Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Authors :  T. H. Tahirov, K. Ogata
Date :  29 Jan 01  (Deposition) - 28 Jan 02  (Release) - 06 Mar 13  (Revision)
Resolution :  2.80
Chains :  Asym./Biol. Unit :  A,B,C,D,E
Keywords :  Transcription-Dna Complex, Transcription Regulation, Bzip, Proto-Oncogene, Myb, C-Myb, C/Ebp (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  T. H. Tahirov, K. Sato, E. Ichikawa-Iwata, M. Sasaki, T. Inoue-Bungo, M. Shiina, K. Kimura, S. Takata, A. Fujikawa, H. Morii, T. Kumasaka, M. Yamamoto, S. Ishii, K. Ogata
Mechanism Of C-Myb-C/Ebpbeta Cooperation From Separated Sites On A Promoter
Cell(Cambridge, Mass. ) V. 108 57 2002
PubMed-ID: 11792321  |  Reference-DOI: 10.1016/S0092-8674(01)00636-5
(for further references see the PDB file header)

(-) Compounds

    ChainsA, B
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPAR2156
    Expression System StrainBL21(DE3)
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    FragmentRESIDUES 259-336
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    Other DetailsBZIP DOMAIN
    SynonymC/EBP BETA, NFIL-6
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPAR2156
    Expression System StrainBL21(DE3)
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    FragmentRESIDUES 35-193
    Organism CommonHOUSE MOUSE
    Organism ScientificMUS MUSCULUS
    Organism Taxid10090

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCDE

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 1)

Asymmetric/Biological Unit (1, 1)
No.NameCountTypeFull Name

(-) Sites  (1, 1)

Asymmetric Unit (1, 1)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1H88)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1H88)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1H88)

(-) PROSITE Motifs  (2, 4)

Asymmetric/Biological Unit (2, 4)
1HTH_MYBPS51294 Myb-type HTH DNA-binding domain profile.MYB_MOUSE87-142
2BZIPPS50217 Basic-leucine zipper (bZIP) domain profile.CEBPB_HUMAN271-334

(-) Exons   (1, 2)

Asymmetric/Biological Unit (1, 2)
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:70
 aligned with CEBPB_HUMAN | P17676 from UniProtKB/Swiss-Prot  Length:345

    Alignment length:70
                                   276       286       296       306       316       326       336
               SCOP domains d1h88a_ A: C/ebp beta                                                  SCOP domains
               CATH domains 1h88A00 A:267-336  [code=, no name defined]                  CATH domains
               Pfam domains ---------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----BZIP  PDB: A:271-334 UniProt: 271-334                           -- PROSITE
               Transcript 1 Exon 1.1  PDB: A:267-336 UniProt: 1-410 [INCOMPLETE]                   Transcript 1
                                   276       286       296       306       316       326       336

Chain B from PDB  Type:PROTEIN  Length:71
 aligned with CEBPB_HUMAN | P17676 from UniProtKB/Swiss-Prot  Length:345

    Alignment length:71
                                   275       285       295       305       315       325       335 
               SCOP domains d1h88b_ B: C/ebp beta                                                   SCOP domains
               CATH domains 1h88B00 B:266-336  [code=, no name defined]                   CATH domains
               Pfam domains ----------------------------------------------------------------------- Pfam domains
         Sec.struct. author .....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -----BZIP  PDB: B:271-334 UniProt: 271-334                           -- PROSITE
               Transcript 1 Exon 1.1  PDB: B:266-336 UniProt: 1-410 [INCOMPLETE]                    Transcript 1
                                   275       285       295       305       315       325       335 

Chain C from PDB  Type:PROTEIN  Length:152
 aligned with MYB_MOUSE | P06876 from UniProtKB/Swiss-Prot  Length:636

    Alignment length:152
                                    48        58        68        78        88        98       108       118       128       138       148       158       168       178       188  
               SCOP domains d1h88c1 C:39-88 c-Myb, DNA-binding domain         d1h88c2 C:89-143 c-Myb, DNA-binding domain             d1h88c3 C:144-190 c-Myb, DNA-binding domain     SCOP domains
               CATH domains 1h88C01 C:39-88 Homeodomain-like                  1h88C02 C:89-144 Homeodomain-like                       1h88C03 C:145-190 Homeodomain-like             CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .....hhhhhhhhhhhhhhhh..hhhhhhhhh...hhhhhhhhhhh...........hhhhhhhhhhhhhhhh..hhhhhhh.....hhhhhhhhhhhh..........hhhhhhhhhhhhhhhh.hhhhhhhhh...hhhhhhhhhhhh.. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE HTH_MYB  PDB: - UniProt: 35-86                  HTH_MYB  PDB: C:87-142 UniProt: 87-142                  HTH_MYB  PDB: C:143-190 UniProt: 143-193         PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    48        58        68        78        88        98       108       118       128       138       148       158       168       178       188  

Chain D from PDB  Type:DNA  Length:26
                 1h88 D   1 GATGTGGCGCAATCCTTAACGGACTG  26
                                    10        20      

Chain E from PDB  Type:DNA  Length:26
                 1h88 E   1 CCAGTCCGTTAAGGATTGCGCCACAT  26
                                    10        20      

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 5)

Asymmetric/Biological Unit

(-) CATH Domains  (2, 5)

Asymmetric/Biological Unit

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1H88)

(-) Gene Ontology  (84, 97)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (CEBPB_HUMAN | P17676)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0000978    RNA polymerase II core promoter proximal region sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
    GO:0000977    RNA polymerase II regulatory region sequence-specific DNA binding    Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls the transcription of a gene or cistron by RNA polymerase II.
    GO:0003682    chromatin binding    Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase.
    GO:0035259    glucocorticoid receptor binding    Interacting selectively and non-covalently with a glucocorticoid receptor.
    GO:0035035    histone acetyltransferase binding    Interacting selectively and non-covalently with the enzyme histone acetyltransferase.
    GO:0042826    histone deacetylase binding    Interacting selectively and non-covalently with the enzyme histone deacetylase.
    GO:0019900    kinase binding    Interacting selectively and non-covalently with a kinase, any enzyme that catalyzes the transfer of a phosphate group.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0046982    protein heterodimerization activity    Interacting selectively and non-covalently with a nonidentical protein to form a heterodimer.
    GO:0042803    protein homodimerization activity    Interacting selectively and non-covalently with an identical protein to form a homodimer.
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003705    transcription factor activity, RNA polymerase II distal enhancer sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in a distal enhancer region for RNA polymerase II (RNAP II) in order to modulate transcription by RNAP II.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0008134    transcription factor binding    Interacting selectively and non-covalently with a transcription factor, any protein required to initiate or regulate transcription.
    GO:0044212    transcription regulatory region DNA binding    Interacting selectively and non-covalently with a DNA region that regulates the transcription of a region of DNA, which may be a gene, cistron, or operon. Binding may occur as a sequence specific interaction or as an interaction observed only once a factor has been recruited to the DNA by other factors.
    GO:0001077    transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to activate or increase the frequency, rate or extent of transcription from the RNAP II promoter.
    GO:0044389    ubiquitin-like protein ligase binding    Interacting selectively and non-covalently with a ubiquitin-like protein ligase, such as ubiquitin-ligase.
biological process
    GO:0035711    T-helper 1 cell activation    The change in morphology and behavior of a T-helper 1 cell resulting from exposure to a mitogen, cytokine, chemokine, cellular ligand, or an antigen for which it is specific.
    GO:0006953    acute-phase response    An acute inflammatory response that involves non-antibody proteins whose concentrations in the plasma increase in response to infection or injury of homeothermic animals.
    GO:0050873    brown fat cell differentiation    The process in which a relatively unspecialized cell acquires specialized features of a brown adipocyte, an animal connective tissue cell involved in adaptive thermogenesis. Brown adipocytes contain multiple small droplets of triglycerides and a high number of mitochondria.
    GO:0030154    cell differentiation    The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state.
    GO:0071230    cellular response to amino acid stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an amino acid stimulus. An amino acid is a carboxylic acids containing one or more amino groups.
    GO:0071347    cellular response to interleukin-1    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an interleukin-1 stimulus.
    GO:0071222    cellular response to lipopolysaccharide    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a lipopolysaccharide stimulus; lipopolysaccharide is a major component of the cell wall of gram-negative bacteria.
    GO:0071407    cellular response to organic cyclic compound    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic cyclic compound stimulus.
    GO:0042742    defense response to bacterium    Reactions triggered in response to the presence of a bacterium that act to protect the cell or organism.
    GO:0001892    embryonic placenta development    The embryonically driven process whose specific outcome is the progression of the placenta over time, from its formation to the mature structure. The placenta is an organ of metabolic interchange between fetus and mother, partly of embryonic origin and partly of maternal origin.
    GO:0045444    fat cell differentiation    The process in which a relatively unspecialized cell acquires specialized features of an adipocyte, an animal connective tissue cell specialized for the synthesis and storage of fat.
    GO:0002432    granuloma formation    The formation of nodular inflammatory lesions, usually small or granular, firm, persistent, well-structured, and containing compactly grouped T lymphocytes and modified phagocytes such as epithelioid cells, giant cells, and other macrophages. Granuloma formation represents a chronic inflammatory response initiated by various infectious and noninfectious agents. The center of a granuloma consists of fused macrophages, which can become necrotic.
    GO:0072574    hepatocyte proliferation    The multiplication or reproduction of hepatocytes, resulting in the expansion of a cell population. Hepatocytes form the main structural component of the liver. They are specialized epithelial cells that are organized into interconnected plates called lobules.
    GO:0006955    immune response    Any immune system process that functions in the calibrated response of an organism to a potential internal or invasive threat.
    GO:0006954    inflammatory response    The immediate defensive reaction (by vertebrate tissue) to infection or injury caused by chemical or physical agents. The process is characterized by local vasodilation, extravasation of plasma into intercellular spaces and accumulation of white blood cells and macrophages.
    GO:0070059    intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress    A series of molecular signals in which an intracellular signal is conveyed to trigger the apoptotic death of a cell. The pathway is induced in response to a stimulus indicating endoplasmic reticulum (ER) stress, and ends when the execution phase of apoptosis is triggered. ER stress usually results from the accumulation of unfolded or misfolded proteins in the ER lumen.
    GO:0001889    liver development    The process whose specific outcome is the progression of the liver over time, from its formation to the mature structure. The liver is an exocrine gland which secretes bile and functions in metabolism of protein and carbohydrate and fat, synthesizes substances involved in the clotting of the blood, synthesizes vitamin A, detoxifies poisonous substances, stores glycogen, and breaks down worn-out erythrocytes.
    GO:0097421    liver regeneration    The regrowth of lost or destroyed liver.
    GO:0060644    mammary gland epithelial cell differentiation    The process in which a relatively unspecialized epithelial cell becomes a more specialized epithelial cell of the mammary gland.
    GO:0033598    mammary gland epithelial cell proliferation    The multiplication or reproduction of mammary gland epithelial cells, resulting in the expansion of a cell population. Mammary gland epithelial cells make up the covering of surfaces of the mammary gland. The mammary gland is a large compound sebaceous gland that in female mammals is modified to secrete milk.
    GO:0007613    memory    The activities involved in the mental information processing system that receives (registers), modifies, stores, and retrieves informational stimuli. The main stages involved in the formation and retrieval of memory are encoding (processing of received information by acquisition), storage (building a permanent record of received information as a result of consolidation) and retrieval (calling back the stored information and use it in a suitable way to execute a given task).
    GO:0042130    negative regulation of T cell proliferation    Any process that stops, prevents or reduces the rate or extent of T cell proliferation.
    GO:0043524    negative regulation of neuron apoptotic process    Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process in neurons.
    GO:0045892    negative regulation of transcription, DNA-templated    Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0030182    neuron differentiation    The process in which a relatively unspecialized cell acquires specialized features of a neuron.
    GO:0001541    ovarian follicle development    The process whose specific outcome is the progression of the ovarian follicle over time, from its formation to the mature structure.
    GO:0045600    positive regulation of fat cell differentiation    Any process that activates or increases the frequency, rate or extent of adipocyte differentiation.
    GO:0032753    positive regulation of interleukin-4 production    Any process that activates or increases the frequency, rate, or extent of interleukin-4 production.
    GO:0045669    positive regulation of osteoblast differentiation    Any process that activates or increases the frequency, rate or extent of osteoblast differentiation.
    GO:0045944    positive regulation of transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:1990440    positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress    Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter as a result of an endoplasmic reticulum stress.
    GO:0045893    positive regulation of transcription, DNA-templated    Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0045408    regulation of interleukin-6 biosynthetic process    Any process that modulates the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of interleukin-6.
    GO:0045670    regulation of osteoclast differentiation    Any process that modulates the frequency, rate or extent of osteoclast differentiation.
    GO:0060850    regulation of transcription involved in cell fate commitment    Any process that modulates the frequency, rate or extent of transcription from an RNA polymerase II promoter that contributes to the commitment of a cell to a specific fate.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0034976    response to endoplasmic reticulum stress    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stress acting at the endoplasmic reticulum. ER stress usually results from the accumulation of unfolded or misfolded proteins in the ER lumen.
    GO:0032496    response to lipopolysaccharide    Any process that results in a change in state or activity of an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a lipopolysaccharide stimulus; lipopolysaccharide is a major component of the cell wall of gram-negative bacteria.
    GO:0006366    transcription from RNA polymerase II promoter    The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0036488    CHOP-C/EBP complex    A heterodimeric protein complex that is composed of the transcription factor CHOP (GADD153) and a member of the C/EBP family of transcription factors.
    GO:0000779    condensed chromosome, centromeric region    The region of a condensed chromosome that includes the centromere and associated proteins, including the kinetochore. In monocentric chromosomes, this region corresponds to a single area of the chromosome, whereas in holocentric chromosomes, it is evenly distributed along the chromosome.
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0000790    nuclear chromatin    The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome in the nucleus.
    GO:0016363    nuclear matrix    The dense fibrillar network lying on the inner side of the nuclear membrane.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.

Chain C   (MYB_MOUSE | P06876)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0000978    RNA polymerase II core promoter proximal region sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
    GO:0071987    WD40-repeat domain binding    Interacting selectively and non-covalently with a WD40 repeat domain of a protein. The WD40 repeat is a short structural motif of approximately 40 amino acids, often terminating in a tryptophan-aspartic acid (W-D) dipeptide. Several of these repeats are combined to form a type of protein domain called the WD domain.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0001077    transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to activate or increase the frequency, rate or extent of transcription from the RNAP II promoter.
biological process
    GO:0030183    B cell differentiation    The process in which a precursor cell type acquires the specialized features of a B cell. A B cell is a lymphocyte of B lineage with the phenotype CD19-positive and capable of B cell mediated immunity.
    GO:0000082    G1/S transition of mitotic cell cycle    The mitotic cell cycle transition by which a cell in G1 commits to S phase. The process begins with the build up of G1 cyclin-dependent kinase (G1 CDK), resulting in the activation of transcription of G1 cyclins. The process ends with the positive feedback of the G1 cyclins on the G1 CDK which commits the cell to S phase, in which DNA replication is initiated.
    GO:0006816    calcium ion transport    The directed movement of calcium (Ca) ions into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore.
    GO:0071354    cellular response to interleukin-6    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an interleukin-6 stimulus.
    GO:0006338    chromatin remodeling    Dynamic structural changes to eukaryotic chromatin occurring throughout the cell division cycle. These changes range from the local changes necessary for transcriptional regulation to global changes necessary for chromosome segregation.
    GO:0048566    embryonic digestive tract development    The process whose specific outcome is the progression of the gut over time, from its formation to the mature structure during embryonic development. The gut is the region of the digestive tract extending from the beginning of the intestines to the anus.
    GO:0048872    homeostasis of number of cells    Any biological process involved in the maintenance of the steady-state number of cells within a population of cells.
    GO:0001701    in utero embryonic development    The process whose specific outcome is the progression of the embryo in the uterus over time, from formation of the zygote in the oviduct, to birth. An example of this process is found in Mus musculus.
    GO:0030099    myeloid cell differentiation    The process in which a relatively unspecialized myeloid precursor cell acquires the specialized features of any cell of the myeloid leukocyte, megakaryocyte, thrombocyte, or erythrocyte lineages.
    GO:0000122    negative regulation of transcription from RNA polymerase II promoter    Any process that stops, prevents, or reduces the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0045892    negative regulation of transcription, DNA-templated    Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0045624    positive regulation of T-helper cell differentiation    Any process that activates or increases the frequency, rate or extent of T-helper cell differentiation.
    GO:0051571    positive regulation of histone H3-K4 methylation    Any process that activates or increases the frequency, rate or extent of the covalent addition of a methyl group to the lysine at position 4 of histone H3.
    GO:0051574    positive regulation of histone H3-K9 methylation    Any process that activates or increases the frequency, rate or extent of the covalent addition of a methyl group to the lysine at position 9 of histone H3.
    GO:0045944    positive regulation of transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0045893    positive regulation of transcription, DNA-templated    Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0010468    regulation of gene expression    Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0048536    spleen development    The process whose specific outcome is the progression of the spleen over time, from its formation to the mature structure. The spleen is a large vascular lymphatic organ composed of white and red pulp, involved both in hemopoietic and immune system functions.
    GO:0017145    stem cell division    The self-renewing division of a stem cell. A stem cell is an undifferentiated cell, in the embryo or adult, that can undergo unlimited division and give rise to one or several different cell types.
    GO:0048538    thymus development    The process whose specific outcome is the progression of the thymus over time, from its formation to the mature structure. The thymus is a symmetric bi-lobed organ involved primarily in the differentiation of immature to mature T cells, with unique vascular, nervous, epithelial, and lymphoid cell components.
    GO:0006366    transcription from RNA polymerase II promoter    The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    NH4  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1h88)

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  CEBPB_HUMAN | P17676
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
  MYB_MOUSE | P06876
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
    Age Related InformationGenAge
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  CEBPB_HUMAN | P17676
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  MYB_MOUSE | P06876
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        CEBPB_HUMAN | P176761gtw 1gu4 1gu5 1h89 1h8a 1hjb 1io4 2e42 2e43
        MYB_MOUSE | P068761guu 1gv2 1gv5 1gvd 1h89 1idy 1idz 1mbe 1mbf 1mbg 1mbh 1mbj 1mbk 1mse 1msf 1sb0 2agh

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1H88)