Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS VALYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(VAL) AND VALYL-ADENYLATE ANALOGUE
 
Authors :  S. Fukai, O. Nureki, S. -I. Sekine, A. Shimada, D. G. Vassylyev, S. Yokoyama, Riken Structural Genomics/Proteomics Initiative (Rsgi)
Date :  29 Mar 02  (Deposition) - 11 Feb 03  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.90
Chains :  Asym. Unit :  A,B,C,D
Biol. Unit 1:  A,C  (1x)
Biol. Unit 2:  B,D  (1x)
Keywords :  Rossmann Fold, Helix Bundle, Coiled Coil, Beta Barrel, Riken Structural Genomics/Proteomics Initiative, Rsgi, Structural Genomics, Ligase/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  S. Fukai, O. Nureki, S. -I. Sekine, A. Shimada, D. G. Vassylyev, S. Yokoyama
Mechanism Of Molecular Interactions For Trna(Val) Recognition By Valyl-Trna Synthetase
Rna V. 9 100 2003
PubMed-ID: 12554880  |  Reference-DOI: 10.1261/RNA.2760703
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - TRNA (VAL)
    Chains: C, D
    Engineered: YES
    Other Details: TRNA (VAL) WITH THE CAC ANTICODON
    Synthetic: YES
 
Molecule 2 - VALYL-TRNA SYNTHETASE
    Chains: A, B
    EC Number: 6.1.1.9
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PK7
    Expression System Strain: JM109(DE3)
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: VALS
    Organism Scientific: THERMUS THERMOPHILUS
    Organism Taxid: 274
    Synonym: VALINE-TRNA LIGASE, VALRS

 Structural Features

(-) Chains, Units

  1234
Asymmetric Unit : ABCD
Biological Unit 1 (1x): A C 
Biological Unit 2 (1x):  B D

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 2)

Asymmetric Unit (1, 2)
No.NameCountTypeFull Name
1VAA2Ligand/IonN-[VALINYL]-N'-[ADENOSYL]-DIAMINOSUFONE
Biological Unit 1 (1, 1)
No.NameCountTypeFull Name
1VAA1Ligand/IonN-[VALINYL]-N'-[ADENOSYL]-DIAMINOSUFONE
Biological Unit 2 (1, 1)
No.NameCountTypeFull Name
1VAA1Ligand/IonN-[VALINYL]-N'-[ADENOSYL]-DIAMINOSUFONE

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREPRO A:41 , PRO A:42 , ASN A:44 , HIS A:50 , HIS A:53 , ASP A:56 , ASP A:81 , SER A:459 , THR A:487 , GLY A:488 , ASP A:490 , ILE A:491 , TRP A:495 , HIS A:518 , GLY A:519 , LEU A:520 , VAL A:521 , MET A:529BINDING SITE FOR RESIDUE VAA A 990
2AC2SOFTWAREPRO B:41 , PRO B:42 , ASN B:44 , HIS B:50 , GLY B:52 , HIS B:53 , ASP B:56 , ASP B:81 , TRP B:456 , SER B:459 , THR B:487 , GLY B:488 , ASP B:490 , ILE B:491 , TRP B:495 , HIS B:518 , GLY B:519 , LEU B:520 , VAL B:521 , MET B:529BINDING SITE FOR RESIDUE VAA B 991

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1IVS)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1IVS)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1IVS)

(-) PROSITE Motifs  (1, 2)

Asymmetric Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYV_THETH43-54
 		  2A:43-54
B:43-54
Biological Unit 1 (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYV_THETH43-54
 		  1A:43-54
-
Biological Unit 2 (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYV_THETH43-54
 		  1-
B:43-54

(-) Exons   (0, 0)

(no "Exon" information available for 1IVS)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:862
 aligned with SYV_THETH | P96142 from UniProtKB/Swiss-Prot  Length:862

    Alignment length:862
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790       800       810       820       830       840       850       860  
            SYV_THETH     1 MDLPKAYDPKSVEPKWAEKWAKNPFVANPKSGKPPFVIFMPPPNVTGSLHMGHALDNSLQDALIRYKRMRGFEAVWLPGTDHAGIATQVVVERLLLKEGKTRHDLGREKFLERVWQWKEESGGTILKQLKRLGASADWSREAFTMDEKRSRAVRYAFSRYYHEGLAYRAPRLVNWCPRCETTLSDLEVETEPTPGKLYTLRYEVEGGGFIEIATVRPETVFADQAIAVHPEDERYRHLLGKRARIPLTEVWIPILADPAVEKDFGTGALKVTPAHDPLDYEIGERHGLKPVSVINLEGRMEGERVPEALRGLDRFEARRKAVELFREAGHLVKEEDYTIALATCSRCGTPIEYAIFPQWWLRMRPLAEEVLKGLRRGDIAFVPERWKKVNMDWLENVKDWNISRQLWWGHQIPAWYCEDCQAVNVPRPERYLEDPTSCEACGSPRLKRDEDVFDTWFSSALWPLSTLGWPEETEDLKAFYPGDVLVTGYDILFLWVSRMEVSGYHFMGERPFKTVLLHGLVLDEKGQKMSKSKGNVIDPLEMVERYGADALRFALIYLATGGQDIRLDLRWLEMARNFANKLYNAARFVLLSREGFQAKEDTPTLADRFMRSRLSRGVEEITALYEALDLAQAAREVYELVWSEFCDWYLEAAKPALKAGNAHTLRTLEEVLAVLLKLLHPMMPFLTSELYQALTGKEELALEAWPEPGGRDEEAERAFEALKQAVTAVRALKAEAGLPPAQEVRVYLEGETAPVEENLEVFRFLSRADLLPERPAKALVKAMPRVTARMPLEGLLDVEEWRRRQEKRLKELLALAERSQRKLASPGFREKAPKEVVEAEEARLKENLEQAERIREALSQIG 862
               SCOP domains d1ivsa4 A:1-189,A:343-578 Valyl-tRNA synthetase (ValRS)                                                                                                                                      d1ivsa3 A:190-342 Valyl-tRNA synthetase (ValRS)                                                                                                          d1ivsa4 A:1-189,A:343-578 Valyl-tRNA synthetase (ValRS)                                                                                                                                                                                     d1ivsa2 A:579-796 Valyl-tRNA synthetase (ValRS)                                                                                                                                                                           d1ivsa1 A:797-862 Valyl-tRNA synthetase (ValRS) C-terminal domain  SCOP domains
               CATH domains 1ivsA02               1ivsA01 A:23-174,A:344-529 Tyrosyl-Transfer RNA Synthetase , subunit E, domain 1                                                                        ---------------1ivsA03 A:190-342 Isoleucyl-tRNA Synthetase; Domain 2                                                                                                    -1ivsA01 A:23-174,A:344-529 Tyrosyl-Transfer RNA Synthetase , subunit E, domain 1                                                                                                          -----1ivsA02 A:1-22,A:535-739 Isoleucyl-tRNA Synthetase; Domain 1                                                                                                                                                 1ivsA04 A:740-789                                 1ivsA05 A:790-862  [code=1.10.287.380, no name defined]                   CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .......hhhhhhhhhhhhhhh............eeeee..........hhhhhhhhhhhhhhhhhhhh...eeeee.ee...hhhhhhhhhhhhhh...hhhhh..hhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhee..hhhhhhhhhhhhhhhhh...eeee..eeeee....ee.hhh.eee..eeeeeeeee.........eeee..hhhhh...eeee.........................eee...........eeeehhhhhhhhhhhhh.........ee...ee.................hhhhhhhhhh...eeeeeeeee..eee.......eeee..eeeehhhhhhhhhhhhhhhh..ee...hhhhhhhhhhhh...ee.ee..........eee.....ee..hhhhh..............eee...eehhhhhhh.............hhhhhh.....eeee.hhh..hhhhhhhhhhhhh......eeeee..ee...............hhhhhhhhhhhhhhhhhhhhhh.....ee.hhhhhhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhh...hhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhh..hhhhh........hhhhhhhhhhhhhhhhhhhhhhhhhh.......eeeeee.hhhhhhhhhhhhhhhh.ee........eeee...eeeee......hhhhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------AA_TRNA_LIGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1ivs A   1 MDLPKAYDPKSVEPKWAEKWAKNPFVANPKSGKPPFVIFMPPPNVTGSLHMGHALDNSLQDALIRYKRMRGFEAVWLPGTDHAGIATQVVVERLLLKEGKTRHDLGREKFLERVWQWKEESGGTILKQLKRLGASADWSREAFTMDEKRSRAVRYAFSRYYHEGLAYRAPRLVNWCPRCETTLSDLEVETEPTPGKLYTLRYEVEGGGFIEIATVRPETVFADQAIAVHPEDERYRHLLGKRARIPLTEVWIPILADPAVEKDFGTGALKVTPAHDPLDYEIGERHGLKPVSVINLEGRMEGERVPEALRGLDRFEARRKAVELFREAGHLVKEEDYTIALATCSRCGTPIEYAIFPQWWLRMRPLAEEVLKGLRRGDIAFVPERWKKVNMDWLENVKDWNISRQLWWGHQIPAWYCEDCQAVNVPRPERYLEDPTSCEACGSPRLKRDEDVFDTWFSSALWPLSTLGWPEETEDLKAFYPGDVLVTGYDILFLWVSRMEVSGYHFMGERPFKTVLLHGLVLDEKGQKMSKSKGNVIDPLEMVERYGADALRFALIYLATGGQDIRLDLRWLEMARNFANKLYNAARFVLLSREGFQAKEDTPTLADRFMRSRLSRGVEEITALYEALDLAQAAREVYELVWSEFCDWYLEAAKPALKAGNAHTLRTLEEVLAVLLKLLHPMMPFLTSELYQALTGKEELALEAWPEPGGRDEEAERAFEALKQAVTAVRALKAEAGLPPAQEVRVYLEGETAPVEENLEVFRFLSRADLLPERPAKALVKAMPRVTARMPLEGLLDVEEWRRRQEKRLKELLALAERSQRKLASPGFREKAPKEVVEAEEARLKENLEQAERIREALSQIG 862
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790       800       810       820       830       840       850       860  


Chain B from PDB  Type:PROTEIN  Length:862
 aligned with SYV_THETH | P96142 from UniProtKB/Swiss-Prot  Length:862

    Alignment length:862
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790       800       810       820       830       840       850       860  
            SYV_THETH     1 MDLPKAYDPKSVEPKWAEKWAKNPFVANPKSGKPPFVIFMPPPNVTGSLHMGHALDNSLQDALIRYKRMRGFEAVWLPGTDHAGIATQVVVERLLLKEGKTRHDLGREKFLERVWQWKEESGGTILKQLKRLGASADWSREAFTMDEKRSRAVRYAFSRYYHEGLAYRAPRLVNWCPRCETTLSDLEVETEPTPGKLYTLRYEVEGGGFIEIATVRPETVFADQAIAVHPEDERYRHLLGKRARIPLTEVWIPILADPAVEKDFGTGALKVTPAHDPLDYEIGERHGLKPVSVINLEGRMEGERVPEALRGLDRFEARRKAVELFREAGHLVKEEDYTIALATCSRCGTPIEYAIFPQWWLRMRPLAEEVLKGLRRGDIAFVPERWKKVNMDWLENVKDWNISRQLWWGHQIPAWYCEDCQAVNVPRPERYLEDPTSCEACGSPRLKRDEDVFDTWFSSALWPLSTLGWPEETEDLKAFYPGDVLVTGYDILFLWVSRMEVSGYHFMGERPFKTVLLHGLVLDEKGQKMSKSKGNVIDPLEMVERYGADALRFALIYLATGGQDIRLDLRWLEMARNFANKLYNAARFVLLSREGFQAKEDTPTLADRFMRSRLSRGVEEITALYEALDLAQAAREVYELVWSEFCDWYLEAAKPALKAGNAHTLRTLEEVLAVLLKLLHPMMPFLTSELYQALTGKEELALEAWPEPGGRDEEAERAFEALKQAVTAVRALKAEAGLPPAQEVRVYLEGETAPVEENLEVFRFLSRADLLPERPAKALVKAMPRVTARMPLEGLLDVEEWRRRQEKRLKELLALAERSQRKLASPGFREKAPKEVVEAEEARLKENLEQAERIREALSQIG 862
               SCOP domains d1ivsb4 B:1-189,B:343-578 Valyl-tRNA synthetase (ValRS)                                                                                                                                      d1ivsb3 B:190-342 Valyl-tRNA synthetase (ValRS)                                                                                                          d1ivsb4 B:1-189,B:343-578 Valyl-tRNA synthetase (ValRS)                                                                                                                                                                                     d1ivsb2 B:579-796 Valyl-tRNA synthetase (ValRS)                                                                                                                                                                           d1ivsb1 B:797-862 Valyl-tRNA synthetase (ValRS) C-terminal domain  SCOP domains
               CATH domains 1ivsB02               1ivsB01 B:23-174,B:344-529 Tyrosyl-Transfer RNA Synthetase , subunit E, domain 1                                                                        ---------------1ivsB03 B:190-342 Isoleucyl-tRNA Synthetase; Domain 2                                                                                                    -1ivsB01 B:23-174,B:344-529 Tyrosyl-Transfer RNA Synthetase , subunit E, domain 1                                                                                                          -----1ivsB02 B:1-22,B:535-739 Isoleucyl-tRNA Synthetase; Domain 1                                                                                                                                                 1ivsB04 B:740-789                                 1ivsB05 B:790-862  [code=1.10.287.380, no name defined]                   CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .......hhhhhhhhhhhhhhhh...........eeeee..........hhhhhhhhhhhhhhhhhhhhh..eeeee.ee...hhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhee..hhhhhhhhhhhhhhhhh...eeee..eeeee....eeehhh.eee..eee..eeee.........eeee.hhhhh.....eee...hhhhh.................eee...........eee.....hhhhhhhhh................................hhhhhhhhhhh...eeee..eee..eee.......eeee..eeeehhhhhhhhhhhhhhhh..ee...hhhhhhhhhh.....ee.............eee.....ee..hhhhh..............eee.....hhhhhhh...hhhhh.....hhhhhh..eeeeeee.hhh..hhhhhhhhhhhh.....eeeeeee..ee...............hhhhhhhhhhhhhhhhhhhhhh.....ee..hhhhhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhh.....hhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhh..hhhhh........hhhhhhhhhhhhhhhhhhhhhhhhhh......eeeeeee.hhhhhhhhhhhhhhhheeee......eeeee...eeeeee.....hhhhhhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------AA_TRNA_LIGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1ivs B   1 MDLPKAYDPKSVEPKWAEKWAKNPFVANPKSGKPPFVIFMPPPNVTGSLHMGHALDNSLQDALIRYKRMRGFEAVWLPGTDHAGIATQVVVERLLLKEGKTRHDLGREKFLERVWQWKEESGGTILKQLKRLGASADWSREAFTMDEKRSRAVRYAFSRYYHEGLAYRAPRLVNWCPRCETTLSDLEVETEPTPGKLYTLRYEVEGGGFIEIATVRPETVFADQAIAVHPEDERYRHLLGKRARIPLTEVWIPILADPAVEKDFGTGALKVTPAHDPLDYEIGERHGLKPVSVINLEGRMEGERVPEALRGLDRFEARRKAVELFREAGHLVKEEDYTIALATCSRCGTPIEYAIFPQWWLRMRPLAEEVLKGLRRGDIAFVPERWKKVNMDWLENVKDWNISRQLWWGHQIPAWYCEDCQAVNVPRPERYLEDPTSCEACGSPRLKRDEDVFDTWFSSALWPLSTLGWPEETEDLKAFYPGDVLVTGYDILFLWVSRMEVSGYHFMGERPFKTVLLHGLVLDEKGQKMSKSKGNVIDPLEMVERYGADALRFALIYLATGGQDIRLDLRWLEMARNFANKLYNAARFVLLSREGFQAKEDTPTLADRFMRSRLSRGVEEITALYEALDLAQAAREVYELVWSEFCDWYLEAAKPALKAGNAHTLRTLEEVLAVLLKLLHPMMPFLTSELYQALTGKEELALEAWPEPGGRDEEAERAFEALKQAVTAVRALKAEAGLPPAQEVRVYLEGETAPVEENLEVFRFLSRADLLPERPAKALVKAMPRVTARMPLEGLLDVEEWRRRQEKRLKELLALAERSQRKLASPGFREKAPKEVVEAEEARLKENLEQAERIREALSQIG 862
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790       800       810       820       830       840       850       860  


Chain C from PDB  Type:RNA  Length:75
                                                                                                           
                 1ivs C 901 GGGCGGCUAGCUCAGCGGAAGAGCGCUCGCCUCACACGCGAGAGGUCGUAGGUUCAAGUCCUACGCCGCCCACCA 975
                                   910       920       930       940       950       960       970     


Chain D from PDB  Type:RNA  Length:75
                                                                                                           
                 1ivs D 901 GGGCGGCUAGCUCAGCGGAAGAGCGCUCGCCUCACACGCGAGAGGUCGUAGGUUCAAGUCCUACGCCGCCCACCA 975
                                   910       920       930       940       950       960       970
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (4, 8)

Asymmetric Unit
(-)
Class: All alpha proteins (14657)
(-)
Class: All beta proteins (24004)
(-)
Class: Alpha and beta proteins (a/b) (23833)

(-) CATH Domains  (5, 10)

Asymmetric Unit
(-)
Class: Alpha Beta (26913)
(-)
Class: Mainly Alpha (13335)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1IVS)

(-) Gene Ontology  (12, 12)

Asymmetric Unit(hide GO term definitions)
Chain A,B   (SYV_THETH | P96142)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0002161    aminoacyl-tRNA editing activity    The hydrolysis of an incorrectly aminoacylated tRNA.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0004832    valine-tRNA ligase activity    Catalysis of the reaction: L-valine + ATP + tRNA(Val) = L-valyl-tRNA(Val) + AMP + diphosphate + 2 H(+).
biological process
    GO:0006450    regulation of translational fidelity    Any process that modulates the ability of the translational apparatus to interpret the genetic code.
    GO:0006418    tRNA aminoacylation for protein translation    The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
    GO:0006438    valyl-tRNA aminoacylation    The process of coupling valine to valyl-tRNA, catalyzed by valyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    VAA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1ivs)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1ivs
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  SYV_THETH | P96142
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  6.1.1.9
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  SYV_THETH | P96142
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        SYV_THETH | P96142: 1gax 1iyw 1wk9 1wka

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1IVS)