2DU5 - JenaLib

Biol.Unit 1 - manually (Jmol Viewer)

Asym.Unit - manually (Jmol Viewer)

Asymmetric Unit (Jmol Viewer)

Asym. Unit - sites (Jmol Viewer)

Biological Unit 1 (Jmol Viewer)

Biol. Unit 1 - sites (Jmol Viewer)

Title :   CRYSTAL STRUCTURE OF ARCHAEOGLOBUS FULGIDUS O-PHOSPHOSERYL-TRNA SYNTHETASE E418N/E420N MUTANT COMPLEXED WITH TRNAOPAL AND O-PHOSPHOSERINE ("OPAL COMPLEX")

Authors :   R. Fukunaga

Date :   20 Jul 06 (Deposition) - 13 Mar 07 (Release) - 09 Jun 09 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   3.20

Chains :   Asym. Unit : A,B,D
Biol. Unit 1: A,B,D  (2x)

Keywords :   Alpha4 Tetramer, Ligase/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   R. Fukunaga, S. Yokoyama
Structural Insights Into The First Step Of Rna-Dependent Cysteine Biosynthesis In Archaea.
Nat. Struct. Mol. Biol. V. 14 272 2007
PubMed-ID: 17351629 | Reference-DOI: 10.1038/NSMB1219
(for further references see the PDB file header)

Molecule 1 - TRNA
	Chains	:	D
	Engineered	:	YES
	Mutation	:	YES
	Synthetic	:	YES

Molecule 2 - O-PHOSPHOSERYL-TRNA SYNTHETASE
	Chains	:	A, B
	EC Number	:	6.1.1.-
	Engineered	:	YES
	Expression System	:	ESCHERICHIA COLI
	Expression System Plasmid	:	PET26B
	Expression System Taxid	:	562
	Expression System Vector Type	:	PLASMID
	Mutation	:	YES
	Organism Scientific	:	ARCHAEOGLOBUS FULGIDUS
	Organism Taxid	:	2234

		1	2	3
Asymmetric Unit	:	A	B	D
Biological Unit 1 (2x)	:	A	B	D

Summary Information (see also Sequences/Alignments below)

Asymmetric Unit (1, 2)

No.	Name	Count	Type	Full Name
1	SEP	2	Mod. Residue	PHOSPHOSERINE

Biological Unit 1 (1, 4)

No.	Name	Count	Type	Full Name
1	SEP	4	Mod. Residue	PHOSPHOSERINE

Asymmetric Unit (2, 2)

No.	Name	Evidence	Residues	Description
1	AC1	SOFTWARE	HIS A:186 , MET A:187 , THR A:188 , SER A:231 , SER A:233 , TYR A:273 , TYR A:274 , ASN A:325 , GLY A:327	BINDING SITE FOR RESIDUE SEP A 1001
2	AC2	SOFTWARE	HIS B:186 , MET B:187 , THR B:188 , SER B:231 , SER B:233 , TYR B:273 , TYR B:274 , THR B:305 , ASN B:325 , GLY B:327	BINDING SITE FOR RESIDUE SEP A 1002

(no "SS Bond" information available for 2DU5)

Asymmetric Unit

No.	Residues
1	Tyr A:36	-	Pro A:37
2	Leu A:204	-	Pro A:205
3	Ser A:396	-	Pro A:397
4	Tyr B:36	-	Pro B:37
5	Leu B:204	-	Pro B:205
6	Ser B:396	-	Pro B:397

(no "SAP(SNP)/Variant" information available for 2DU5)

(no "PROSITE Motif" information available for 2DU5)

(no "Exon" information available for 2DU5)

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:PROTEIN  Length:534
 aligned with SEPS_ARCFU | O30126 from UniProtKB/Swiss-Prot  Length:534

    Alignment length:534
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530    
           SEPS_ARCFU     1 MKFDPQKYRELAEKDFEAAWKAGKEILAERSPNELYPRVGFSFGKEHPLFATIQRLREAYLSIGFSEVVNPLIVEDVHVKKQFGREALAVLDRCFYLATLPKPNVGISAEKIRQIEAITKREVDSKPLQEIFHRYKKGEIDGDDLSYLIAEVLDVDDITAVKILDEVFPEFKELKPISSTLTLRSHMTTGWFITLSHIADKLPLPIKLFSIDRCFRREQGEDATRLYTYFSASCVLVDEELSVDDGKAVAEALLRQFGFENFRFRKDEKRSKYYIPDTQTEVFAFHPKLVGSSTKYSDGWIEIATFGIYSPTALAEYDIPYPVMNLGLGVERLAMILYGYDDVRKMVYPQIHGEIKLSDLDIAREIKVKEVPQTAVGLKIAQSIVETAEKHASEPSPCSFLAFEGEMMGRNVRVYVVEEEENTKLCGPAYANEVVVYKGDIYGIPKTKKWRSFFEEGVPTGIRYIDGFAYYAARKVEEAAMREQEEVKVKARIVENLSDINLYIHENVRRYILWKKGKIDVRGPLFVTVKAEIE 534
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ...hhhhhhhhhh.hhhhhhhhhhhhh...hhhhh...........hhhhhhhhhhhhhhhhh..ee.....eeehhhhhhhh..hhhhhhh..eeee.......hhhhh......................hhhhhh......................hhhhhh.hhhhhhh......eee..hhhhhhhhhhhh........eeeeeeeeee............eeeeeeeeee....hhhhhhhhhhhhhh.....eeeeee.............eeeeee.hhhh.........eeeeeeeee.hhhhhhh......eeeeeeehhhhhhhhhh..hhhhhhh.........hhhhhhhheee.....hhhhhhhhhhhhhhhhhh.......eeeeeeee....eeeeeee...............eeeee..eeeee.....hhhhh...eeeeeehhhhhhhhhhhhhhhhhhhh..eeeeeeeee..hhhh.eeehhhhhhhhhhh...ee..eeeeeeeeeee. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 2du5 A   1 MKFDPQKYRELAEKDFEAAWKAGKEILAERSPNELYPRVGFSFGKEHPLFATIQRLREAYLSIGFSEVVNPLIVEDVHVKKQFGREALAVLDRCFYLATLPKPNVGISAEKIRQIEAITKREVDSKPLQEIFHRYKKGEIDGDDLSYLIAEVLDVDDITAVKILDEVFPEFKELKPISSTLTLRSHMTTGWFITLSHIADKLPLPIKLFSIDRCFRREQGEDATRLYTYFSASCVLVDEELSVDDGKAVAEALLRQFGFENFRFRKDEKRSKYYIPDTQTEVFAFHPKLVGSSTKYSDGWIEIATFGIYSPTALAEYDIPYPVMNLGLGVERLAMILYGYDDVRKMVYPQIHGEIKLSDLDIAREIKVKEVPQTAVGLKIAQSIVETAEKHASEPSPCSFLAFEGEMMGRNVRVYVVNENENTKLCGPAYANEVVVYKGDIYGIPKTKKWRSFFEEGVPTGIRYIDGFAYYAARKVEEAAMREQEEVKVKARIVENLSDINLYIHENVRRYILWKKGKIDVRGPLFVTVKAEIE 534
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530

Chain B from PDB  Type:PROTEIN  Length:465
 aligned with SEPS_ARCFU | O30126 from UniProtKB/Swiss-Prot  Length:534

    Alignment length:534
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530    
           SEPS_ARCFU     1 MKFDPQKYRELAEKDFEAAWKAGKEILAERSPNELYPRVGFSFGKEHPLFATIQRLREAYLSIGFSEVVNPLIVEDVHVKKQFGREALAVLDRCFYLATLPKPNVGISAEKIRQIEAITKREVDSKPLQEIFHRYKKGEIDGDDLSYLIAEVLDVDDITAVKILDEVFPEFKELKPISSTLTLRSHMTTGWFITLSHIADKLPLPIKLFSIDRCFRREQGEDATRLYTYFSASCVLVDEELSVDDGKAVAEALLRQFGFENFRFRKDEKRSKYYIPDTQTEVFAFHPKLVGSSTKYSDGWIEIATFGIYSPTALAEYDIPYPVMNLGLGVERLAMILYGYDDVRKMVYPQIHGEIKLSDLDIAREIKVKEVPQTAVGLKIAQSIVETAEKHASEPSPCSFLAFEGEMMGRNVRVYVVEEEENTKLCGPAYANEVVVYKGDIYGIPKTKKWRSFFEEGVPTGIRYIDGFAYYAARKVEEAAMREQEEVKVKARIVENLSDINLYIHENVRRYILWKKGKIDVRGPLFVTVKAEIE 534
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ...hhhhhhhhhhhhhhhhhhhhhhh....hhhhh...........hhhhhhhhhhhhhhhh...ee.....eeehhhhhhhh..hhhhhhhhh.eee......---------------------------------------------------------------------.......eee...hhhhhhhhhhh........eeeeeeeeee............eeeeeeeeee....hhhhhhhhhhhhhhh....eeeeee.............eeeeee........hhhhh.eeeeeeeee.hhhhhhhh......eeeeeehhhhhhhhhh..hhhhhhh.........hhhhhhhh.ee.....hhhhhhhhhhhhhhhhhh.......eeeeeeeee..eeeeeeee...............eeeee..eeeee.....hhhhhh..eeeeeehhhhhhhhhhhhhhhhhh.....eeeeeeee..hhhh.ee.hhhhhhhhhhh...ee..eeeeeeeeeee. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 2du5 B   1 MKFDPQKYRELAEKDFEAAWKAGKEILAERSPNELYPRVGFSFGKEHPLFATIQRLREAYLSIGFSEVVNPLIVEDVHVKKQFGREALAVLDRCFYLATLPKPN---------------------------------------------------------------------LKPISSTLTLRSHMTTGWFITLSHIADKLPLPIKLFSIDRCFRREQGEDATRLYTYFSASCVLVDEELSVDDGKAVAEALLRQFGFENFRFRKDEKRSKYYIPDTQTEVFAFHPKLVGSSTKYSDGWIEIATFGIYSPTALAEYDIPYPVMNLGLGVERLAMILYGYDDVRKMVYPQIHGEIKLSDLDIAREIKVKEVPQTAVGLKIAQSIVETAEKHASEPSPCSFLAFEGEMMGRNVRVYVVNENENTKLCGPAYANEVVVYKGDIYGIPKTKKWRSFFEEGVPTGIRYIDGFAYYAARKVEEAAMREQEEVKVKARIVENLSDINLYIHENVRRYILWKKGKIDVRGPLFVTVKAEIE 534
                                    10        20        30        40        50        60        70        80        90       100   |     -         -         -         -         -         -         -   |   180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530    
                                                                                                                                 104                                                                   174

Chain D from PDB  Type:RNA  Length:71
                                                                                                       
                 2du5 D 901 GCCAGGGUGGCAGAGGGGCUUUGCGGCGGACUUCAGAUCCGCUUUACCCCGGUUCGAAUCCGGGCCCUGGC 971
                                   910       920       930       940       950       960       970

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

(no "SCOP Domain" information available for 2DU5)

(no "CATH Domain" information available for 2DU5)

(no "Pfam Domain" information available for 2DU5)

Asymmetric Unit(hide GO term definitions)

Chain A,B (SEPS_ARCFU | O30126)

molecular function
	GO:0005524	ATP binding	Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
	GO:0004812	aminoacyl-tRNA ligase activity	Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
	GO:0016874	ligase activity	Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
	GO:0000166	nucleotide binding	Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
	GO:0000049	tRNA binding	Interacting selectively and non-covalently with transfer RNA.
biological process
	GO:0043039	tRNA aminoacylation	The chemical reactions and pathways by which the various amino acids become bonded to their corresponding tRNAs. The most common route for synthesis of aminoacyl tRNA is by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, usually catalyzed by the cognate aminoacyl-tRNA ligase. A given aminoacyl-tRNA ligase aminoacylates all species of an isoaccepting group of tRNA molecules.
	GO:0006418	tRNA aminoacylation for protein translation	The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis.
	GO:0006412	translation	The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		SEP	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
		Leu A:204 - Pro A:205	[ RasMol ]
		Leu B:204 - Pro B:205	[ RasMol ]
		Ser A:396 - Pro A:397	[ RasMol ]
		Ser B:396 - Pro B:397	[ RasMol ]
		Tyr A:36 - Pro A:37	[ RasMol ]
		Tyr B:36 - Pro B:37	[ RasMol ]

Biological Unit
	Complete Structure
		Biological Unit 1	[ Jena3D ]

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym. Unit PNG format \| Asym. Unit - sites PNG format \| Biol. Unit 1 PNG format \| Biol. Unit 1 - sites PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Access by PDB/NDB ID
	2du5
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	SEPS_ARCFU \| O30126
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	6.1.1.-
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	SEPS_ARCFU \| O30126
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)

UniProtKB/Swiss-Prot
	SEPS_ARCFU \| O30126	:	2du3 2du4 2du6

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (1, 2)

Sites (2, 2)

SS Bonds (0, 0)

Cis Peptide Bonds (6, 6)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (9, 9)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File