Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN HUMAN FMRP RGG MOTIF AND G-QUADRUPLEX RNA, CESIUM BOUND FORM.
 
Authors :  N. Vasilyev, A. Polonskaia, J. C. Darnell, R. B. Darnell, D. J. Patel, A.
Date :  25 Aug 15  (Deposition) - 23 Sep 15  (Release) - 14 Oct 15  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.80
Chains :  Asym. Unit :  A,B,C,D
Biol. Unit 1:  A,B  (1x)
Biol. Unit 2:  C,D  (1x)
Keywords :  Fragile X Syndrome, Rna Structure, Rgg Box, Fmrp, G-Quadruplex, Rna Binding Protein-Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  N. Vasilyev, A. Polonskaia, J. C. Darnell, R. B. Darnell, D. J. Patel, A. Serganov
Crystal Structure Reveals Specific Recognition Of A G-Quadruplex Rna By A Beta-Turn In The Rgg Motif Of Fmrp.
Proc. Natl. Acad. Sci. Usa V. 112 E5391 2015
PubMed-ID: 26374839  |  Reference-DOI: 10.1073/PNAS.1515737112

(-) Compounds

Molecule 1 - SC1
    Chains: A, C
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 2 - FRAGILE X MENTAL RETARDATION PROTEIN 1
    Chains: B, D
    Engineered: YES
    Mutation: YES
    Organism Common: HUMAN
    Organism Scientific: HOMO SAPIENS
    Organism Taxid: 9606
    Synonym: PROTEIN FMR-1
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric Unit : ABCD
Biological Unit 1 (1x): AB  
Biological Unit 2 (1x):   CD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 7)

Asymmetric Unit (2, 7)
No.NameCountTypeFull Name
1CS3Ligand/IonCESIUM ION
2K4Ligand/IonPOTASSIUM ION
Biological Unit 1 (0, 0)
No.NameCountTypeFull Name
1CS-1Ligand/IonCESIUM ION
2K-1Ligand/IonPOTASSIUM ION
Biological Unit 2 (0, 0)
No.NameCountTypeFull Name
1CS-1Ligand/IonCESIUM ION
2K-1Ligand/IonPOTASSIUM ION

(-) Sites  (6, 6)

Asymmetric Unit (6, 6)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREG A:11 , G A:12 , G A:15 , G A:16 , G A:20 , G A:21 , G A:24 , G A:25 , K A:102binding site for residue K A 101
2AC2SOFTWAREG A:6 , G A:9 , G A:12 , G A:16 , G A:18 , G A:21 , G A:25 , G A:26 , K A:101binding site for residue K A 102
3AC3SOFTWAREG A:6 , U A:8 , G A:9 , A A:17 , G A:18 , G A:26 , G A:29binding site for residue CS A 103
4AC4SOFTWAREG C:6 , G C:9 , G C:12 , G C:16 , G C:18 , G C:21 , G C:25 , G C:26 , K C:102binding site for residue K C 101
5AC5SOFTWAREG C:11 , G C:12 , G C:15 , G C:16 , G C:20 , G C:21 , G C:24 , G C:25 , K C:101binding site for residue K C 102
6AC6SOFTWAREG C:6 , U C:8 , G C:9 , A C:17 , G C:18 , G C:26 , G C:29 , HOH C:202binding site for residue CS C 103

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5DEA)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5DEA)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5DEA)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5DEA)

(-) Exons   (0, 0)

(no "Exon" information available for 5DEA)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:RNA  Length:35
                                                                  
                  5dea A  1 GCUGCGGUGUGGAAGGAGUGGCUGGGUUGCGCAGC 35
                                    10        20        30     


Chain B from PDB  Type:PROTEIN  Length:14
                                             
               SCOP domains -------------- SCOP domains
               CATH domains -------------- CATH domains
               Pfam domains -------------- Pfam domains
         Sec.struct. author .............. Sec.struct. author
                 SAPs(SNPs) -------------- SAPs(SNPs)
                    PROSITE -------------- PROSITE
                 Transcript -------------- Transcript
                  5dea B  5 GDGRRRGGGGRGQG 18
                                    14    


Chain C from PDB  Type:RNA  Length:35
                                                                  
                  5dea C  1 GCUGCGGUGUGGAAGGAGUGGCUGGGUUGCGCAGC 35
                                    10        20        30     


Chain D from PDB  Type:PROTEIN  Length:14
                                             
               SCOP domains -------------- SCOP domains
               CATH domains -------------- CATH domains
               Pfam domains -------------- Pfam domains
         Sec.struct. author .............. Sec.struct. author
                 SAPs(SNPs) -------------- SAPs(SNPs)
                    PROSITE -------------- PROSITE
                 Transcript -------------- Transcript
                  5dea D  5 GDGRRRGGGGRGQG 18
                                    14
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5DEA)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5DEA)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5DEA)

(-) Gene Ontology  (91, 91)

Asymmetric Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CS  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5dea)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5dea
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  FMR1_HUMAN | Q06787
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  FMR1_HUMAN | Q06787
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        FMR1_HUMAN | Q06787: 2bkd 2fmr 2la5 2qnd 4ova 4qvz 4qw2 5de5 5de8 5uwj 5uwo

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5DEA)