Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRE RECOMBINASE-DNA TRANSITION STATE
 
Authors :  B. P. Gibb, K. Gupta, K. Ghosh, R. Sharp, J. Chen, G. D. Van Duyne
Date :  07 Apr 10  (Deposition) - 26 May 10  (Release) - 06 Oct 10  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.29
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F,G,H,I,K,L,M
Keywords :  Cre-Loxp, Transition State, Isomerase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  B. Gibb, K. Gupta, K. Ghosh, R. Sharp, J. Chen, G. D. Van Duyne
Requirements For Catalysis In The Cre Recombinase Active Site.
Nucleic Acids Res. V. 38 5817 2010
PubMed-ID: 20462863  |  Reference-DOI: 10.1093/NAR/GKQ384

(-) Compounds

Molecule 1 - RECOMBINASE CRE
    Chains: A, B, C, D
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PET21A
    Expression System Strain: BL21(DE3)
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Gene: CRE
    Organism Common: BACTERIOPHAGE P1
    Organism Scientific: ENTEROBACTERIA PHAGE P1
    Organism Taxid: 10678
 
Molecule 2 - DNA (5'-D(*TP*AP*TP*AP*AP*CP*TP*TP*CP*GP*TP*AP*TP*AP*G)- 3')
    Chains: E, G, I, L
    Engineered: YES
    Fragment: UPSTREAM CLEAVED STRAND
    Synthetic: YES
 
Molecule 3 - DNA (5'- D(*CP*AP*TP*AP*TP*GP*CP*TP*AP*TP*AP*CP*GP*AP*AP*GP*TP*TP*AP*T)-3')
    Chains: F, H, K, M
    Engineered: YES
    Fragment: DOWNSTREAM CLEAVED STRAND
    Synthetic: YES

 Structural Features

(-) Chains, Units

  123456789101112
Asymmetric/Biological Unit : ABCDEFGHIKLM

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 2)

Asymmetric/Biological Unit (1, 2)
No.NameCountTypeFull Name
1VO42Ligand/IonVANADATE ION

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREARG B:173 , LYS B:201 , HIS B:289 , ARG B:292 , TRP B:315 , TYR B:324 , HOH B:347 , DG E:15 , DC F:1BINDING SITE FOR RESIDUE VO4 B 690
2AC2SOFTWAREARG D:173 , HIS D:289 , ARG D:292 , TRP D:315 , TYR D:324 , HOH D:351 , DG I:15 , DC K:1BINDING SITE FOR RESIDUE VO4 D 690

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3MGV)

(-) Cis Peptide Bonds  (4, 4)

Asymmetric/Biological Unit
No.Residues
1Phe A:64 -Pro A:65
2Phe B:64 -Pro B:65
3Phe C:64 -Pro C:65
4Phe D:64 -Pro D:65

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3MGV)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 3MGV)

(-) Exons   (0, 0)

(no "Exon" information available for 3MGV)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d3mgva1 A:20-129 Cre recombinase                                                                              d3mgva2 A:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.eee.....eeee.............eee.hhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhh..hhhhhhhhhh..hhhhhhhhhh.hhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3mgv A  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  


Chain B from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d3mgvb1 B:20-129 Cre recombinase                                                                              d3mgvb2 B:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.eee.....eeeeeeee..eeeeeeeeee.hhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhhh.hhhhhhhhhh..hhhhhhhhhh......hhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3mgv B  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  


Chain C from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d3mgvc1 C:20-129 Cre recombinase                                                                              d3mgvc2 C:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.eee.....eeee.............eee.hhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhh..hhhhhhhhhh..hhhhhhhhhh.hhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3mgv C  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  


Chain D from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d3mgvd1 D:20-129 Cre recombinase                                                                              d3mgvd2 D:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
           Pfam domains (1) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-3mgvD01 D:138-331                                                                                                                                                                 ---------- Pfam domains (1)
           Pfam domains (2) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-3mgvD02 D:138-331                                                                                                                                                                 ---------- Pfam domains (2)
           Pfam domains (3) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-3mgvD03 D:138-331                                                                                                                                                                 ---------- Pfam domains (3)
           Pfam domains (4) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-3mgvD04 D:138-331                                                                                                                                                                 ---------- Pfam domains (4)
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhh.hhh.eee.....eeeeeee....eeeeeeeee.hhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhh..hhhhhhhhhh..hhhhhhhhhh......hhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3mgv D  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  


Chain E from PDB  Type:DNA  Length:15
                                               
                 3mgv E   1 TATAACTTCGTATAG  15
                                    10     


Chain F from PDB  Type:DNA  Length:20
                                                    
                 3mgv F   1 CATATGCTATACGAAGTTAT  20
                                    10        20


Chain G from PDB  Type:DNA  Length:15
                                               
                 3mgv G   1 TATAACTTCGTATAG  15
                                    10     


Chain H from PDB  Type:DNA  Length:20
                                                    
                 3mgv H   1 CATATGCTATACGAAGTTAT  20
                                    10        20


Chain I from PDB  Type:DNA  Length:15
                                               
                 3mgv I   1 TATAACTTCGTATAG  15
                                    10     


Chain K from PDB  Type:DNA  Length:20
                                                    
                 3mgv K   1 CATATGCTATACGAAGTTAT  20
                                    10        20


Chain L from PDB  Type:DNA  Length:15
                                               
                 3mgv L   1 TATAACTTCGTATAG  15
                                    10     


Chain M from PDB  Type:DNA  Length:20
                                                    
                 3mgv M   1 CATATGCTATACGAAGTTAT  20
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 8)

Asymmetric/Biological Unit
(-)
Class: All alpha proteins (14657)
(-)
Class: Alpha and beta proteins (a+b) (23004)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 3MGV)

(-) Pfam Domains  (1, 4)

Asymmetric/Biological Unit
(-)
Clan: DNA-mend (28)

(-) Gene Ontology  (3, 3)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B,C,D   (RECR_BPP1 | P06956)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
biological process
    GO:0015074    DNA integration    The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Intrachromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    VO4  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Phe A:64 - Pro A:65   [ RasMol ]  
    Phe B:64 - Pro B:65   [ RasMol ]  
    Phe C:64 - Pro C:65   [ RasMol ]  
    Phe D:64 - Pro D:65   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  3mgv
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  RECR_BPP1 | P06956
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  RECR_BPP1 | P06956
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        RECR_BPP1 | P06956: 1crx 1drg 1f44 1kbu 1ma7 1nzb 1ouq 1pvp 1pvq 1pvr 1q3u 1q3v 1xns 1xo0 2crx 2hof 2hoi 3c28 3c29 3crx 4crx 5crx

(-) Related Entries Specified in the PDB File

1crx 2hof 2hoi 4crx