Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  INSIGHTS INTO EDITING FROM AN ILE-TRNA SYNTHETASE STRUCTURE WITH TRNA(ILE) AND MUPIROCIN
 
Authors :  L. F. Silvian, J. Wang, T. A. Steitz
Date :  06 Jul 99  (Deposition) - 31 Aug 99  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.90
Chains :  Asym./Biol. Unit :  A,T
Keywords :  Shuttling Mechanism, Editing Trna Synthetase, Double-Sieve, Metal Ions, Hydrolytic Function, Ligase/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  L. F. Silvian, J. Wang, T. A. Steitz
Insights Into Editing From An Ile-Trna Synthetase Structure With Trnaile And Mupirocin.
Science V. 285 1074 1999
PubMed-ID: 10446055  |  Reference-DOI: 10.1126/SCIENCE.285.5430.1074
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - ISOLEUCYL-TRNA
    ChainsT
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism ScientificSTAPHYLOCOCCUS AUREUS
    Organism Taxid1280
 
Molecule 2 - ISOLEUCYL-TRNA SYNTHETASE
    ChainsA
    EC Number6.1.1.5
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism ScientificSTAPHYLOCOCCUS AUREUS
    Organism Taxid1280
    SynonymISOLEUCINE-TRNA LIGASE, ILERS

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit AT

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 2)

Asymmetric/Biological Unit (2, 2)
No.NameCountTypeFull Name
1MRC1Ligand/IonMUPIROCIN
2ZN1Ligand/IonZINC ION

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREASP A:13 , HIS A:201 , HIS A:770BINDING SITE FOR RESIDUE ZN A 992
2AC2SOFTWAREPRO A:56 , HIS A:64 , GLY A:66 , HIS A:67 , GLU A:554 , ASP A:557 , GLN A:558 , TRP A:562 , HIS A:585 , GLY A:586 , PHE A:587 , VAL A:588 , LYS A:595 , MET A:596 , SER A:597 , LYS A:598 , VAL A:603 , HOH A:1021BINDING SITE FOR RESIDUE MRC A 993

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1QU3)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1QU3)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1QU3)

(-) PROSITE Motifs  (1, 1)

Asymmetric/Biological Unit (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYI1_STAAU57-68  1A:57-68

(-) Exons   (0, 0)

(no "Exon" information available for 1QU3)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:880
 aligned with SYI1_STAAU | P41972 from UniProtKB/Swiss-Prot  Length:917

    Alignment length:880
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881
          SYI1_STAAU      2 DYKETLLMPKTDFPMRGGLPNKEPQIQEKWDAEDQYHKALEKNKGNETFILHDGPPYANGNLHMGHALNKILKDFIVRYKTMQGFYAPYVPGWDTHGLPIEQALTKKGVDRKKMSTAEFREKCKEFALEQIELQKKDFRRLGVRGDFNDPYITLKPEYEAAQIRIFGEMADKGLIYKGKKPVYWSPSSESSLAEAEIEYHDKRSASIYVAFNVKDDKGVVDADAKFIIWTTTPWTIPSNVAITVHPELKYGQYNVNGEKYIIAEALSDAVAEALDWDKASIKLEKEYTGKELEYVVAQHPFLDRESLVINGDHVTTDAGTGCVHTAPGHGEDDYIVGQKYELPVISPIDDKGVFTEEGGQFEGMFYDKANKAVTDLLTEKGALLKLDFITHSYPHDWRTKKPVIFRATPQWFASISKVRQDILDAIENTNFKVNWGKTRIYNMVRDRGEWVISRQRVWGVPLPVFYAENGEIIMTKETVNHVADLFAEHGSNIWFEREAKDLLPEGFTHPGSPNGTFTKETDIMDVWFDSGSSHRGVLETRPELSFPADMYLEGSDQYRGWFNSSITTSVATRGVSPYKFLLSHGFVMDGEGKKMSKSLGNVIVPDQVVKQKGADIARLWVSSTDYLADVRISDEILKQTSDVYRKIRNTLRFMLGNINDFNPDTDSIPESELLEVDRYLLNRLREFTASTINNYENFDYLNIYQEVQNFINVELSNFYLDYGKDILYIEQRDSHIRRSMQTVLYQILVDMTKLLAPILVHTAEEVWSHTPHVKEESVHLADMPKVVEVDQALLDKWRTFMNLRDDVNRALETARNEKVIGKSLEAKVTIASNDKFNASEFLTSFDALHQLFIVSQVKVVDKLDDQATAYEHGDIVIEHA  881
               SCOP domains d1qu3a3 A:2-200,A:395-644 Isoleucyl-tRNA synthetase (IleRS)                                                                                                                                            d1qu3a2 A:201-394 Isoleucyl-tRNA synthetase (IleRS)                                                                                                                                               d1qu3a3 A:2-200,A:395-644 Isoleucyl-tRNA synthetase (IleRS)                                                                                                                                                                                               d1qu3a1 A:645-881 Isoleucyl-tRNA synthetase (IleRS)                                                                                                                                                                                           SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1qu3A02 A:202-393 Isoleucyl-tRNA Synthetase; Domain 2                                                                                                                                           ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1qu3A04 A:634-783 Isoleucyl-tRNA Synthetase; Domain 1                                                                                                 -------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------tRNA-synt_1-1qu3A01 A:26-634                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------------------------------------------Anticodon_1-1qu3A02 A:678-831                                                                                                                             -------------------------------------------------- Pfam domains
         Sec.struct. author .................hhhhhhhhhhhhhhhhhhhhhhhhhhh..................hhhhhhhhhhhhhhhhhhhhh........ee....hhhhhhhhh.........hhhhhh..hhhhhhhhhhhhhhhhhh.........ee..hhhhhhhhhhhhhhhhh.....eeeeeeee........hhh.eee.......ee...ee..hhhhh........ee....hhhhh.eeee.....................hhhhhhhhh.............hhhhhh...ee.hhhh..eeeeee..................hhhhhhhhhh...................hhhhhh..hhhhhhhhhhhh...............eee.......eeeeeeeeeehhhhhhhhhhhhhhh.ee..hhhhhhhhhhhh....ee.............ee..........hhhhhhhhhhhhhh.hhhhhh.hhhhh..............ee......hhhhhhhhhhhh..........eeeeeee.hhh...hhhhhhhhhhhhh...eeeeeee..ee................hhhhhhhhhhhhhhhhhh.......ee.hhhhhhhhhhhhhhhhhhhhhhhhh...........hhhhhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh...hhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhh.......hhhhh........hhhhhhhhhhhhhhhhhhhhhhhhhhhh........eeeeee.....hhhhhh....hhhhhh...eeee.........ee..eeeeeee. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------AA_TRNA_LIGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                1qu3 A    2 DYEKTLLMPKTDFPMRGGLPNKEPQIQEKWDAEDQYHKALEKNKGNETFILHDGPPYANGNLHMGHALNKILKDFIVRYKTMQGFYAPYVPGWDTHGLPIEQALTKKGVDRKKMSTAEFREKCKEFALEQIELQKKDFRRLGVRGDFNDPYITLKPEYEAAQIRIFGEMADKGLIYKGKKPVYWSPSSESSLAEAEIEYHDKRSASIYVAFNVKDDKGVVDADAKFIIWTTTPWTIPSNVAITVHPELKYGQYNVNGEKYIIAEALSDAVAEALDWDKASIKLEKEYTGKELEWVVAQHPFLDRESLVINGDHVTTDAGTGCVHTAPGHGEDDYIVGQQYELPVISPIDDKGVFTEEGGQFEGMFYDKANKAVTDLLTEKGALLKLDFITHSYPHDWRTKKPVIFRATPQWFASISKVRQDILDAIENTNFKVNWGKTRIYNMVRDRGEWVISRQRVWGVPLPVFYAENGEIIMTKETVNHVADLFAEHGSNIWFEREAKDLLPEGFTHPGSPNGTFTKETDIMDVWFDSGSSHRGVLETRPELSFPADMYLEGSDQYRGWFNSSITTSVATRGVSPYKFLLSHGFVMDGEGKKMSKSLGNVIVPDQVVKQKGADIARLWVSSTDYLADVRISDEILKQTSDDYRKIRNTLRFMLGNINDFNPDTDSIPESELLEVDRYLLNRLREFTASTINNYENFDYLNIYQEVQNFINVELSNFYLDYGKDILYIEQRDSHIRRSMQTVLYQILVDMTKLLAPILVHTAEEVWSHTPHVKEESVHLADMPKVVEVDQALLDKWRTFMNLRDDVNRALETARNEKVIGKSLEAKVTIASNDKFNASEFLTSFDALHQLFIVSQVKVVDKLDDQATAYEHGDIVIEHA  881
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881

Chain T from PDB  Type:RNA  Length:75
                                                                                                            
                1qu3 T    1 GGGCUUGUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGGUGGUUCAAGUCCACUCAGGCCCAC   74
                                    10        20||      29        39        49        59        69     
                                              20||                                                     
                                             121A|                                                     
                                                21                                                     

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (3, 3)

Asymmetric/Biological Unit

(-) CATH Domains  (2, 2)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)

(-) Pfam Domains  (2, 2)

Asymmetric/Biological Unit
(-)
Clan: HUP (230)

(-) Gene Ontology  (13, 13)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (SYI1_STAAU | P41972)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0002161    aminoacyl-tRNA editing activity    The hydrolysis of an incorrectly aminoacylated tRNA.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0004822    isoleucine-tRNA ligase activity    Catalysis of the reaction: L-isoleucine + ATP + tRNA(Ile) = L-isoleucyl-tRNA(Ile) + AMP + diphosphate + 2 H(+).
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0008270    zinc ion binding    Interacting selectively and non-covalently with zinc (Zn) ions.
biological process
    GO:0006428    isoleucyl-tRNA aminoacylation    The process of coupling isoleucine to isoleucyl-tRNA, catalyzed by isoleucyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA.
    GO:0006450    regulation of translational fidelity    Any process that modulates the ability of the translational apparatus to interpret the genetic code.
    GO:0006418    tRNA aminoacylation for protein translation    The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    MRC  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ZN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1qu3)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1qu3
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  SYI1_STAAU | P41972
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  6.1.1.5
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  SYI1_STAAU | P41972
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        SYI1_STAAU | P419721ffy 1qu2

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1QU3)