126       136       146       156       166       176       186       196       206       216       226       236       246       256       266       276       286    |    -       306       316       326       336       346       356       366       376       386       396       406  |      -         -         -         -      |456       466       476       486       496   |     -         -   |   526 |     536  |      -|      556       566      |  -         -         -  |    606       616       626       636       646       656       666       676       686       696       706       716       726       736       746       756       766       776       786       796       806       816       826       836  |      -     | 856       866       876       886       896       906  |      - |     926       
                                                                                                                                                                                                                                                                                                                      291          304                                                                                                      409                                         453                                            500                 520     528    535 539     547                       573                       599                                                                                                                                                                                                                                             839          852                                                      909      918               


Chain E from PDB  Type:RNA  Length:22
                                                      
                 3htx E   1 GAUUUCUCUCUGCAAGCGAAAG  22
                                    10        20  


Chain F from PDB  Type:RNA  Length:22
                                                      
                 3htx F   1 UUCGCUUGCAGAGAGAAAUCAC  22
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 3HTX)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 3HTX)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 3HTX)

(-) Gene Ontology  (19, 19)

Asymmetric Unit(hide GO term definitions)
Chain A,D   (HEN1_ARATH | Q9C5Q8)
molecular function
    GO:0008171    O-methyltransferase activity    Catalysis of the transfer of a methyl group to the oxygen atom of an acceptor molecule.
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0008173    RNA methyltransferase activity    Catalysis of the transfer of a methyl group from a donor to a nucleoside residue in an RNA molecule.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0008168    methyltransferase activity    Catalysis of the transfer of a methyl group to an acceptor molecule.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
    GO:0001510    RNA methylation    Posttranscriptional addition of a methyl group to either a nucleotide or 2'-O ribose in a polyribonucleotide. Usually uses S-adenosylmethionine as a cofactor.
    GO:0031047    gene silencing by RNA    Any process in which RNA molecules inactivate expression of target genes.
    GO:0010589    leaf proximal/distal pattern formation    The regionalization process within a leaf by which specific areas of cell differentiation are determined along a proximal/distal axis.
    GO:0010305    leaf vascular tissue pattern formation    Vascular tissue pattern formation as it occurs in the leaf of vascular plants.
    GO:0035279    mRNA cleavage involved in gene silencing by miRNA    The process in which microRNAs (miRNAs) direct the cleavage of target mRNAs. Once incorporated into a RNA-induced silencing complex (RISC), a miRNA base pairing with near-perfect complementarity to the target mRNA will typically direct targeted endonucleolytic cleavage of the mRNA. Many plant miRNAs downregulate gene expression through this mechanism.
    GO:0032259    methylation    The process in which a methyl group is covalently attached to a molecule.
    GO:0035196    production of miRNAs involved in gene silencing by miRNA    Cleavage of stem-loop RNA precursors into microRNAs (miRNAs), a class of small RNAs that primarily silence genes by blocking the translation of mRNA transcripts into protein.
    GO:0030422    production of siRNA involved in RNA interference    Cleavage of double-stranded RNA to form small interfering RNA molecules (siRNAs) of 21-23 nucleotides, in the context of RNA interference.
    GO:0009909    regulation of flower development    Any process that modulates the frequency, rate or extent of flower development.
    GO:0010093    specification of floral organ identity    The process in which the identity of a floral organ primordium is specified. Identity is considered to be the aggregate of characteristics by which a structure is recognized.
    GO:0009616    virus induced gene silencing    Specific posttranscriptional gene inactivation ('silencing') both of viral gene(s), and host gene(s) homologous to the viral genes. This silencing is triggered by viral infection, and occurs through a specific decrease in the level of mRNA of both host and viral genes.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    SAH  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 3htx)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  3htx
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  HEN1_ARATH | Q9C5Q8
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  HEN1_ARATH | Q9C5Q8
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 3HTX)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 3HTX)