Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  GLUTAMINYL-TRNA SYNTHETASE COMPLEXED TO GLUTAMINE AND 2'DEOXY A76 GLUTAMINE TRNA
 
Authors :  I. Gruic-Sovulj, N. Uter, T. Bullock, J. J. Perona
Date :  01 May 05  (Deposition) - 07 Jun 05  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.50
Chains :  Asym./Biol. Unit :  A,B
Keywords :  Protein-Rna Complex, Ligase/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  I. Gruic-Sovulj, N. Uter, T. Bullock, J. J. Perona
Trna-Dependent Aminoacyl-Adenylate Hydrolysis By A Nonediting Class I Aminoacyl-Trna Synthetase.
J. Biol. Chem. V. 280 23978 2005
PubMed-ID: 15845536  |  Reference-DOI: 10.1074/JBC.M414260200
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - GLUTAMINYL-TRNA
    Chains: B
    Engineered: YES
    Other Details: IN VITRO TRANSCRIBED RNA
    Synthetic: YES
 
Molecule 2 - GLUTAMINYL-TRNA SYNTHETASE
    Chains: A
    EC Number: 6.1.1.18
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PSJW1
    Expression System Strain: BL21(DE3) PLYSS
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: GLNS
    Organism Scientific: ESCHERICHIA COLI
    Organism Taxid: 562
    Synonym: GLUTAMINE--TRNA LIGASE, GLNRS

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 4)

Asymmetric/Biological Unit (3, 4)
No.NameCountTypeFull Name
1AMP1Ligand/IonADENOSINE MONOPHOSPHATE
2GLN1Mod. Amino AcidGLUTAMINE
3SO42Ligand/IonSULFATE ION

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREHIS A:40 , HIS A:43 , ARG A:260 , MET A:268 , LYS A:270 , AMP A:998BINDING SITE FOR RESIDUE SO4 A 1394
2AC2SOFTWAREVAL A:267 , MET A:268 , SER A:269 , LYS A:272 , GLY A:482 , HOH A:1472BINDING SITE FOR RESIDUE SO4 A 1395
3AC3SOFTWAREPRO A:33 , GLU A:34 , GLY A:42 , HIS A:43 , SER A:46 , THR A:230 , ARG A:260 , LEU A:261 , LYS A:270 , GLN A:996 , SO4 A:1394 , HOH A:1447 , HOH A:1477BINDING SITE FOR RESIDUE AMP A 998
4AC4SOFTWAREPRO A:32 , TYR A:211 , HIS A:215 , CYS A:229 , PHE A:233 , AMP A:998 , HOH A:1396 , HOH A:1476 , HOH A:1477 , A B:976BINDING SITE FOR RESIDUE GLN A 996

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1ZJW)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1ZJW)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1ZJW)

(-) PROSITE Motifs  (1, 1)

Asymmetric/Biological Unit (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYQ_ECOLI34-45  1A:33-44

(-) Exons   (0, 0)

(no "Exon" information available for 1ZJW)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:530
 aligned with SYQ_ECOLI | P00962 from UniProtKB/Swiss-Prot  Length:554

    Alignment length:542
                                    18        28        38        48        58        68        78        88        98       108       118       128       138       148       158       168       178       188       198       208       218       228       238       248       258       268       278       288       298       308       318       328       338       348       358       368       378       388       398       408       418       428       438       448       458       468       478       488       498       508       518       528       538       548  
            SYQ_ECOLI     9 TNFIRQIIDEDLASGKHTTVHTRFPPEPNGYLHIGHAKSICLNFGIAQDYKGQCNLRFDDTNPVKEDIEYVESIKNDVEWLGFHWSGNVRYSSDYFDQLHAYAIELINKGLAYVDELTPEQIREYRGTLTQPGKNSPYRDRSVEENLALFEKMRAGGFEEGKACLRAKIDMASPFIVMRDPVLYRIKFAEHHQTGNKWCIYPMYDFTHCISDALEGITHSLCTLEFQDNRRLYDWVLDNITIPVHPRQYEFSRLNLEYTVMSKRKLNLLVTDKHVEGWDDPRMPTISGLRRRGYTAASIREFCKRIGVTKQDNTIEMASLESCIREDLNENAPRAMAVIDPVKLVIENYQGEGEMVTMPNHPNKPEMGSRQVPFSGEIWIDRADFREEANKQYKRLVLGKEVRLRNAYVIKAERVEKDAEGNITTIFCTYDADTLSKDPADGRKVKGVIHWVSAAHALPVEIRLYDRLFSVPNPGAADDFLSVINPESLVIKQGFAEPSLKDAVAGKAFQFEREGYFCLDSRHSTAEKPVFNRTVGLRDTWA 550
               SCOP domains d1zjwa2 A:8-338 Glutaminyl-tRNA synthetase (GlnRS)                                                                                                                                                                                                                                                                                         d1zjwa1 A:339-547 Gln-tRNA synthetase (GlnRS), C-terminal (anticodon-binding) domain                                                                                                                              - SCOP domains
               CATH domains -------------------1zjwA01 A:27-99,A:210-259                                                1zjwA02 A:100-208 Glutamyl-tRNA Synthetase; Domain 3                                                         -1zjwA01 A:27-99,A:210-259                         1zjwA03 A:260-338 Glutamyl-trna Synthetase; Domain 2                           1zjwA04 1zjwA05 A:347-464 Ribosomal Protein L25; Chain P                                                                      1zjwA04 A:339-346,A:465-546 Ribosomal Protein L25; Chain P                        - - CATH domains
               Pfam domains ------------------tRNA-synt_1c-1zjwA01 A:26-337                                                                                                                                                                                                                                                                                           -tRNA-synt_1c_C-1zjwA02 A:339-527                                                                                                                                                             -------------------- - Pfam domains
         Sec.struct. author .hhhhhhhhhhhhh......eeee........hhhhhhhhhhhhhhhhhh..eeeeee...hhhhhhhhhhhhhhhhhhhhh.......ee...hhhhhhhhhhhhhhh..eeee..hhhhhhhhhh..............hhhhhhhhhhhhhhh.......eeee.......hhhhh..eeeee.............eeehhhhhhhhhhhhhh..eeeee.hhhhhhhhhhhhhhhh......eeeee..........hhhhhhhhhhh............hhhhhhhhh.hhhhhhhhhhhhh........hhhhhhhhhhhhhhhhh.ee.ee..eeeeee.......eeeeee....hhhh.eeeeee..eeeee...ee.........ee...eeee....eeeeee..........eeeeee.....-----------.ee..ee.hhheeeeeeee.......hhhhh.hhhhhh....eeeeeeee.hhhhhh....eeee...eeee...........eeeeeee....-. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------AA_TRNA_LIGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1zjw A   8 TNFIRQIIDEDLASGKHTTVHTRFPPEPNGYLHIGHAKSICLNFGIAQDYKGQCNLRFDDTNPVKEDIEYVESIKNDVEWLGFHWSGNVRYSSDYFDQLHAYAIELINKGLAYVDELTPEQIREYRGTLTQPGKNSPYRDRSVEENLALFEKMRAGGFEEGKACLRAKIDMASPFIVMRDPVLYRIKFAEHHQTGNKWCIYPMYDFTHCISDALEGITHSLCTLEFQDNRRLYDWVLDNITIPVHPRQYEFSRLNLEYTVMSKRKLNLLVTDKHVEGWDDPRMPTISGLRRRGYTAASIREFCKRIGVTKQDNTIEMASLESCIREDLNENAPRAMAVIDPVKLVIENYQGEGEMVTMPNHPNKPEMGSRQVPFSGEIWIDRADFREEANKQYKRLVLGKEVRLRNAYVIKAERVEKDAEGNITTIFCTYDADTL-----------GVIHWVSAAHALPVEIRLYDRLFSVPNPGAADDFLSVINPESLVIKQGFAEPSLKDAVAGKAFQFEREGYFCLDSRHSTAEKPVFNRTVGLRDT-Q 996
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257       267       277       287       297       307       317       327       337       347       357       367       377       387       397       407       417       427       437    |    -      |457       467       477       487       497       507       517       527       537       547 |
                                                                                                                                                                                                                                                                                                                                                                                                                                                                            442         454                                                                                          547 |
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       996


Chain B from PDB  Type:DNA/RNA  Length:74
                                                                                                          
                 1zjw B 902 GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA 976
                                   911    || 922       932       942       952       962       972    
                                        916|                                                          
                                         918
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 2)

Asymmetric/Biological Unit
(-)
Class: All beta proteins (24004)
(-)
Class: Alpha and beta proteins (a/b) (23833)

(-) CATH Domains  (4, 5)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)
(-)
Class: Mainly Alpha (13335)
(-)
Class: Mainly Beta (13760)

(-) Pfam Domains  (2, 2)

Asymmetric/Biological Unit
(-)
Clan: HUP (230)
(-)
Clan: no clan defined [family: tRNA-synt_1c_C] (10)

(-) Gene Ontology  (14, 14)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (SYQ_ECOLI | P00962)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0004819    glutamine-tRNA ligase activity    Catalysis of the reaction: ATP + L-glutamine + tRNA(Gln) = AMP + diphosphate + L-glutaminyl-tRNA(Gln).
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0016876    ligase activity, forming aminoacyl-tRNA and related compounds    Catalysis of the joining of an amino acid and a nucleic acid (usually tRNA) or poly(ribitol phosphate), with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate. The reaction forms an aminoacyl-tRNA or a related compound.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
biological process
    GO:0006425    glutaminyl-tRNA aminoacylation    The process of coupling glutamine to glutaminyl-tRNA, catalyzed by glutaminyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'- adenosine residue of the tRNA.
    GO:0006424    glutamyl-tRNA aminoacylation    The process of coupling glutamate to glutamyl-tRNA, catalyzed by glutamyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'- adenosine residue of the tRNA.
    GO:0043039    tRNA aminoacylation    The chemical reactions and pathways by which the various amino acids become bonded to their corresponding tRNAs. The most common route for synthesis of aminoacyl tRNA is by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, usually catalyzed by the cognate aminoacyl-tRNA ligase. A given aminoacyl-tRNA ligase aminoacylates all species of an isoaccepting group of tRNA molecules.
    GO:0006418    tRNA aminoacylation for protein translation    The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    AMP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    GLN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    SO4  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1zjw)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1zjw
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  SYQ_ECOLI | P00962
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  6.1.1.18
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  SYQ_ECOLI | P00962
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        SYQ_ECOLI | P00962: 1euq 1euy 1exd 1gsg 1gtr 1gts 1nyl 1o0b 1o0c 1qrs 1qrt 1qru 1qtq 2rd2 2re8 4jxx 4jxz 4jyz

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1ZJW)