Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF LAGLIDADG MEGANUCLEASE I-AABMI BOUND TO UNCLEAVED DNA
 
Authors :  J. P. Hallinan, B. L. Stoddard
Date :  02 Mar 15  (Deposition) - 23 Mar 16  (Release) - 15 Jun 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.24
Chains :  Asym. Unit :  A,B,C,D,E,F
Biol. Unit 1:  A,B,C  (1x)
Biol. Unit 2:  D,E,F  (1x)
Keywords :  Hydrolase-Dna Complex, Laglidadg, Homing Endonuclease, Meganuclease (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  A. R. Lambert, J. P. Hallinan, B. W. Shen, J. K. Chik, J. M. Bolduc, N. Kulshina, L. I. Robins, B. K. Kaiser, J. Jarjour, K. Havens, A. M. Scharenberg, B. L. Stoddard
Indirect Dna Sequence Recognition And Its Impact On Nucleas Cleavage Activity.
Structure V. 24 862 2016
PubMed-ID: 27133026  |  Reference-DOI: 10.1016/J.STR.2016.03.024

(-) Compounds

Molecule 1 - MEGANUCLEASE I-AABMI
    Chains: A, D
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Organism Scientific: GREMMENIELLA ABIETINA
    Organism Taxid: 127520
 
Molecule 2 - DNA (25-MER)
    Chains: B
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 3 - DNA (25-MER)
    Chains: C
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 4 - DNA (25MER)
    Chains: E
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 5 - DNA (25-MER)
    Chains: F
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  123456
Asymmetric Unit : ABCDEF
Biological Unit 1 (1x): ABC   
Biological Unit 2 (1x):    DEF

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 5)

Asymmetric Unit (1, 5)
No.NameCountTypeFull Name
1CA5Ligand/IonCALCIUM ION
Biological Unit 1 (0, 0)
No.NameCountTypeFull Name
1CA-1Ligand/IonCALCIUM ION
Biological Unit 2 (0, 0)
No.NameCountTypeFull Name
1CA-1Ligand/IonCALCIUM ION

(-) Sites  (5, 5)

Asymmetric Unit (5, 5)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREGLY A:12 , GLU A:169 , GLN A:196 , DA B:14 , DA C:16binding site for residue CA A 301
2AC2SOFTWAREGLU A:13 , ALA A:168 , DA B:15 , DA C:15binding site for residue CA A 302
3AC3SOFTWAREASP A:209 , ASN A:212 , ASP D:209binding site for residue CA A 303
4AC4SOFTWAREGLY D:12 , GLU D:169 , DA E:14 , DA F:16binding site for residue CA D 301
5AC5SOFTWAREGLU D:13 , ALA D:168 , DA E:15 , DA F:15binding site for residue CA D 302

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4YIT)

(-) Cis Peptide Bonds  (4, 4)

Asymmetric Unit
No.Residues
1Ser A:62 -Gly A:63
2Ile D:156 -Pro D:157
3Phe D:211 -Asn D:212
4Trp D:213 -Gly D:214

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4YIT)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4YIT)

(-) Exons   (0, 0)

(no "Exon" information available for 4YIT)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:272
                                                                                                                                                                                                                                                                                                                
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhheeeeeeee..eeeeeeeeeee..hhhhhhhhhhhhh..eee.....eeeeee.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.........................hhhhhhhhhhheeeeeeee.........eeeeeeeeeee..hhhhhhhhhhhhh..eeeee..eeeeee.hhhhhhhhhhhhhh....hhhhhhhhhhhhhhhh......hhhhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 4yit A   1 INPWFLTGFIDGEGCFRISVTKWRVQLFFQINLHEKDRALLESIKDYLKVGKIHISGKNLVQYRIQTFDELTILIKHLKEYPLVSKKRADFELFNTAHKLIKNNEHLNKEGINKLVSLKASLNLGLSSLKLAFPNVIATRLNIPDPHWLSGFASAEGCFMVGIAKSSASSTGYQVYLTFILTQHVRDENLMKCLVDYFNWGRLARKRNVYEYQVKFSDVEKLLSFFDKYPILGEKAKDLQDFCSVSDLMKSKTHLTEEGVAKIRKIKEGMNR 286
                                    10        20 ||     36        46        56        66        76        86        96       106       116       126      |137      |148||     163       173       183       193       203       213       223   ||  234       244       254       264       274       284  
                                                22|                                                                                                     133|      144|  ||                                                                     227|                                                         
                                                 29                                                                                                      135       146  ||                                                                      229                                                         
                                                                                                                                                                      149|                                                                                                                                  
                                                                                                                                                                       155                                                                                                                                  


Chain B from PDB  Type:DNA  Length:25
                                                         
                 4yit B   2 AGGTACCCTTTAAACCTACTAACCC  26
                                    11        21     


Chain C from PDB  Type:DNA  Length:25
                                                         
                 4yit C   1 GGTTAGTAGGTTTAAAGGGTACCTG  25
                                    10        20     


Chain D from PDB  Type:PROTEIN  Length:277
                                                                                                                                                                                                                                                                                                                     
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhheeeeeeee...eeeeeeeee.hhhhhhhhhhhhhhhh..eeee.....eeeee.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhh..............hhhhhhhhhhhheeeeeeee.........eeeeeeeeeee..hhhhhhhhhhh....eeee...eeeeee.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 4yit D   1 INPWFLTGFIDGEGCFRISVTKDWRVQLFFQINLHEKDRALLESIKDYLKVGKIHISGKNLVQYRIQTFDELTILIKHLKEYPLVSKKRADFELFNTAHKLIKNNEHLNKEGINKLVSLKASLNLGLSESLKLAFPNVISATRLNIPDPHWLSGFASAEGCFMVGIAKSSASSTGYQVYLTFILTQHVRDENLMKCLVDYFNWGRLARKRNVYEYQVSKFSDVEKLLSFFDKYPILGEKAKDLQDFCSVSDLMKSKTHLTEEGVAKIRKIKEGMNRG 287
                                    10        20 ||     35        45        55        65        75        85        95       105       115       125       135       145   ||  160       170       180       190       200       210       220       230       240       250       260       270       280       
                                                22|                                                                                                                      149|                                                                                                                                    
                                                 28                                                                                                                       155                                                                                                                                    


Chain E from PDB  Type:DNA  Length:24
                                                        
                 4yit E   2 AGGTACCCTTTAAACCTACTAACC  25
                                    11        21    


Chain F from PDB  Type:DNA  Length:24
                                                        
                 4yit F   2 GTTAGTAGGTTTAAAGGGTACCTG  25
                                    11        21
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4YIT)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4YIT)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4YIT)

(-) Gene Ontology  (0, 0)

Asymmetric Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 4YIT)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Ile D:156 - Pro D:157   [ RasMol ]  
    Phe D:211 - Asn D:212   [ RasMol ]  
    Ser A:62 - Gly A:63   [ RasMol ]  
    Trp D:213 - Gly D:214   [ RasMol ]  
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4yit
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  A0A158RFF2_9 | A0A158RFF2
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/TrEMBL
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  A0A158RFF2_9 | A0A158RFF2
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 4YIT)

(-) Related Entries Specified in the PDB File

4yis