Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  MOBM RELAXASE DOMAIN (MOBV; MOB_PRE) BOUND TO 26NT PMV158 ORIT DNA
 
Authors :  S. Russi, D. R. Boer, M. Coll
Date :  08 Feb 17  (Deposition) - 12 Apr 17  (Release) - 12 Apr 17  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.00
Chains :  Asym./Biol. Unit :  A,B
Keywords :  Relaxase, Nuclease, Conjugation, Dna Binding Protein (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  S. Russi, D. R. Boer, M. Coll
Mobm Relaxase Domain (Mobv; Mob_pre) Bound To 26Nt Pmv158 Orit Dna
To Be Published
PubMed: search

(-) Compounds

Molecule 1 - PLASMID RECOMBINATION ENZYME
    Chains: A
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Gene: PRE, MOB
    Organism Scientific: STREPTOCOCCUS AGALACTIAE
    Organism Taxid: 1311
    Synonym: MOBILIZATION PROTEIN
 
Molecule 2 - DNA (26-MER)
    Chains: B
    Engineered: YES
    Expression System: SYNTHETIC CONSTRUCT
    Expression System Taxid: 32630
    Organism Scientific: PLASMID PMV158
    Organism Taxid: 2606

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (5, 11)

Asymmetric/Biological Unit (5, 11)
No.NameCountTypeFull Name
1CL1Ligand/IonCHLORIDE ION
2GOL1Ligand/IonGLYCEROL
3MG1Ligand/IonMAGNESIUM ION
4MSE7Mod. Amino AcidSELENOMETHIONINE
5NA1Ligand/IonSODIUM ION

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREALA A:13 , GLY A:14binding site for residue CL A 201
2AC2SOFTWAREPHE A:92 , LEU A:95 , HOH A:326binding site for residue MG A 202
3AC3SOFTWAREPHE A:192 , DG B:24binding site for residue GOL B 101
4AC4SOFTWAREGLU A:97 , GLU A:98 , DA B:1 , DC B:2 , HOH B:255binding site for residue NA B 102

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5N2Q)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5N2Q)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5N2Q)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5N2Q)

(-) Exons   (0, 0)

(no "Exon" information available for 5N2Q)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:174
                                                                                                                                                                                                              
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ...eeeeeee...hhhhhhhhh..ee........hhhhhhhhhhhhhh............eeeeeee.hhhhhhh.hhhhhhhhhhhhhhhhhhhhh...eeeeeee......eeeeee..ee..eehhhhhhhhhhhhhhhhhhhhhhhhh................hhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 5n2q A   2 SYmVARmQKmKAGNLGGAFKHNENYELTDRDRSVSYEKQIKDYVNENKVSNRAIRKDAVLCDEWIITSDKDFFEKLDEEQTRTFFETAKNYFAENYGESNIAYASVHLDESTPHmHmGVVPFENGKLSSKAmFDREELKHIQEDLPRYmSDHGFELERGKLNSEAKHKTVAEFK 193
                              |   | 11        21  ||    49        59        69        79        89        99       109       119       129    | |139       149 |     159       169       179       189    
                              |   |  |           24|                                                                                        134-MSE          151-MSE          168-MSE                     
                              4-MSE  |            43                                                                                          136-MSE                                                     
                                  8-MSE                                                                                                                                                                   
                                    11-MSE                                                                                                                                                                


Chain B from PDB  Type:DNA  Length:26
                                                          
                 5n2q B   1 ACTTTATGAAAATAAAGTATAGTGTG  26
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5N2Q)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5N2Q)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5N2Q)

(-) Gene Ontology  (3, 3)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    GOL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MSE  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    NA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5n2q)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5n2q
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  PRE_STRAG | P13925
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  PRE_STRAG | P13925
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        PRE_STRAG | P13925: 4lvi 4lvj 4lvk 4lvl 4lvm

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5N2Q)