Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF FRANCISELLA NOVICIDA CAS9 RHA IN COMPLEX WITH SGRNA AND TARGET DNA (TGG PAM)
 
Authors :  H. Hirano, H. Nishimasu, T. Nakane, R. Ishitani, O. Nureki
Date :  01 Feb 16  (Deposition) - 02 Mar 16  (Release) - 09 Mar 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  1.70
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Crispr-Cas9, Genome Engineering, Hydrolase-Rna-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  H. Hirano, J. S. Gootenberg, T. Horii, O. O. Abudayyeh, M. Kimura, P. D. Hsu, T. Nakane, R. Ishitani, I. Hatada, F. Zhang, H. Nishimasu, O. Nureki
Structure And Engineering Of Francisella Novicida Cas9
Cell V. 164 950 2016
PubMed-ID: 26875867  |  Reference-DOI: 10.1016/J.CELL.2016.01.039

(-) Compounds

Molecule 1 - CRISPR-ASSOCIATED ENDONUCLEASE CAS9
    Chains: A
    EC Number: 3.1.-.-
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PE-SUMO
    Expression System Strain: BL21(DE3) ROSETTA2
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: CAS9, FTN_0757
    Mutation: YES
    Organism Scientific: FRANCISELLA TULARENSIS SUBSP. NOVICIDA U112
    Organism Taxid: 401614
    Strain: U112
 
Molecule 2 - GUIDE RNA
    Chains: B
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Other Details: IN VITRO TRANSCRIPTION
    Synthetic: YES
 
Molecule 3 - TARGET DNA
    Chains: C
    Engineered: YES
    Organism Scientific: FRANCISELLA TULARENSIS SUBSP. NOVICIDA
    Organism Taxid: 264
    Other Details: CHEMICAL SYNTHESIS
    Synthetic: YES
 
Molecule 4 - DNA (5'-D(*TP*GP*GP*TP*AP*TP*CP*GP*G)-3')
    Chains: D
    Engineered: YES
    Organism Scientific: FRANCISELLA TULARENSIS SUBSP. NOVICIDA
    Organism Taxid: 264
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (7, 51)

Asymmetric/Biological Unit (7, 51)
No.NameCountTypeFull Name
1ACT2Ligand/IonACETATE ION
2CA17Ligand/IonCALCIUM ION
3CL2Ligand/IonCHLORIDE ION
4DU1Mod. Residue
5EDO24Ligand/Ion1,2-ETHANEDIOL
6NA4Ligand/IonSODIUM ION
7ZN1Ligand/IonZINC ION

(-) Sites  (50, 50)

Asymmetric Unit (50, 50)
No.NameEvidenceResiduesDescription
01AC1SOFTWARECYS A:460 , CYS A:657 , CYS A:814 , CYS A:817binding site for residue ZN A 1701
02AC2SOFTWAREPHE A:647 , ASP A:649 , HOH A:1850 , HOH A:2200 , HOH A:2206 , HOH A:2338binding site for residue NA A 1702
03AC3SOFTWAREASN A:1248 , HOH A:1975 , HOH A:2003 , HOH A:2323 , HOH A:2369 , HOH B:534binding site for residue NA A 1703
04AC4SOFTWARELYS A:564 , PHE A:602 , HOH A:2267 , HOH A:2334binding site for residue CL A 1704
05AC5SOFTWARELYS A:366 , LYS A:370 , TRP A:395 , GLU A:399 , HOH A:2079binding site for residue CL A 1705
06AC6SOFTWAREASP A:11 , GLU A:903 , HIS A:1162 , HOH A:1851 , HOH A:1870binding site for residue CA A 1706
07AC7SOFTWAREASP A:66 , HOH A:1931 , A B:60 , HOH B:318 , HOH B:458 , HOH B:479 , HOH B:493binding site for residue CA A 1707
08AC8SOFTWAREHOH A:1804 , HOH A:2088 , HOH A:2335 , HOH A:2342 , HOH C:111 , HOH C:117 , HOH C:157binding site for residue CA A 1708
09AC9SOFTWAREASP A:66 , HOH A:1808 , HOH B:267 , HOH B:288 , HOH B:368 , HOH B:398 , HOH B:458 , HOH B:520binding site for residue CA A 1709
10AD1SOFTWAREVAL A:402 , HOH A:2283 , HOH A:2299 , U B:83 , HOH B:335 , HOH B:503binding site for residue CA A 1710
11AD2SOFTWAREHOH A:1901 , HOH A:1906 , HOH A:2387 , HOH B:218 , HOH B:257 , HOH B:490binding site for residue CA A 1711
12AD3SOFTWARESER A:507 , HOH A:2286 , HOH A:2327 , HOH B:336 , HOH B:440binding site for residue CA A 1712
13AD4SOFTWARELYS A:1415 , ASP A:1417 , HOH A:1902 , HOH A:2332 , HOH A:2336binding site for residue CA A 1713
14AD5SOFTWAREHOH A:1948 , HOH A:2059 , HOH A:2242 , HOH B:282 , HOH B:506 , HOH C:103 , HOH C:152binding site for residue CA A 1714
15AD6SOFTWAREGLU A:1231 , ASN A:1234 , ASP A:1498 , SER A:1499binding site for residue CA A 1715
16AD7SOFTWARELYS A:45 , TYR A:48 , LEU A:50 , LEU A:51 , VAL A:911 , HOH A:2153binding site for residue EDO A 1716
17AD8SOFTWAREASP A:90 , THR A:91 , TYR A:332 , ASN A:335 , PHE A:336 , TYR A:345 , HOH A:1914 , HOH A:2279binding site for residue EDO A 1717
18AD9SOFTWAREHIS A:394 , LEU A:397 , GLY A:398 , HOH A:2016 , HOH B:226 , HOH B:370binding site for residue EDO A 1718
19AE1SOFTWARELEU A:626 , TYR A:627 , ILE A:628 , TYR A:656 , ARG A:1093 , GLU A:1097 , HOH A:1990 , HOH A:2099binding site for residue EDO A 1719
20AE2SOFTWAREARG A:625 , TYR A:627 , SER A:1118 , PHE A:1119 , HOH A:1972 , HOH A:2165binding site for residue EDO A 1720
21AE3SOFTWARELYS A:459 , GLY A:645 , PHE A:647 , ASN A:658 , HOH A:1806 , HOH A:2080binding site for residue EDO A 1721
22AE4SOFTWAREPRO A:1251 , TYR A:1265 , TYR A:1329 , EDO B:110 , EDO B:116 , HOH B:379binding site for residue EDO A 1722
23AE5SOFTWAREASN A:1089 , GLY A:1090 , HOH A:1892 , DC C:21 , DT C:22binding site for residue EDO A 1723
24AE6SOFTWARESER A:105 , ILE A:107 , ASP A:406 , PRO A:447 , PRO A:448 , HOH A:2048 , HOH A:2066binding site for residue EDO A 1724
25AE7SOFTWARELEU A:6 , SER A:21 , ALA A:22 , PHE A:23 , ASN A:37 , ASN A:877 , ASN A:880binding site for residue EDO A 1725
26AE8SOFTWAREGLN A:478 , TYR A:530 , LYS A:531 , ASP A:534binding site for residue EDO A 1726
27AE9SOFTWARESER A:899 , ALA A:901 , PHE A:904 , ASN A:1089binding site for residue EDO A 1727
28AF1SOFTWAREASN A:1248 , SER A:1368 , ARG A:1370 , PHE A:1398 , HOH A:1977 , HOH A:2003 , C B:44 , HOH B:228binding site for residue ACT A 1728
29AF2SOFTWAREGLN A:92 , THR A:1458 , TRP A:1459 , ASP A:1460 , ASN A:1462 , HOH A:1968 , HOH A:2195 , A B:50binding site for residue ACT A 1729
30AF3SOFTWAREG B:28 , U B:30 , U B:45 , NA B:102 , HOH B:334 , HOH B:475 , HOH B:515binding site for residue NA B 101
31AF4SOFTWAREU B:45 , NA B:101 , HOH B:260 , HOH B:279 , HOH B:474 , HOH B:475 , HOH B:514binding site for residue NA B 102
32AF5SOFTWAREHOH B:210 , HOH B:236 , HOH B:262 , HOH B:269 , HOH B:307 , HOH B:366 , HOH B:504binding site for residue CA B 103
33AF6SOFTWAREHOH A:2356 , U B:93 , HOH B:455 , HOH B:461 , HOH B:481 , HOH B:529binding site for residue CA B 104
34AF7SOFTWAREG B:74 , HOH B:283 , HOH B:343 , HOH B:390 , HOH B:399 , HOH B:501binding site for residue CA B 105
35AF8SOFTWAREHOH A:2322 , HOH B:211 , HOH B:255 , HOH B:344 , HOH B:357 , HOH B:422 , HOH B:531binding site for residue CA B 106
36AF9SOFTWAREHOH A:2021 , HOH A:2204 , HOH A:2385 , HOH B:222 , HOH B:361 , HOH B:485 , HOH B:513binding site for residue CA B 107
37AG1SOFTWAREHOH A:2351 , HOH A:2379 , G B:20 , HOH B:206 , HOH B:221 , HOH B:403 , HOH B:425 , HOH B:533binding site for residue CA B 108
38AG2SOFTWAREU B:12 , G B:13 , HOH B:204 , HOH B:502 , HOH C:123binding site for residue CA B 109
39AG3SOFTWARETYR A:1265 , EDO A:1722 , C B:42 , G B:43 , HOH B:258 , HOH B:300binding site for residue EDO B 110
40AG4SOFTWAREARG A:1404 , HOH A:2038 , G B:31 , C B:44 , U B:45 , HOH B:275binding site for residue EDO B 111
41AG5SOFTWAREARG A:59 , ARG A:62 , HOH A:1931 , A B:61 , G B:62binding site for residue EDO B 112
42AG6SOFTWARESER A:105 , TYR A:449 , U B:17 , HOH B:245 , HOH B:264 , HOH B:384binding site for residue EDO B 113
43AG7SOFTWAREGLY A:309 , G B:19 , G B:20 , HOH B:230 , HOH B:295 , HOH B:298 , HOH C:118binding site for residue EDO B 114
44AG8SOFTWAREARG A:369 , G B:73 , C B:89 , HOH B:243 , HOH B:244 , HOH B:308 , HOH B:391binding site for residue EDO B 115
45AG9SOFTWARETYR A:1329 , EDO A:1722 , C B:34 , C B:35 , G B:41 , HOH B:300binding site for residue EDO B 116
46AH1SOFTWAREMET A:52 , ARG A:55 , G B:69 , A B:70 , HOH B:248 , HOH B:394binding site for residue EDO B 117
47AH2SOFTWAREG B:28 , HOH B:202 , HOH B:260 , HOH B:279 , HOH B:475binding site for residue EDO B 118
48AH3SOFTWAREC B:32 , G B:33 , C B:34 , HOH B:281 , HOH B:310binding site for residue EDO B 119
49AH4SOFTWAREA B:71 , G B:94 , HOH B:223binding site for residue EDO B 120
50AH5SOFTWAREARG A:455 , LYS A:456 , A B:71 , C B:89 , HOH B:244 , HOH B:262binding site for residue EDO B 121

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5B2Q)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5B2Q)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5B2Q)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5B2Q)

(-) Exons   (0, 0)

(no "Exon" information available for 5B2Q)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:1455
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..eee..eeeee...eeeeeee.ee...hhhhh..eeeeeeee........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhh.............hhhhhhhhhhh.....hhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhh.hhhhhhhh...hhhhhhhhhhhhhhhhhhhhh...hhhhh.....hhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh....hhhhhhhhhhhhh......hhhhhhhhhhhhhh.hhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhh......hhhhh.....hhhhhhhhhhhhhhhhhhhhhhh..hhhhhh................eeehhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhh.........ee.....hhhhhh..eehhhhhhhhhhhhhh.hhhhh..hhhhhhhhhhhhhh..hhhhhhhhhhh..hhhhh..ee..ee...hhhhhhhhhhhhhhhhhh.....eeeeeee....eeeeeeeee.....eee......hhhhhhhhhhhhhhh.hhhhhhhhhh..hhhhhhhhhhhhh.hhhhhhhhhhhhhhhh..hhhhhhhhhhhhh...hhhhhhhhhhhhh...hhhhhhhhhhhh.....hhhhhhhhhh...hhhhhhhhhhhhh.........hhhhhhhhhhhhhee....ee.............hhhhhhhhhhhhhhhhhhhhhhhhhhhhh..eeeeeeeeeehhhhhhhhhhhhh....hhhhhhhhhh......hhhhhhhhhhh..eeee.......hhh.eeee..................hhhhhhhhhhhhhh...hhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhh......eeeeeee........hhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhhhhhh...................hhhhhh......eeeee...............eeeeeeeeee..eeee.....eeee.....eeee..ee..eehhhhhhhhhhhhhhh...........hhhhhhhhhhhh.......eeee..hhhhhhhhhhhhhhhhhh....hhhhhhhhhheeeeeeeee.hhhhhhhhhhhhhh.ee..ee..hhhhhhhhhhhhhhh...hhhhhhhhhh...............eeeeeee....eeeeee.....eeeeeeee..........eeeeee....eeeeee.hhhh...eee..............eee.....eeee..hhhhhh..eeeeeee.......eeeeee.....hhhhhhhhhhh......hhhhhhhhhh...eeeee....hhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                5b2q A    1 MNFKILPIAIDLGVKNTGVFSAFYQKGTSLERLDNKNGKVYELSKDSYTLLMNNRTARRHQRRGIDRKQLVKRLFKLIWTEQLNLEWDKDTQQAISFLFNRRGFSFITDGYSVKAILMDIFDDYNGEDDSYLKLATEQESKISEIYNKLMQKILEFKLMKLCTDIKDDTLKEITSYEFELLADYLANYSESLKTQKFYNIQEFLKRHATINDRILDTLLTDDLDIWNFNFELHHFVFAVNKIKSEMASGGRHRSQYFQEITNVLDENNHQEGYLKNFCENLHNKKYSNLSVKNLVNLIGNLSNLELKPLRKYFNDKIHAKADHWDEQKFTETYCHWILGEWRVGVKDQDKKDGAKYSYKDLCNELKQKVTKAGLVDFLLELDPCRTIPPYLDNNNRKPPKCQSLILNPKFLDNQYPNWQQYLQELKKLQSIQNYLDSFETDLKVLKSSKDQPYFVEYKSSNQQIASGQRDYKDLDARILQFIFDRVKASDELLLNEIYFQAKKLKQESSKKLDEVIANSQLSQILKSQHTNGIFEQGTFLHLVCKYYKQRQRARDSRLYIMPEYRYDKKLHKYNNTGRFDDDNQLLTYCNHKPRQKRYQLLNDLAGVLQVSPNFLKDKIGSDDDLFISKWLVEHIRGFKKACEDSLKIQKDNRGLLNHKINIARNTKGKCEKEIFNLICKIEGYKHGLAYELGVLLFGEPNEASKPEFDRKIKKFNSIYSFAQIQQIAFAERKGNANTCAVCSADNAHRMQQIKIILSAKAQRLPAIPTRIVDGAVKKMATILAKNIVDDNWQNIKQVLSAKHQLHIPIITESNAFEFEPALADVKGKSLKDRRKKALERISPENIFKDKNNRIKEFAEELDHIIPRTLNDEANLICVTGNRIFCLRDNYRSFINLTPQEQKAFRHALFLADENPIKQAVIRAINNRNRTFVNGTQRYFAEVLANNIYLRAKKENLNTDKISFDYFGIPTIGNGRGIAEIRQLYEKVDSDIQAYAKGDKPQASYSHLIDAMLAFCIAADEHRNDGSIGLEIDKNYSLYPDIFSQIKITDNEFSDKKLVRKKAIEGFNTHRQMTRDGIYAENYLPILIHKELNEVRKGYTWKNSEEIKIFKGKKYDIQQLNNLVYCLKFVDKPISIDIQISTLEELRNILTTNNIAATAEYYYINLKTQKLHEYYIENYNTALGYKKYSKEMEFLRSLAYRSRRVKIKSIDDVKQVLDKDSNFIIGKITLPFKKEWQRLYREWQNTTIKDDYEFLKSFFNVKSITKLHKKVRKDFSLPISTNHGKFLVKRKTWDNNFIYQILNDSDSRADGTKPFIPAFDISKNEIVEAIIDSFTSKNIFWLPKNIELQKVDNKNIFAIDTSKWFEVETPSDLRDIGIATIQYKIDNNSAPKVRVKLDYVIDDDSKINYFMNHSLLKSRYPDKVLEILKQSTIIEFESSGFNKTIKEMLGMKLAGI 1622
                                    10        20        30        40        50        60        70        80        90       100       110 ||    130       142       152       162       172       187       197       207      |236       246       256       266||     299       309       319       329       339       349       359       369       379       389       399       409       419       429       439       449       459       469       479       489       499       509       519       529       539       549       559     ||578       588       598       608       618       628       638       648       658       668       678       688       698       708       718       728       738       748  ||   765       775       785       795       805       815       825    || 846       856       866       876       886       896       906       916       926       936       966      |982       999      1046      1056      1066      1076      1086      1096      1106      1116      1126      1136      1146      1156      1166      1176      1186      1207      1217      1227      1237      1247      1257      1267      1277      1287      1297      1307      1317      1327      1337      1347      1357      1367      1377      1387      1397      1407      1417      1427      1437      1447      1457      1467      1477      1487      1497      1507      1517      1527      1537      1547      1557      1567      1577      1587      1597      1607      1617     
                                                                                                                                         112|            138|                                    180|                         214|                              267|                                                                                                                                                                                                                                                                               565|                                                                                                                                                                             751|                                                                    830|                                                                                                   944|     973|        991|    1007|                                                                                                                                                  1195|                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                          123             141                                     186                          234                               291                                                                                                                                                                                                                                                                                575                                                                                                                                                                              759                                                                     842                                                                                                    965      980         999     1045                                                                                                                                                   1207                                                                                                                                                                                                                                                                                                                                                                                                                               


Chain B from PDB  Type:DNA/RNA  Length:94
                                                                                                                               
                5b2q B    1 GGGAAAUUAGGUGCGCUGGGGGUUUCAGUUGCGCCGAAAGGCGCUCUGUAAUCAUUxAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUG   94
                                    10        20        30        40        50      | 60        70        80        90    
                                                                                   57-DU                                  


Chain C from PDB  Type:DNA  Length:30
                                                               
                5b2q C    1 CCGATACCACCCCAGCGCACCTAATTTCCC   30
                                    10        20        30


Chain D from PDB  Type:DNA  Length:9
                                          
                5b2q D    1 TGGTATCGG    9
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5B2Q)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5B2Q)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5B2Q)

(-) Gene Ontology  (9, 9)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ACT  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    CL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    DU  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    EDO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    NA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ZN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
    AD1  [ RasMol ]  +environment [ RasMol ]
    AD2  [ RasMol ]  +environment [ RasMol ]
    AD3  [ RasMol ]  +environment [ RasMol ]
    AD4  [ RasMol ]  +environment [ RasMol ]
    AD5  [ RasMol ]  +environment [ RasMol ]
    AD6  [ RasMol ]  +environment [ RasMol ]
    AD7  [ RasMol ]  +environment [ RasMol ]
    AD8  [ RasMol ]  +environment [ RasMol ]
    AD9  [ RasMol ]  +environment [ RasMol ]
    AE1  [ RasMol ]  +environment [ RasMol ]
    AE2  [ RasMol ]  +environment [ RasMol ]
    AE3  [ RasMol ]  +environment [ RasMol ]
    AE4  [ RasMol ]  +environment [ RasMol ]
    AE5  [ RasMol ]  +environment [ RasMol ]
    AE6  [ RasMol ]  +environment [ RasMol ]
    AE7  [ RasMol ]  +environment [ RasMol ]
    AE8  [ RasMol ]  +environment [ RasMol ]
    AE9  [ RasMol ]  +environment [ RasMol ]
    AF1  [ RasMol ]  +environment [ RasMol ]
    AF2  [ RasMol ]  +environment [ RasMol ]
    AF3  [ RasMol ]  +environment [ RasMol ]
    AF4  [ RasMol ]  +environment [ RasMol ]
    AF5  [ RasMol ]  +environment [ RasMol ]
    AF6  [ RasMol ]  +environment [ RasMol ]
    AF7  [ RasMol ]  +environment [ RasMol ]
    AF8  [ RasMol ]  +environment [ RasMol ]
    AF9  [ RasMol ]  +environment [ RasMol ]
    AG1  [ RasMol ]  +environment [ RasMol ]
    AG2  [ RasMol ]  +environment [ RasMol ]
    AG3  [ RasMol ]  +environment [ RasMol ]
    AG4  [ RasMol ]  +environment [ RasMol ]
    AG5  [ RasMol ]  +environment [ RasMol ]
    AG6  [ RasMol ]  +environment [ RasMol ]
    AG7  [ RasMol ]  +environment [ RasMol ]
    AG8  [ RasMol ]  +environment [ RasMol ]
    AG9  [ RasMol ]  +environment [ RasMol ]
    AH1  [ RasMol ]  +environment [ RasMol ]
    AH2  [ RasMol ]  +environment [ RasMol ]
    AH3  [ RasMol ]  +environment [ RasMol ]
    AH4  [ RasMol ]  +environment [ RasMol ]
    AH5  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5b2q)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5b2q
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  CAS9_FRATN | A0Q5Y3
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.1.-.-
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  CAS9_FRATN | A0Q5Y3
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        CAS9_FRATN | A0Q5Y3: 5b2o 5b2p

(-) Related Entries Specified in the PDB File

5b2o 5b2p