Image Library
Entries with manually generated images from the JenaLib are marked in bold.
Clicking on the hetero component identifier generates an image. The structural information is taken from the first listed PDB/NDB entry. In addition, all hetero components can be visualized interactively (RasMol/Chime/VRML) on the JenaLib atlas pages.

From the Database of Hetero Components

6190 entries selected from PDBlist WHERE class LIKE 'nuc' 

   

Code	Class Resolution	Description

02I    (6S,7S,8S,10R)-4-AMINO-8-HYDROXY-7,8,9,10-TETRAHYDRO- 6H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
2lg0	nuc      NMR    	(6S,7S,8S,10R)-4-AMINO-8-HYDROXY-7,8,9,10-TETRAHYDRO- 6H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O6 P	STRUCTURE OF THE DUPLEX CONTAINING (5'S)-8,5'-CYCLO-2'-DEOXY DNA (5'-D(*GP*TP*GP*CP*(02I)P*TP*GP*TP*TP*TP*GP*T CHAIN: A, DNA (5'-D(*AP*CP*AP*AP*AP*CP*AP*TP*GP*CP*AP*C)-3' CHAIN: B DNA (5'S)-8,5'-CYCLO-2'-DEOXYADENOSINE, CYCLOPURINE, CYCLO-DA, D
2lsf	nuc      NMR    	(6S,7S,8S,10R)-4-AMINO-8-HYDROXY-7,8,9,10-TETRAHYDRO- 6H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O6 P	STRUCTURE AND STABILITY OF DUPLEX DNA CONTAINING (5'S) 5',8- DEOXYADENOSINE: AN OXIDATIVE LESION REPAIR BY NER DNA (5'-D(*CP*GP*TP*AP*CP*(02I)P*CP*AP*TP*GP*C)-3 CHAIN: B, DNA (5'-D(*GP*CP*AP*TP*GP*TP*GP*TP*AP*CP*G)-3') DNA NER, DNA

0DC    2'-DEOXY-L-RIBO-FURANOSYL CYTOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1fv7	nuc      NMR    	2'-DEOXY-L-RIBO-FURANOSYL CYTOSINE-5'-MONOPHOSPHATE 2(C9 H14 N3 O7 P)	A TWO B-Z JUNCTION CONTAINING DNA RESOLVES INTO AN ALL RIGHT DOUBLE HELIX 5'-D(*(5CM)P*GP*(5CM)P*GP*(0DC)P*(0DG)P*(5CM)P*GP P*G)-3' DNA DNA POLYMORPHISM, L ENANTIOMERY, ANTISENSE, DNA
1r4d	nuc      NMR    	2'-DEOXY-L-RIBO-FURANOSYL CYTOSINE-5'-MONOPHOSPHATE 2(C9 H14 N3 O7 P)	SOLUTION STRUCTURE OF THE CHIMERIC L/D DNA OLIGONUCLEOTIDE D(C8METGCGC(L)G(L)CGCG)2 5'-D(*CP*(8MG)P*CP*GP*(0DC)P*(0DG)P*CP*GP*CP*G)-3 CHAIN: A, B DNA DNA POLYMORPHISM, L ENANTIOMERY, ANTISENSE, HYBRID ZBZ DNA,

0DG    2'-DEOXY-L-RIBO-FURANOSYL GUANINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1fv7	nuc      NMR    	2'-DEOXY-L-RIBO-FURANOSYL GUANINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O7 P)	A TWO B-Z JUNCTION CONTAINING DNA RESOLVES INTO AN ALL RIGHT DOUBLE HELIX 5'-D(*(5CM)P*GP*(5CM)P*GP*(0DC)P*(0DG)P*(5CM)P*GP P*G)-3' DNA DNA POLYMORPHISM, L ENANTIOMERY, ANTISENSE, DNA
1r4d	nuc      NMR    	2'-DEOXY-L-RIBO-FURANOSYL GUANINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O7 P)	SOLUTION STRUCTURE OF THE CHIMERIC L/D DNA OLIGONUCLEOTIDE D(C8METGCGC(L)G(L)CGCG)2 5'-D(*CP*(8MG)P*CP*GP*(0DC)P*(0DG)P*CP*GP*CP*G)-3 CHAIN: A, B DNA DNA POLYMORPHISM, L ENANTIOMERY, ANTISENSE, HYBRID ZBZ DNA,

0DT    2'-DEOXY-L-RIBO-FURANOSYL THYMIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1fv8	nuc      NMR    	2'-DEOXY-L-RIBO-FURANOSYL THYMIDINE-5'-MONOPHOSPHATE C10 H15 N2 O8 P	NMR STUDY OF AN HETEROCHIRAL HAIRPIN 5'-D(*TP*AP*TP*CP*AP*(0DT)P*CP*GP*AP*TP*A)-3': AT(L)C HAIRPIN DNA HAIRPIN, HETEROCHIRAL LOOP, FLEXIBILTY, ANTISENSE DNA, DNA

0DX    4,9-BIS{[3-(4-METHYLPIPERAZIN-1-YL)PROPYL]AMINO}-2,7- BIS[3-(MORPHOLIN-4-YL)PROPYL]BENZO[LMN][3, 8]PHENANTHROLINE-1,3,6,8(2H,7H)-TETRONE

Code	Class Resolution	Description
3uyh	nuc      1.95	4,9-BIS{[3-(4-METHYLPIPERAZIN-1-YL)PROPYL]AMINO}-2,7- BIS[3-(MORPHOLIN-4-YL)PROPYL]BENZO[LMN][3, 8]PHENANTHROLINE-1,3,6,8(2H,7H)-TETRONE C44 H66 N10 O6	CRYSTAL STRUCTURE OF AN INTRAMOLECULAR HUMAN TELOMERIC DNA G QUADRUPLEX BOUND BY THE NAPHTHALENE DIIMIDE COMPOUND, MM41 HUMAN TELOMERIC DNA SEQUENCE DNA INTRAMOLECULAR, LIGAND-COMPLEX, G-QUADRUPLEX, TELOMERE, DNA
4da3	nuc      2.40	4,9-BIS{[3-(4-METHYLPIPERAZIN-1-YL)PROPYL]AMINO}-2,7- BIS[3-(MORPHOLIN-4-YL)PROPYL]BENZO[LMN][3, 8]PHENANTHROLINE-1,3,6,8(2H,7H)-TETRONE C44 H66 N10 O6	CRYSTAL STRUCTURE OF AN INTRAMOLECULAR HUMAN TELOMERIC DNA G QUADRUPLEX 21-MER BOUND BY THE NAPHTHALENE DIIMIDE COMPOUND DNA (5'- D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP 3') DNA INTRAMOLECULAR, LIGAND-COMPLEX, G-QUADRUPLEX, TELOMERE, DNA

0EC    6,7-DIMETHOXY-2-(PIPERAZIN-1-YL)QUINAZOLIN-4-AMINE

Code	Class Resolution	Description
2lwk	nuc      NMR    	6,7-DIMETHOXY-2-(PIPERAZIN-1-YL)QUINAZOLIN-4-AMINE C14 H19 N5 O2	SOLUTION STRUCTURE OF SMALL MOLECULE-INFLUENZA RNA COMPLEX RNA (32-MER) RNA DOUBLE HELIX, RNA, STRUCTURAL GENOMICS, SEATTLE STRUCTURAL G CENTER FOR INFECTIOUS DISEASE, SSGCID

0KZ    [(1R,2S,4S,5S)-2-HYDROXY-4-(5-METHYL-2,4-DIOXO-3,4- DIHYDROPYRIMIDIN-1(2H)-YL)BICYCLO[3.1.0]HEX-1- YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
4dkz	nuc      1.80	[(1R,2S,4S,5S)-2-HYDROXY-4-(5-METHYL-2,4-DIOXO-3,4- DIHYDROPYRIMIDIN-1(2H)-YL)BICYCLO[3.1.0]HEX-1- YL]METHYL DIHYDROGEN PHOSPHATE 4(C12 H17 N2 O7 P)	HAIRPIN STRUCTURE OF A DNA DODECAMER CONTAINING NORTH-METHAN DEOXYTHYMIDINE SYNTHETIC DNA DODECAMER CONTAING NORTH-METHANOCAR DEOXYTHYMIDINE (N-MCDT) DNA NORTH-METHANOCARBA-2'-DEOXYTHYMIDINE, N-MCDT, X-RAY CRYSTAL STRUCTURE, TETRA-LOOP HAIRPIN, C4'-EXO PUCKER, HAIRPIN DNA,

0TN    DELTA-RU(PHEN)2(DPPZ) COMPLEX

Code	Class Resolution	Description
4jd8	nuc      1.16	DELTA-RU(PHEN)2(DPPZ) COMPLEX C42 H26 N8 RU	RACEMIC-[RU(PHEN)2(DPPZ)]2+] BOUND TO SYNTHETIC DNA AT HIGH DNA (5'-D(*AP*TP*GP*CP*AP*T)-3') DNA INTERCALATION, RACEMIC LIGAND-DNA, DNA
5jeu	nuc      0.97	DELTA-RU(PHEN)2(DPPZ) COMPLEX 2(C42 H26 N8 RU)	DEL-[RU(PHEN)2(DPPZ)]2+ BOUND TO D(TCGGCGCCGA) WITH BA2+ DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA DNA, RUTHENIUM, LIGHT-SWITCH, SEMI-INTERCALATION
5jev	nuc      0.99	DELTA-RU(PHEN)2(DPPZ) COMPLEX 2(C42 H26 N8 RU)	DEL-[RU(PHEN)2(DPPZ]2+ BOUND TO D(TCGGCGCCGA) WITH COBALT HE DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA DNA, RUTHENIUM, CROSS-LINKING, DNA PROBE

104    N,N'-BIS(2-AMINOETHYL)-1,2-ETHANEDIAMINE

Code	Class Resolution	Description
1dj6	nuc      1.00	N,N'-BIS(2-AMINOETHYL)-1,2-ETHANEDIAMINE 2(C6 H18 N4)	COMPLEX OF A Z-DNA HEXAMER, D(CG)3, WITH SYNTHETIC POLYAMINE AT ROOM TEMPERATURE 5'-D(*CP*GP*CP*GP*CP*G)-3' DNA Z-DNA:POLYAMINE COMPLEX, X-RAY CRYSTAL STRUCTURE, POLYAMINE BINDING IN MINOR GROOVE OF Z-DNA

10C    4-AMINO-1-{2,5-ANHYDRO-4-[(PHOSPHONOOXY)METHYL]-ALPHA- L-LYXOFURANOSYL}PYRIMIDIN-2(1H)-ONE

Code	Class Resolution	Description
2oom	nuc      NMR    	4-AMINO-1-{2,5-ANHYDRO-4-[(PHOSPHONOOXY)METHYL]-ALPHA- L-LYXOFURANOSYL}PYRIMIDIN-2(1H)-ONE C10 H14 N3 O8 P	NMR STRUCTURE OF A KISSING COMPLEX FORMED BETWEEN THE TAR RNA ELEMENT OF HIV-1 AND A LNA/RNA APTAMER TAR RNA ELEMENT OF HIV-1, RNA 16-MER RNA LNA; LOCKED NUCLEIC ACID; NMR; APTAMER; TAR; HIV-1, RNA
2pn9	nuc      NMR    	4-AMINO-1-{2,5-ANHYDRO-4-[(PHOSPHONOOXY)METHYL]-ALPHA- L-LYXOFURANOSYL}PYRIMIDIN-2(1H)-ONE C10 H14 N3 O8 P	NMR STRUCTURE OF A KISSING COMPLEX FORMED BETWEEN THE TAR RNA ELEMENT OF HIV-1 AND A LNA MODIFIED APTAMER 5'- R(*GP*GP*AP*GP*CP*CP*UP*GP*GP*GP*AP*GP*CP*UP*CP*C)-3', RNA 16-MER WITH LOCKED RESIDUES 9-10 RNA RNA; LNA; LOCKED NUCLEIC ACID; NMR; APTAMER; TAR; HIV-1; KISSING

125    2'-O-FLUOROETHYL-5-METHYL-URIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1i0g	nuc      1.45	2'-O-FLUOROETHYL-5-METHYL-URIDINE-5'-MONOPHOSPHATE 2(C12 H18 F N2 O9 P)	1.45 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-FLUOROETHYL THYMINE IN PLACE OF T6, MEDIUM NA-SALT 5'-D(*GP*CP*GP*TP*AP*(125)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
1i0m	nuc      1.05	2'-O-FLUOROETHYL-5-METHYL-URIDINE-5'-MONOPHOSPHATE 2(C12 H18 F N2 O9 P)	1.05 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-FLUOROETHYL THYMINE IN PLACE OF T6, HIGH RB-SALT 5'-D(*GP*CP*GP*TP*AP*(125)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
1y86	nuc      1.70	2'-O-FLUOROETHYL-5-METHYL-URIDINE-5'-MONOPHOSPHATE 2(C12 H18 F N2 O9 P)	CRYSTAL STRUCTURE OF THE A-DNA GCGTAT*CGC WITH A 2'-O-[2- (FLUORO)ETHYL] THYMIDINE (T*) 5'-D(*GP*CP*GP*TP*AP*(125)P*AP*CP*GP*C)-3' DNA CRYSTAL STRUCTURE, A-DNA, O2'-MODIFICATION, DECAMER

126    2'-O-METHYL-[TRI(OXYETHYL)]-5-METHYL-URIDINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
1i0k	nuc      1.05	2'-O-METHYL-[TRI(OXYETHYL)]-5-METHYL-URIDINE-5'- MONOPHOSPHATE 2(C17 H29 N2 O12 P)	1.05 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-METHYL-[TRI(OXYETHYL)] THYMINE IN PLACE OF T6, MEDIUM CS-SALT 5'-D(*GP*CP*GP*TP*AP*(126)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
1i0n	nuc      1.30	2'-O-METHYL-[TRI(OXYETHYL)]-5-METHYL-URIDINE-5'- MONOPHOSPHATE 2(C17 H29 N2 O12 P)	1.3 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-METHYL-[TRI(OXYETHYL)] THYMINE IN PLACE OF T6, MEDIUM RB-SALT 5'-D(*GP*CP*GP*TP*AP*(126)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
1i0p	nuc      1.30	2'-O-METHYL-[TRI(OXYETHYL)]-5-METHYL-URIDINE-5'- MONOPHOSPHATE 2(C17 H29 N2 O12 P)	1.3 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-METHYL-[TRI(OXYETHYL)], MEDIUM K-SALT 5'-D(*GP*CP*GP*TP*AP*(126)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
1i0q	nuc      1.30	2'-O-METHYL-[TRI(OXYETHYL)]-5-METHYL-URIDINE-5'- MONOPHOSPHATE 2(C17 H29 N2 O12 P)	1.3 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-METHYL-[TRI(OXYETHYL)] THYMINE IN PLACE OF T6, MEDIUM NA-SALT 5'-D(*GP*CP*GP*TP*AP*(126)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
412d	nuc      1.65	2'-O-METHYL-[TRI(OXYETHYL)]-5-METHYL-URIDINE-5'- MONOPHOSPHATE 2(C17 H29 N2 O12 P)	DUPLEX [5'-D(GCGTA+TACGC)]2 WITH INCORPORATED 2'-O-METHYL- [TRI(OXYETHYL)] RIBONUCLEOSIDE DNA (5'-D(*GP*CP*GP*TP*AP*(126)P*AP*CP*GP*C)-3') DNA DUPLEX [5'-D(GCGTA+TACGC)]2 WITH INCORPORATED 2'-O-METHYL- [TRI(OXYETHYL)] RIBONUCLEOSIDE, DNA

127    2'-O-AMINOOXY-ETHYL-5-METHYL-URIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1i0f	nuc      1.60	2'-O-AMINOOXY-ETHYL-5-METHYL-URIDINE-5'-MONOPHOSPHATE 2(C12 H20 N3 O10 P)	1.6 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-AMINOOXYETHYL THYMINE IN PLACE OF T6, BA-FORM 5'-D(*GP*CP*GP*TP*AP*(127)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA

12A    2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1fir	nuc      3.30	2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE C16 H23 N6 O11 P S	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) RNA MAMMALIAN TRANSFERT RIBONUCLEIC ACID, HIV-1 PRIMER TRNA, AMI TRANSPORT, CANONICAL TRNA STRUCTURE, CANONICAL ANTICODON, FRAMESHIFTING, CODON/ANTICODON MIMICRY, MODIFIED BASES, RNA
2l9e	nuc      NMR    	2-METHYLTHIO-N6-(AMINOCARBONYL-L-THREONYL)-ADENOSINE- 5'-MONOPHOSPHATE C16 H23 N6 O11 P S	SOLUTION STRUCTURE OF THE HUMAN ANTI-CODON STEM AND LOOP(HAS TRANSFER RNA LYSINE 3 (TRNALYS3) RNA (5'-R(*GP*CP*AP*GP*AP*CP*UP*(70U)P*UP*UP*(12A P*AP*UP*CP*UP*GP*C)-3') RNA RNA

13D    1,3-DIAMINOPROPANE

Code	Class Resolution	Description
2f8w	nuc      1.20	1,3-DIAMINOPROPANE C3 H10 N2	CRYSTAL STRUCTURE OF D(CACGTG)2 5'-D(*CP*AP*CP*GP*TP*G)-3' DNA D(CACGTG), POLYAMINE, Z-DNA, 1,3-PROPANEDIAMINE

14L    (11S,12S,13S)-11,12,13,14-TETRAHYDRONAPHTHO[1,2,3,4- PQR]TETRAPHENE-11,12,13-TRIOL

Code	Class Resolution	Description
2lzk	nuc      NMR    	(11S,12S,13S)-11,12,13,14-TETRAHYDRONAPHTHO[1,2,3,4- PQR]TETRAPHENE-11,12,13-TRIOL C24 H18 O3	NMR SOLUTION STRUCTURE OF AN N2-GUANINE DNA ADDUCT DERIVED F POTENT TUMORIGEN DIBENZO[A,L]PYRENE: INTERCALATION FROM THE GROOVE WITH RUPTURED WATSON-CRICK BASE PAIRING DNA (5'-D(*GP*GP*TP*AP*GP*CP*GP*AP*TP*GP*G)-3'), DNA (5'-D(*CP*CP*AP*TP*CP*GP*CP*TP*AP*CP*C)-3') DNA 14R (+)-TRANS-ANTI-DB[A,L]P-N2-DG, DNA ADDUCT, DNA

1AF    2,4-BIS{[4-(N-CYCLOPENTYLDIAMINOMETHYL)PHENYL]}FURAN

Code	Class Resolution	Description
2gxc	nuc      model  	2,4-BIS{[4-(N-CYCLOPENTYLDIAMINOMETHYL)PHENYL]}FURAN C28 H36 N4 O	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 2,4-BIS{[4-(N-CYCLOPENTYLDIAMINOMETHYL)PHENYL]}FURAN. DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, FURAN DERIVATIVE

1AP    2,6-DIAMINOPURINE NUCLEOTIDE

Code	Class Resolution	Description
1d76	nuc      1.30	2,6-DIAMINOPURINE NUCLEOTIDE 2(C10 H15 N6 O6 P)	CRYSTAL AND MOLECULAR STRUCTURE OF A DNA FRAGMENT CONTAINING A 2-AMINO ADENINE MODIFICATION: THE RELATIONSHIP BETWEEN CONFORMATION, PACKING, AND HYDRATION IN Z-DNA HEXAMERS DNA (5'-D(*CP*GP*UP*(1AP)P*CP*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1s1k	nuc      1.90	2,6-DIAMINOPURINE NUCLEOTIDE C10 H15 N6 O6 P	INFLUENCE OF GROOVE INTERACTIONS ON DNA HOLLIDAY JUNCTION FORMATION 5'-D(*CP*CP*(1AP)P*GP*TP*AP*CP*TP*GP*G)-3' DNA B-DNA, DOUBLE HELIX, 2, 6-DIAMINOPURINE, MINOR GROOVE INTERACTIONS
1vty	nuc      1.30	2,6-DIAMINOPURINE NUCLEOTIDE 2(C10 H15 N6 O6 P)	CRYSTAL STRUCTURE OF A Z-DNA FRAGMENT CONTAINING THYMINE/2- AMINOADENINE BASE PAIRS DNA (5'-D(*CP*(NH2)AP*CP*GP*TP*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED, DNA
210d	nuc      1.35	2,6-DIAMINOPURINE NUCLEOTIDE C10 H15 N6 O6 P	CRYSTAL AND MOLECULAR STRUCTURE OF A NEW Z-DNA CRYSTAL FORM: D[CGT(2-NH2-A)CG] AND ITS PLATINATED DERIVATIVE DNA (5'-D(*CP*GP*TP*(1AP)P*CP*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
211d	nuc      1.60	2,6-DIAMINOPURINE NUCLEOTIDE C10 H15 N6 O6 P	THE CRYSTAL AND MOLECULAR STRUCTURE OF A NEW Z-DNA CRYSTAL FORM: D[CGT(2-NH2-A) CG] AND ITS PLATINATED DERIVATIVE DNA (5'-D(*CP*GP*TP*(1AP)P*CP*(PT(NH3)3)G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED

1CC    5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE

Code	Class Resolution	Description
4pwm	nuc      1.95	5-CARBOXY-2'-DEOXYCYTIDINE MONOPHOSPHATE 2(C10 H14 N3 O9 P)	CRYSTAL STRUCTURE OF DICKERSON DREW DODECAMER WITH 5-CARBOXY 5'-[CGCGAATT(5CC)GCG]-3' DNA DNA CRYSTAL STRUCTURE, DICKERSON DREW DODECAMER, 5-CARBOXYCY 5-CARBOXYCYTOSINE, DNA

1CF    2-HYDROXYETHYL 6-DEOXY-BETA-L-GALACTOPYRANOSIDE

Code	Class Resolution	Description
2lyg	nuc      NMR    	2-HYDROXYETHYL 6-DEOXY-BETA-L-GALACTOPYRANOSIDE C8 H16 O6	FUC_TBA DNA (5'-D(P*GP*GP*TP*TP*GP*GP*TP*GP*TP*GP*GP*TP*T 3') DNA CARBOHYDRATE-DNA INTERACTION, G-QUADRUPLEX STRUCTURE, DNA

1DP    N1-DEAZA-ADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
3i2q	nuc      2.90	N1-DEAZA-ADENOSINE-5'-MONOPHOSPHATE C11 H15 N4 O7 P	CRYSTAL STRUCTURE OF THE HAIRPIN RIBOZYME WITH 2'OME SUBSTRA AND N1-DEAZAADENOSINE AT POSITION A9 DNA/RNA (30-MER), 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*C *C)-3', 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*CP*GP* CHAIN: A RNA HAIRPIN RIBOZYME, N1-DEAZAADENOSINE, RNA
3i2r	nuc      2.80	N1-DEAZA-ADENOSINE-5'-MONOPHOSPHATE C11 H15 N4 O7 P	CRYSTAL STRUCTURE OF THE HAIRPIN RIBOZYME WITH A 2',5'- LINKED SUBSTRATE WITH N1-DEAZAADENOSINE AT POSITION A9 5'- R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*CP*UP*GP*CP*C) -3', DNA/RNA (30-MER), 5'-R(*UP*CP*CP*CP*AP*GP*UP*CP*CP*AP*CP*CP*GP*U)- 3' RNA HAIRPIN RIBOZYME, N1-DEAZAADENOSINE, RNA
3i2s	nuc      2.75	N1-DEAZA-ADENOSINE-5'-MONOPHOSPHATE C11 H15 N4 O7 P	CRYSTAL STRUCTURE OF THE HAIRPIN RIBOZYME WITH A 2'OME SUBST N1-DEAZAADENOSINE AT POSITION A10 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*CP*GP* CHAIN: A, 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*C *C)-3', DNA/RNA (30-MER) RNA HAIRPIN RIBOZYME, N1-DEAZAADENOSINE, RNA
3i2u	nuc      2.80	N1-DEAZA-ADENOSINE-5'-MONOPHOSPHATE C11 H15 N4 O7 P	CRYSTAL STRUCTURE OF THE HAIPRIN RIBOZYME WITH A 2',5'- LINKED SUBSTRATE AND N1-DEAZAADENOSINE AT POSITION A10 5'- R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*CP*UP*GP*CP*C) -3', DNA/RNA (30-MER), 5'-R(*UP*CP*CP*CP*AP*GP*UP*CP*CP*AP*CP*CP*GP*U)- 3' RNA HAIRPIN RIBOZYME, N1-DEAZAADENOSINE, RNA

1GL    4-O-METHYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE

Code	Class Resolution	Description
1d83	nuc      NMR    	4-O-METHYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE 2(C7 H14 O4)	STRUCTURE REFINEMENT OF THE CHROMOMYCIN DIMER/DNA OLIGOMER COMPLEX IN SOLUTION DNA (5'-D(*AP*AP*GP*GP*CP*CP*TP*T)-3') DNA DNA, NMR, DOUBLE HELIX, CHROMOMYCIN
1ekh	nuc      NMR    	4-O-METHYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE 2(C7 H14 O4)	NMR STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND CO DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1eki	nuc      NMR    	4-O-METHYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE 2(C7 H14 O4)	AVERAGE SOLUTION STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMY COBALT DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1vaq	nuc      2.00	4-O-METHYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE 4(C7 H14 O4)	CRYSTAL STRUCTURE OF THE MG2+-(CHROMOMYCIN A3)2-D(TTGGCCAA) 2 COMPLEX REVEALS GGCC BINDING SPECIFICITY OF THE DRUG DIMER CHELATED BY METAL ION 5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3' DNA CHROMOMYCIN A3, X-RAY DIFFRACTION, MAD, DNA DUPLEX, GGCC SITE, DNA KINK, CD SPECTRA
5erz	nuc      1.75	4-O-METHYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE 2(C7 H14 O4)	CRYSTAL STRUCTURE OF THE [NI2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX
5es0	nuc      2.10	4-O-METHYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE 2(C7 H14 O4)	CRYSTAL STRUCTURE OF THE [CO2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX

1MA    6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1c2w	nuc      7.50	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	23S RRNA STRUCTURE FITTED TO A CRYO-ELECTRON MICROSCOPIC MAP ANGSTROMS RESOLUTION 23S RIBOSOMAL RNA RIBOSOME 23S RRNA, RIBOSOME, LARGE RIBOSOMAL SUBUNIT, ATOMIC PROTEIN BIOSYNTHESIS, RIBONUCLEIC ACID, EM-RECONSTRUCTION, 3D ARRAN FITTING
1ehz	nuc      1.93	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	THE CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRNA AT 1.93 A TRANSFER RNA (PHE) RNA TRNA, YEAST, PHENYLALANINE, RNA
1evv	nuc      2.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRANSFER RNA AT 2.0 RESOLUTION PHENYLALANINE TRANSFER RNA RNA TRANSFER RNA, PHENYLALANINE, PHE-TRNA, YEAST, AMINO-ACID TRA RNA
1fcw	nuc      17.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 5(C11 H16 N5 O7 P)	TRNA POSITIONS DURING THE ELONGATION CYCLE TRNAPHE RIBOSOME RIBOSOME, TRNA BINDING SITES, PROTEIN SYNTHESIS, ELONGATION
1fir	nuc      3.30	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) RNA MAMMALIAN TRANSFERT RIBONUCLEIC ACID, HIV-1 PRIMER TRNA, AMI TRANSPORT, CANONICAL TRNA STRUCTURE, CANONICAL ANTICODON, FRAMESHIFTING, CODON/ANTICODON MIMICRY, MODIFIED BASES, RNA
1ipl	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3' RIBONUCLEIC ACID TRANSLOCATION, LARGE RIBOSOMAL RNA, SMALL RIBOSOMAL RNA, TRNA, MRNA
1ipx	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRANSFER RNA BOUND TO P SITE, TRANSFER RNA BOUND TO R SITE RIBONUCLEIC ACID TRNA-TRNA INTERACTION
1ipz	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRANSFER RNA BOUND TO P SITE, TRANSFER RNA BOUND TO R SITE RIBONUCLEIC ACID NONCOGNATE TRNA-TRNA INTERACTION
1k7n	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 2) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7o	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 3) P-SITE TRNA, A-SITE TRNA, MRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7p	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 4) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7r	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 1) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1ks1	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H18 N5 O7 P	A MODEL FOR A FIVE-PRIME STACKED TRNA PHENYLALANINE TRANSFER RNA RIBONUCLEIC ACID FIVE-PRIME STACK, TRNA
1nrt	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 3(C11 H18 N5 O7 P)	APE-SITE TRNA, THEORETICAL MODEL TRANSFER RIBONUCLEIC ACID AMINO-ACID TRANSPORT AMINO-ACID TRANSPORT, TRNA, MODEL
1q49	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1q5s	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxu	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxv	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rcz	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd0	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B2) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd1	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C2) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd2	nuc      model  	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O7 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1tn1	nuc      3.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE TRNA TRNAPHE RNA TRANSLATION, RNA
1tn2	nuc      3.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE T-RNA TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1tra	nuc      3.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	RESTRAINED REFINEMENT OF THE MONOCLINIC FORM OF YEAST PHENYL TRANSFER RNA. TEMPERATURE FACTORS AND DYNAMICS, COORDINATED AND BASE-PAIR PROPELLER TWIST ANGLES TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1yfg	nuc      3.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	YEAST INITIATOR TRNA YEAST INITIATOR TRNA T-RNA AMINO ACID TRANSPORT, TRANSFER RIBONUCLEIC ACID, T-RNA
2z9q	nuc      11.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	TRANSFER RNA IN THE HYBRID P/E STATE TRNA RNA DISTORTED ANTICODON-STEM-LOOP, TWISTED CCA ARM, RNA
486d	nuc      7.50	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	X-RAY CRYSTAL STRUCTURES OF 70S RIBOSOME FUNCTIONAL COMPLEXE E-SITE TRNA OF 70S RIBOSOME, A-SITE TRNA OF 70S RIBOSOME, P-SITE CODON OF 70S RIBOSOME, P-SITE TRNA OF 70S RIBOSOME, A-SITE CODON OF 70S RIBOSOME, 900 STEM-LOOP OF 16S RRNA IN THE 70S RIBOSOME, PENULTIMATE STEM OF 16S RRNA IN THE 70S RIBOSOME RIBOSOME FUNCTIONAL MODELS OF 70S RIBOSOME, TRNA, RIBOSOME
4tna	nuc      2.50	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	FURTHER REFINEMENT OF THE STRUCTURE OF YEAST T-RNA-PHE TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
4tra	nuc      3.00	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPA AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
4wcp	nuc      2.40	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408ME1A-MUTANT RIBOSOMA SITE RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*(1MA) P*CP*GP*UP*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') RNA RIBOSOME, RNA, AMINOGLYCOSIDE, ANTIBIOTIC-RESISTANCE
4wcq	nuc      2.10	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408ME1A-MUTANT RIBOSOMA SITE IN COMPLEX WITH GENETICIN RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*(1MA) P*CP*GP*UP*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') RNA RIBOSOME, RNA, AMINOGLYCOSIDE, ANTIBIOTIC-RESISTANCE
4wcr	nuc      3.50	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408ME1A-MUTANT RIBOSOMA SITE IN COMPLEX WITH PAROMOMYCIN RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*(1MA) P*CP*GP*UP*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') RNA RIBOSOME, RNA, AMINOGLYCOSIDE, ANTIBIOTIC-RESISTANCE
4wcs	nuc      3.10	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408ME1A-MUTANT RIBOSOMA SITE IN THE PRESENCE OF GENTAMICIN RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*(1MA) P*CP*GP*UP*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') RNA RIBOSOME, RNA, AMINOGLYCOSIDE, ANTIBIOTIC-RESISTANCE
6tna	nuc      2.70	6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE T-RNA. I.CRYSTALLOG REFINEMENT TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS

1MG    1N-METHYLGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1luu	nuc      NMR    	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	NMR SOLUTION STRUCTURE OF THE ANTICODON OF YEAST TRNA-PHE WITH 4 MODIFICATIONS (OMC32 OMG34 1MG37 5MC40) 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG) P*AP*AP*(1MG)P*AP*UP*(5MC)P*UP*GP*G)-3' RNA TRNA, ANTICODON STEM LOOP, TRNA DOMAIN, RNA HAIRPIN, 1MG, 2'-O-METHYL, 5MC
1vtq	nuc      3.00	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	THREE-DIMENSIONAL STRUCTURE OF YEAST T-RNA-ASP. I. STRUCTURE DETERMINATION TRNAASP RNA T-RNA, SINGLE STRAND, LOOPS, RNA
1yfg	nuc      3.00	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	YEAST INITIATOR TRNA YEAST INITIATOR TRNA T-RNA AMINO ACID TRANSPORT, TRANSFER RIBONUCLEIC ACID, T-RNA
2tra	nuc      3.00	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPA AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAASP T-RNA T-RNA, SINGLE STRAND, LOOPS
3tra	nuc      3.00	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPARTIC ACID AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAASP T-RNA T-RNA, SINGLE STRAND, LOOPS
486d	nuc      7.50	1N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	X-RAY CRYSTAL STRUCTURES OF 70S RIBOSOME FUNCTIONAL COMPLEXE E-SITE TRNA OF 70S RIBOSOME, A-SITE TRNA OF 70S RIBOSOME, P-SITE CODON OF 70S RIBOSOME, P-SITE TRNA OF 70S RIBOSOME, A-SITE CODON OF 70S RIBOSOME, 900 STEM-LOOP OF 16S RRNA IN THE 70S RIBOSOME, PENULTIMATE STEM OF 16S RRNA IN THE 70S RIBOSOME RIBOSOME FUNCTIONAL MODELS OF 70S RIBOSOME, TRNA, RIBOSOME

1P1    (22R,51R)-22,51-DIAMINO-5,11,17,28,34,40,46,57- OCTAMETHYL-2,5,8,11,14,17,20,25,28,31,34,37,40,43,46, 49,54,57,60,61,64,65-DOCOSAAZANONACYCLO[54.2.1.1~4, 7~.1~10,13~.1~16,19~.1~27,30~.1~33,36~.1~39,42~.1~45, 48~]HEXAHEXACONTA-1(58),4(66),6,10(65),12,16(64

Code	Class Resolution	Description
3i5l	nuc      1.18	(22R,51R)-22,51-DIAMINO-5,11,17,28,34,40,46,57- OCTAMETHYL-2,5,8,11,14,17,20,25,28,31,34,37,40,43,46, 49,54,57,60,61,64,65-DOCOSAAZANONACYCLO[54.2.1.1~4, 7~.1~10,13~.1~16,19~.1~27,30~.1~33,36~.1~39,42~.1~45, 48~]HEXAHEXACONTA-1(58),4(66),6,10(65),12,16(64 C52 H60 N24 O10	ALLOSTERIC MODULATION OF DNA BY SMALL MOLECULES 5'-D(*CP*CP*AP*GP*GP*(C38)P*CP*TP*GP*G)-3' DNA CYCLIC POLYAMIDE, DNA BINDER, MINOR GROOVE BINDER, PYIM POLYAMIDE

1P2    (23R,52R)-23,52-DIAMINO-5,11,17,28,34,40,46,57- OCTAMETHYL-2,5,8,11,14,17,20,25,28,31,34,37,40,43,46, 49,54,57,60,64-ICOSAAZANONACYCLO[54.2.1.1~4,7~.1~10, 13~.1~16,19~.1~27,30~.1~33,36~.1~39,42~.1~45, 48~]HEXAHEXACONTA-1(58),4(66),6,10(65),12,16(64),18, 2

Code	Class Resolution	Description
3omj	nuc      0.95	(23R,52R)-23,52-DIAMINO-5,11,17,28,34,40,46,57- OCTAMETHYL-2,5,8,11,14,17,20,25,28,31,34,37,40,43,46, 49,54,57,60,64-ICOSAAZANONACYCLO[54.2.1.1~4,7~.1~10, 13~.1~16,19~.1~27,30~.1~33,36~.1~39,42~.1~45, 48~]HEXAHEXACONTA-1(58),4(66),6,10(65),12,16(64),18, 2 C54 H62 N22 O10	STRUCTURAL BASIS FOR CYCLIC PY-IM POLYAMIDE ALLOSTERIC INHIB NUCLEAR RECEPTOR BINDING 5'-D(*CP*(C38)P*AP*GP*TP*AP*CP*TP*GP*G)-3' DNA CYCLIC PY-IM POLYAMIDE, DNA

1PE    PENTAETHYLENE GLYCOL

Code	Class Resolution	Description
3dil	nuc      1.90	PENTAETHYLENE GLYCOL 3(C10 H22 O6)	CRYSTAL STRUCTURE OF THE THERMOTOGA MARITIMA LYSINE RIBOSWIT TO LYSINE RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3dim	nuc      2.90	PENTAETHYLENE GLYCOL C10 H22 O6	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH LYSINE, CS+ SOAK RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3dio	nuc      2.40	PENTAETHYLENE GLYCOL C10 H22 O6	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH BOUND TO LYSINE, IRIDIUM HEXAMINE SOAK RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3diq	nuc      2.70	PENTAETHYLENE GLYCOL C10 H22 O6	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH BOUND TO HOMOARGININE RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA

1PT    CYCLOHEXANE-1(R),2(R)-DIAMINE-PLATINUM(II)

Code	Class Resolution	Description
1pg9	nuc      NMR    	CYCLOHEXANE-1(R),2(R)-DIAMINE-PLATINUM(II) C6 H14 N2 PT 2+	NMR SOLUTION STRUCTURE OF AN OXALIPLATIN 1,2-D(GG) INTRASTRAND CROSS-LINK IN A DNA DODECAMER DUPLEX 5'-D(*GP*GP*AP*GP*GP*CP*CP*TP*GP*AP*GP*G)-3', 5'-D(*CP*CP*TP*CP*AP*GP*GP*CP*CP*TP*CP*C)-3' DNA DEOXYRIBONUCLEIC ACID; OXALIPLATIN; DNA; DUPLEX; DODECAMER; NMR
1pgc	nuc      NMR    	CYCLOHEXANE-1(R),2(R)-DIAMINE-PLATINUM(II) C6 H14 N2 PT 2+	NMR SOLUTION STRUCTURE OF AN OXALIPLATIN 1,2-D(GG) INTRASTRAND CROSS-LINK IN A DNA DODECAMER DUPLEX 5'-D(*CP*CP*TP*CP*AP*GP*GP*CP*CP*TP*CP*C)-3', 5'-D(*GP*GP*AP*GP*GP*CP*CP*TP*GP*AP*GP*G)-3' DNA DEOXYRIBONUCLEIC ACID; OXALIPLATIN; DNA; DUPLEX; DODECAMER; NMR
2k0t	nuc      NMR    	CYCLOHEXANE-1(R),2(R)-DIAMINE-PLATINUM(II) C6 H14 N2 PT 2+	HIGH RESOLUTION SOLUTION NMR STRUCTURES OF OXALIPLATIN-DNA A DNA (5'-D(*DCP*DCP*DTP*DCP*DTP*DGP*DGP*DTP*DCP*DT 3'), DNA (5'-D(*DGP*DGP*DAP*DGP*DAP*DCP*DCP*DAP*DGP*DA 3') DNA OXALIPLATIN-DNA ADDUCT, DNA
2k0u	nuc      NMR    	CYCLOHEXANE-1(R),2(R)-DIAMINE-PLATINUM(II) C6 H14 N2 PT 2+	HIGH RESOLUTION SOLUTION NMR STRUCTURES OF OXALIPLATIN-DNA A DNA (5'-D(*DGP*DGP*DAP*DGP*DAP*DCP*DCP*DAP*DGP*DA 3'), DNA (5'-D(*DCP*DCP*DTP*DCP*DTP*DGP*DGP*DTP*DCP*DT 3') DNA OXALIPLATIN-DNA ADDUCT, DNA

1SB   

Code	Class Resolution	Description
2gxv	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 1,2-BIS[5-(2-AMIDINO)-2-BENZIMIDAZOLYL]ETHENE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

1SC    5'-O-THIOPHOSPHONOCYTIDINE

Code	Class Resolution	Description
364d	nuc      3.00	5'-O-THIOPHOSPHONOCYTIDINE C9 H14 N3 O7 P S	3.0 A STRUCTURE OF FRAGMENT I FROM E. COLI 5S RRNA RNA (5'-R(*UP*GP*)-D(*(1SC)P*)- R(*CP*UP*GP*GP*CP*GP*GP*C)-3'), RNA (5'- R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*G P*GP*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP*CP*AP*U)-3'), RNA (5'- R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*GP*UP*GP*GP*GP*G *UP*C)-3') RNA U-RNA, DOUBLE HELIX, KINKED, INTERNAL LOOP, OVERHANGING BASE, MODIFIED, MISMATCHED

1SP   

Code	Class Resolution	Description
2gxj	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-AMIDINO)-2-(4-HYDROXYPHENYL)BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

1TL    1-{2,5-ANHYDRO-6-DEOXY-4-[(PHOSPHONOOXY)METHYL]-ALPHA- L-MANNOFURANOSYL}PYRIMIDINE-2,4(1H,3H)-DIONE

Code	Class Resolution	Description
3ukc	nuc      1.54	1-{2,5-ANHYDRO-6-DEOXY-4-[(PHOSPHONOOXY)METHYL]-ALPHA- L-MANNOFURANOSYL}PYRIMIDINE-2,4(1H,3H)-DIONE 2(C11 H15 N2 O9 P)	(S)-CET-BNA DECAMER STRUCTURE DNA (5'-D(*GP*CP*GP*TP*AP*(1TL)P*AP*CP*GP*C)-3') DNA A-FORM DNA, BICYCLIC NUCLEIC ACID, BNA, DNA, CET-BNA, ANTISE OLIGONUCLEOTIDES

1TW    2-AMINO-9-(2-SE-METHYL-5-O-PHOSPHONO-2-SELENO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE

Code	Class Resolution	Description
4kw0	nuc      1.49	2-AMINO-9-(2-SE-METHYL-5-O-PHOSPHONO-2-SELENO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE 2(C11 H16 N5 O7 P SE)	STRUCTURE OF DICKERSON-DREW DODECAMER WITH 2'-MESE-ARA-G MOD DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(1TW)P*CP*G CHAIN: A, B DNA B-DNA, 2'-MESE-ARABINOSYL-DEOXYGUANOSINE, DNA

1W5    (1R)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-2-DEOXY-5-O-PHOSPHONO-D-ERYTHRO-PENTITOL

Code	Class Resolution	Description
4rhd	nuc      1.70	(1R)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-2-DEOXY-5-O-PHOSPHONO-D-ERYTHRO-PENTITOL 4(C10 H14 N3 O9 P)	DNA DUPLEX WITH NOVEL ZP BASE PAIR DNA 9MER NOVEL Z NUCLEOBASE, DNA 9MER NOVEL P NUCLEOBASE DNA MODIFIED NUCLEOBASE Z AND P, DNA
4xno	nuc      1.99	(1R)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-2-DEOXY-5-O-PHOSPHONO-D-ERYTHRO-PENTITOL 6(C10 H14 N3 O9 P)	CRYSTAL STRUCTURE OF 5'-CTTATPPPZZZATAAG DNA (5'-D(*CP*TP*(BRU)P*AP*TP*(1WA)P*(1WA)P*(1WA) P*(1W5)P*(1W5)P*AP*TP*AP*AP*G)-3') DNA A-FORM DNA, NON-NATURAL NUCLEOBASE PAIR, SYNTHETIC BIOLOGY,
5i4s	nuc      2.46	(1R)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-2-DEOXY-5-O-PHOSPHONO-D-ERYTHRO-PENTITOL 2(C10 H14 N3 O9 P)	NON-NATURAL DNA PAIR Z (6-AMINO-5-NITRO-2[1H] PYRIDONE HETER GUANOSINE DNA (5'-D(P*GP*CP*GP*AP*AP*TP*TP*(D8Z)P*GP*CP*G)- CHAIN: A, B DNA NON-NATURAL NUCLEOTIDE BASE, SYNTHETIC BIOLOGY, 6-AMINO-5-NI PYRIDONE HETEROCYCLE), DNA
5ktv	nuc      2.35	(1R)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-2-DEOXY-5-O-PHOSPHONO-D-ERYTHRO-PENTITOL 2(C10 H14 N3 O9 P)	MIS-PAIRING OF UNNATURAL BASE Z-G DNA DUPLEX AT PH 8.5 DNA (5'-D(P*GP*CP*GP*AP*AP*TP*TP*(1W5)P*GP*CP*G)- CHAIN: A, B DNA UNNATURAL DNA BASES, SYNTHETIC BIOLOGY, DNA
5lj4	nuc      2.17	(1R)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-2-DEOXY-5-O-PHOSPHONO-D-ERYTHRO-PENTITOL 2(C10 H14 N3 O9 P)	CRYSTAL STRUCTURE OF DNA DUPLEX CONTAINING ZP BASE PAIR ODN2 DNA SYNTHETIC NUCLEOTIDE, DNA

1WA    2-AMINO-8-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-HYDROXY-1H-IMIDAZO[1,2-A][1,3, 5]TRIAZINE-5,8-DIIUM

Code	Class Resolution	Description
4rhd	nuc      1.70	2-AMINO-8-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-HYDROXY-1H-IMIDAZO[1,2-A][1,3, 5]TRIAZINE-5,8-DIIUM 4(C10 H16 N5 O7 P 2+)	DNA DUPLEX WITH NOVEL ZP BASE PAIR DNA 9MER NOVEL Z NUCLEOBASE, DNA 9MER NOVEL P NUCLEOBASE DNA MODIFIED NUCLEOBASE Z AND P, DNA
4xno	nuc      1.99	2-AMINO-8-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-HYDROXY-1H-IMIDAZO[1,2-A][1,3, 5]TRIAZINE-5,8-DIIUM 6(C10 H16 N5 O7 P 2+)	CRYSTAL STRUCTURE OF 5'-CTTATPPPZZZATAAG DNA (5'-D(*CP*TP*(BRU)P*AP*TP*(1WA)P*(1WA)P*(1WA) P*(1W5)P*(1W5)P*AP*TP*AP*AP*G)-3') DNA A-FORM DNA, NON-NATURAL NUCLEOBASE PAIR, SYNTHETIC BIOLOGY,
5lj4	nuc      2.17	2-AMINO-8-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-4-HYDROXY-1H-IMIDAZO[1,2-A][1,3, 5]TRIAZINE-5,8-DIIUM 2(C10 H16 N5 O7 P 2+)	CRYSTAL STRUCTURE OF DNA DUPLEX CONTAINING ZP BASE PAIR ODN2 DNA SYNTHETIC NUCLEOTIDE, DNA

218    1-[(4-AMINO-2-METHYLPYRIMIDIN-5-YL)METHYL]-3-(2- HYDROXYETHYL)-2-METHYLPYRIDINIUM

Code	Class Resolution	Description
2hop	nuc      3.30	1-[(4-AMINO-2-METHYLPYRIMIDIN-5-YL)METHYL]-3-(2- HYDROXYETHYL)-2-METHYLPYRIDINIUM C14 H19 N4 O 1+	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO PYRITHIAMINE THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH

232    1,3-DI[[[10-METHOXY-7H-PYRIDO[4,3-C]CARBAZOL-2-IUMYL]- ETHYL]-PIPERIDIN-4-YL]-PROPANE

Code	Class Resolution	Description
1c9z	nuc      2.40	1,3-DI[[[10-METHOXY-7H-PYRIDO[4,3-C]CARBAZOL-2-IUMYL]- ETHYL]-PIPERIDIN-4-YL]-PROPANE C49 H56 N6 O2 2+	D232-CGTACG 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DNA, INTERCALATOR, INTERCALATION, DRUG, MAJOR GROOVE

23G    GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE

Code	Class Resolution	Description
4qk8	nuc      3.05	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O10 P2	THERMOANAEROBACTER PSEUDETHANOLICUS C-DI-AMP RIBOSWITCH C-DI-AMP RIBOSWITCH RNA C-DI-AMP RIBOSWITCH, RNA
4qk9	nuc      3.05	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O10 P2	THERMOVIRGA LIENII C-DI-AMP RIBOSWITCH C-DI-AMP RIBOSWITCH RNA C-DI-AMP RIBOSWITCH, RNA
4qka	nuc      3.20	GUANOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O10 P2	C-DI-AMP RIBOSWITCH FROM THERMOANAEROBACTER PSEUDETHANOLICUS HEXAMINE SOAK C-DI-AMP RIBOSWITCH RNA C-DI-AMP RIBOSWITCH, RNA

29G    PYRIMIDO[4,5-D]PYRIMIDINE-2,4-DIAMINE

Code	Class Resolution	Description
4lx5	nuc      2.13	PYRIMIDO[4,5-D]PYRIMIDINE-2,4-DIAMINE C6 H6 N6	X-RAY CRYSTAL STRUCTURE OF THE M6" RIBOSWITCH APTAMER BOUND PYRIMIDO[4,5-D]PYRIMIDINE-2,4-DIAMINE (PPDA) MUTATED ADENINE RIBOSWITCH APTAMER RNA RIBOSWITCH, GENE EXPRESSION PLATFORM, RNA

29H    2-AMINOPYRIMIDO[4,5-D]PYRIMIDIN-4(3H)-ONE

Code	Class Resolution	Description
4lx6	nuc      2.15	2-AMINOPYRIMIDO[4,5-D]PYRIMIDIN-4(3H)-ONE C6 H5 N5 O	X-RAY CRYSTAL STRUCTURE OF THE M6C" RIBOSWITCH APTAMER BOUND AMINOPYRIMIDO[4,5-D]PYRIMIDIN-4(3H)-ONE (PPAO) MUTATED ADENINE RIBOSWITCH APTAMER RNA RIBOSWITCH GENE EXPRESSION PLATFORM, RNA

2AD    2'-AMINO-2'-DEOXYADENOSINE

Code	Class Resolution	Description
2gcs	nuc      2.10	2'-AMINO-2'-DEOXYADENOSINE C10 H14 N6 O3	PRE-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME GLMS RIBOZYME AMINO RNA INHIBITOR, GLMS RIBOZYME RNA RNA RNA; RIBOZYME; PSEUDOKNOT; HELIX
2h0x	nuc      2.30	2'-AMINO-2'-DEOXYADENOSINE C10 H14 N6 O3	PRE-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME GLMS RIBOZYME RNA, GLMS RIBOZYME AMINO RNA INHIBITOR RNA RNA, RIBOZYME, PSEUDOKNOT, HELIX

2AR    2'-DEOXYARISTEROMYCIN-5'-PHOSPHATE

Code	Class Resolution	Description
1exl	nuc      NMR    	2'-DEOXYARISTEROMYCIN-5'-PHOSPHATE C11 H16 N5 O5 P	STRUCTURE OF AN 11-MER DNA DUPLEX CONTAINING THE CARBOCYCLIC NUCLEOTIDE ANALOG: 2'-DEOXYARISTEROMYCIN DNA (5'-D(*CP*AP*GP*TP*GP*(2AR)P*GP*TP*CP*AP*C)-3 CHAIN: A, DNA (5'-D(*GP*TP*GP*AP*CP*TP*CP*AP*CP*TP*G)-3') DNA DNA, MODIFIED NUCLEOTIDES, 2'-DEOXYARISTEROMYCIN
1fyi	nuc      NMR    	2'-DEOXYARISTEROMYCIN-5'-PHOSPHATE C11 H16 N5 O5 P	11-MER DNA DUPLEX CONTAINING A 2'-DEOXYARISTEROMYCIN 8-OXO- GUANINE BASE PAIR; 5'-D(*GP*TP*GP*AP*CP*(8OG)P*CP*AP*CP*TP*G)-3', 5'-D(*CP*AP*GP*TP*GP*(2AR)P*GP*TP*CP*AP*C)-3' DNA 2'-DEOXYARISTEROMYCIN, 8-OXO-GUANINE, DNA

2AT    2'-O-ALLYL THYMIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1y9f	nuc      1.60	2'-O-ALLYL THYMIDINE-5'-MONOPHOSPHATE 2(C13 H19 N2 O9 P)	CRYSTAL STRUCTURE OF THE A-DNA GCGTAT*CGC WITH A 2'-O-ALLYL THYMIDINE (T*) 5'-D(*GP*CP*GP*TP*AP*(2AT)P*AP*CP*GP*C)-3') DNA CRYSTAL STRUCTURE, A-DNA, O2'-MODIFICATION, DECAMER

2AU    2'-AMINOURIDINE

Code	Class Resolution	Description
2bq2	nuc      NMR    	2'-AMINOURIDINE 2(C9 H14 N3 O8 P)	SOLUTION STRUCTURE OF THE DNA DUPLEX ACGCGU-NA WITH A 2' AMIDO-LINKED NALIDIXIC ACID RESIDUE AT THE 3' TERMINAL NUCLEOTIDE 5'-D(*AP*CP*GP*CP*GP*2AU)-3' DNA NUCLEIC ACID, DEOXYRIBONUCLEIC ACID, DISRUPTED TERMINAL BASEPAIRS, DNA, QUINOLONE, SYNTHETIC HYBRID, DNA COMPLEX
2kk5	nuc      NMR    	2'-AMINOURIDINE 2(C9 H14 N3 O8 P)	HIGH FIDELITY BASE PAIRING AT THE 3'-TERMINUS 5'-D(*AP*CP*GP*CP*GP*(2AU))-3' DNA ANTHRAQUINONE-LINKED DNA
2npy	nuc      2.65	2'-AMINOURIDINE C9 H14 N3 O8 P	CRYSTAL STRUCTURE OF A JUNCTIONED HAIRPIN RIBOZYME INCORPORA LINKER AND 2'-DEOXY 2'-AMINO U AT A-1 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*C *C)-3', 5'-R(*UP*CP*CP*CP*(U2N)P*GP*UP*CP*CP*AP*CP*CP*G)- CHAIN: A, 5'-R(*GP*GP*CP*AP*GP*AP*GP*AP*AP*AP*CP*AP*CP*AP*C 3': S-TURN STRAND, 5'-R(*CP*GP*GP*UP*GP*AP*GP*AP*AP*GP*GP*G)-3' RNA HAIRPIN RIBOZYME, MUTATION, S-TURN, E-LOOP, RIBOSE ZIPPER, C RNA, 2'-DEOXY 2'-AMINO, 9S LINKER, RNA

2BA    (2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE

Code	Class Resolution	Description
4qk8	nuc      3.05	(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE 2(C20 H24 N10 O12 P2)	THERMOANAEROBACTER PSEUDETHANOLICUS C-DI-AMP RIBOSWITCH C-DI-AMP RIBOSWITCH RNA C-DI-AMP RIBOSWITCH, RNA
4qk9	nuc      3.05	(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE 2(C20 H24 N10 O12 P2)	THERMOVIRGA LIENII C-DI-AMP RIBOSWITCH C-DI-AMP RIBOSWITCH RNA C-DI-AMP RIBOSWITCH, RNA
4qka	nuc      3.20	(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE 2(C20 H24 N10 O12 P2)	C-DI-AMP RIBOSWITCH FROM THERMOANAEROBACTER PSEUDETHANOLICUS HEXAMINE SOAK C-DI-AMP RIBOSWITCH RNA C-DI-AMP RIBOSWITCH, RNA
4qlm	nuc      2.72	(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE 2(C20 H24 N10 O12 P2)	YDAO RIBOSWITCH BINDING TO C-DI-AMP RNA (108-MER) RNA SECOND MESSAGE MOLECULE, C-DI-AMP BINDING, RNA
4qln	nuc      2.65	(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-2,9-BIS(6- AMINO-9H-PURIN-9-YL)OCTAHYDRO-2H,7H-DIFURO[3,2-D:3', 2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-3,5, 10,12-TETROL 5,12-DIOXIDE 2(C20 H24 N10 O12 P2)	STRUCTURE OF YDAO RIBOSWITCH BINDING WITH C-DI-DAMP RNA (117-MER) RNA YDAO RIBOSWITCH, C-DI-AMP, RNA

2BD    N1-(1-HYDROXY-3-BUTEN-2(S)-YL)-2'-DEOXYINOSINE MONO PHOSPHORIC ACID

Code	Class Resolution	Description
1u6n	nuc      NMR    	N1-(1-HYDROXY-3-BUTEN-2(S)-YL)-2'-DEOXYINOSINE MONO PHOSPHORIC ACID C14 H19 N4 O8 P	SOLUTION STRUCTURE OF AN OLIGODEOXYNUCLEOTIDE CONTAINING A BUTADIENE DERIVED N1 B-HYDROXYALKYL ADDUCT ON DEOXYINOSINE IN THE HUMAN N-RAS CODON 61 SEQUENCE 5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP*G)-3', 5'-D(*CP*GP*GP*AP*CP*(2BD)P*AP*GP*AP*AP*G)-3' DNA NMR, BUTADIENE, DEOXYINOSINE, RAS61,, DNA
1z7v	nuc      model  	N1-(1-HYDROXY-3-BUTEN-2(S)-YL)-2'-DEOXYINOSINE MONO PHOSPHORIC ACID C14 H19 N4 O8 P	DUAL ROLES OF GLYCOSYL TORSION ANGLE CONFORMATION AND STEREOCHEMICAL CONFIGURATION IN BUTADIENE OXIDE-DERIVED N1 B-HYDROXYALKYL DEOXYINOSINE ADDUCTS: A STRUCTURAL PERSPECTIVE 5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP*G)-3', 5'-D(*CP*GP*GP*AP*CP*(2BD)P*AP*GP*AP*AP*G)-3' DEOXYRIBONUCLEIC ACID DNA

2BP    9H-PURIN-2-AMINE

Code	Class Resolution	Description
3g4m	nuc      2.40	9H-PURIN-2-AMINE C5 H5 N5	CRYSTAL STRUCTURE OF GUANINE RIBOSWITCH BOUND TO 2- AMINOPURINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, 2-AMINOPURINE, GUANINE, THREE-WAY JUNCTION, RNA-LIGAND COMPLEX, DOUBLE HELIX, BASE-TRIPLE.

2BT    2'-O-BUTYL-THYMIDINE

Code	Class Resolution	Description
1wv5	nuc      2.30	2'-O-BUTYL-THYMIDINE 2(C14 H23 N2 O9 P)	X-RAY STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2' THYMINE IN PLACE OF T6, MG-FORM 5'-D(*GP*CP*GP*TP*AP*(2BT)P*AP*CP*GP*C)-3' DNA DNA
1wv6	nuc      2.55	2'-O-BUTYL-THYMIDINE 2(C14 H23 N2 O9 P)	X-RAY STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2' THYMINE IN PLACE OF T6, SR-FORM 5'-D(*GP*CP*GP*TP*AP*(2BT)P*AP*CP*GP*C)-3' DNA DNA

2BU    (2S,3S)-N6-(2,3,4-TRIHYDROXYBUTYL)-2'-DEOXYADENOSINE MONO PHOSPHORIC ACID

Code	Class Resolution	Description
1u6c	nuc      NMR    	(2S,3S)-N6-(2,3,4-TRIHYDROXYBUTYL)-2'-DEOXYADENOSINE MONO PHOSPHORIC ACID C14 H22 N5 O9 P	THE NMR-DERIVED SOLUTION STRUCTURE OF THE (2S,3S)-N6-(2,3,4- TRIHYDROXYBUTYL)-2'-DEOXYADENOSYL DNA ADDUCT OF BUTADIENE DIOL EPOXIDE (2S,3S)-N6-(2,3,4-TRIHYDROXYBUTYL)-2'- DEOXYADENOSYL DNA ADDUCT OF BUTADIENE DIOL EPOXIDE, (2S,3S)-N6-(2,3,4-TRIHYDROXYBUTYL)-2'- DEOXYADENOSYL DNA ADDUCT OF BUTADIENE DIOL EPOXIDE DNA DNA
1u6o	nuc      NMR    	(2S,3S)-N6-(2,3,4-TRIHYDROXYBUTYL)-2'-DEOXYADENOSINE MONO PHOSPHORIC ACID C14 H22 N5 O9 P	MISPAIRING OF A SITE-SPECIFIC MAJOR GROOVE (2S,3S)-N6-(2,3, 4-TRIHYDROXYBUTYL)-2-DEOXYADENOSYL DNA ADDUCT OF BUTADIENE DIOL EPOXIDE WITH DEOXYGUANOSINE: FORMATION OF A DA(ANTI) DG(ANTI) PAIRING INTERACTION 5'-D(*CP*GP*GP*AP*CP*(2BU)P*AP*GP*AP*AP*G)-3', 5'-D(*CP*TP*TP*CP*TP*GP*GP*TP*CP*CP*G)-3' DNA BUTADIENE, MISMATCH, RAS61, DEOXYADENOSYL, DIOL EPOXIDE, DNA

2DF    N-(2-DEOXY-BETA-D-ERYTHO-PENTOFURANOSYL-5-PHOSPHATE) FORMAMIDE

Code	Class Resolution	Description
1osr	nuc      NMR    	N-(2-DEOXY-BETA-D-ERYTHO-PENTOFURANOSYL-5-PHOSPHATE) FORMAMIDE C6 H12 N O7 P	STRUCTURAL STUDY OF DNA DUPLEX CONTAINAING A N-(2-DEOXY- BETA-ERYTHO-PENTOFURANOSYL) FORMAMIDE FRAMESHIFT BY NMR AND RESTRAINED MOLECULAR DYNAMICS 5'-D(*AP*GP*GP*AP*CP*CP*AP*CP*G)-3', 5'-D(*CP*GP*TP*GP*GP*(2DF)P*TP*CP*CP*T)-3' DNA MODIFIED BASE, MUTAGENESIS, DEOXYRIBONUCLEIC ACID, DNA

2DM    2-HYDROXY-3-(PYREN-1-YLMETHOXY)PROPYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
1s88	nuc      NMR    	2-HYDROXY-3-(PYREN-1-YLMETHOXY)PROPYL DIHYDROGEN PHOSPHATE 2(C20 H19 O6 P)	NMR STRUCTURE OF A DNA DUPLEX WITH TWO INA NUCLEOTIDES INSERTED OPPOSITE EACH OTHER, DCTCAACXCAAGCT:DAGCTTGXGTTGAG 5'-D(*AP*GP*CP*TP*TP*GP*(2DM)P*GP*TP*TP*GP*AP*G)- 3', 5'-D(*CP*TP*CP*AP*AP*CP*(2DM)P*CP*AP*AP*GP*CP*T)- 3' DNA DNA

2EG    2'-DEOXY-N-ETHYLGUANOSINE 5'-PHOSPHATE

Code	Class Resolution	Description
2hmd	nuc      NMR    	2'-DEOXY-N-ETHYLGUANOSINE 5'-PHOSPHATE 2(C12 H18 N5 O7 P)	STEREOCHEMISTRY MODULATES STABILITY OF REDUCED INTER-STRAND CROSS-LINKS ARISING FROM R- AND S-ALPHA-METHYL-GAMMA-OH-1, N2-PROPANO-2'-DEOXYGUANINE IN THE 5'-CPG-3' DNA SEQUENCE DNA DODECAMER WITH INTERSTRAND CROSS-LINK, DNA DODECAMER WITH INTERSTRAND CROSS-LINK DNA CROTONALDEHYDE INTERSTRAND DNA CROSS-LINK
2hmr	nuc      NMR    	2'-DEOXY-N-ETHYLGUANOSINE 5'-PHOSPHATE 2(C12 H18 N5 O7 P)	SOLUTION STRUCTURE OF REDUCED INTERSTRAND CROSS-LINK ARISING FROM S-ALPHA-METHYL-GAMMA-OH-1,N2-PROPANO-2'- DEOXYGUANOSINE IN THE 5'-CPG-3' DNA SEQUENCE DNA DODECAMER WITH INTERSTRAND CROSS-LINK, DNA DODECAMER WITH INTERSTRAND CROSS-LINK DNA CROTONALDEHYDE INTERSTRAND DNA CROSS-LINK

2FJ    TETRAKIS(2,2'-BIPYRIDINE-KAPPA~2~N~1~,N~1'~)(MU- TETRAPYRIDO[3,2-A:2',3'-C:3'',2''-H:2''',3'''- J]PHENAZINE-1KAPPA~2~N~4~,N~5~:2KAPPA~2~N~13~,N~14~) DIRUTHENIUM(4+) L ENANTIOMER

Code	Class Resolution	Description
2mco	nuc      NMR    	TETRAKIS(2,2'-BIPYRIDINE-KAPPA~2~N~1~,N~1'~)(MU- TETRAPYRIDO[3,2-A:2',3'-C:3'',2''-H:2''',3'''- J]PHENAZINE-1KAPPA~2~N~4~,N~5~:2KAPPA~2~N~13~,N~14~) DIRUTHENIUM(4+) L ENANTIOMER C64 H44 N14 RU2 4+	STRUCTURAL STUDIES ON DINUCLEAR RUTHENIUM(II) COMPLEXES THAT DIASTEREOSELECTIVELY TO AN ANTI-PARALLEL FOLDED HUMAN TELOM SEQUENCE HUMAN TELOMERE QUADRUPLEX DNA DNA, QUADRUPLEX, COMPLEX, RUTHENIUM

2GF    [(2R,5R)-5-(4-AMINO-5-CHLORO-2-OXOPYRIMIDIN-1(2H)-YL)- 3-OXOTETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
4mgw	nuc      1.93	[(2R,5R)-5-(4-AMINO-5-CHLORO-2-OXOPYRIMIDIN-1(2H)-YL)- 3-OXOTETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHATE 2(C9 H11 CL N3 O7 P)	COMPARISON OF THE STRUCTURAL AND DYNAMIC EFFECTS OF 5-METHYL AND 5-CHLOROCYTOSINE IN A CPG DINUCLEOTIDE SEQUENCE CLC CONTAINING DICKERSON-DREW DODECAMER DNA DNA DODECAMER, STRUCTURAL STUDY OF DNA, DNA

2GL    4-O-ACETYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE

Code	Class Resolution	Description
1ekh	nuc      NMR    	4-O-ACETYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE 2(C8 H14 O5)	NMR STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND CO DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1eki	nuc      NMR    	4-O-ACETYL-2,6-DIDEOXY-ALPHA-D-GALACTO-HEXOPYRANOSE 2(C8 H14 O5)	AVERAGE SOLUTION STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMY COBALT DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA

2GT    2'-O-PROPARGYL THYMIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1y9s	nuc      1.55	2'-O-PROPARGYL THYMIDINE-5'-MONOPHOSPHATE 2(C13 H17 N2 O9 P)	CRYSTAL STRUCTURE OF THE A-DNA GCGTAT*CGC WITH A 2'-O- PROPARGYL THYMIDINE (T*) 5'-D(*GP*CP*GP*TP*AP*(2GT)P*AP*CP*GP*C)-3') DNA A-DNA DECAMER, O2'-MODIFICATION

2HP    DIHYDROGENPHOSPHATE ION

Code	Class Resolution	Description
2h0n	nuc      1.53	DIHYDROGENPHOSPHATE ION 2(H2 O4 P 1-)	STRUCTURE OF THE FULLY MODIFIED LEFT-HANDED CYCLOHEXENE NUCLEIC ACID SEQUENCE GTGTACAC 5'-(*(XGL)P*(XTL)P*(XGL)P*(XTL)P*(XAL)P*(XCL) P*(XAL)P*(XCL)-PHOSPHATE)-3' DNA CYCLOHEXENE NUCLEIC ACID, DNA ANALOGUE, LEFT-HANDED, DOUBLE HELIX

2J0    (10-METHYLDIPYRIDO[3,2-A:2',3'-C]PHENAZINE- KAPPA~2~N~4~,N~5~)[BIS(PYRAZINO[2,3-F]QUINOXALINE- KAPPA~2~N~1~,N~10~)]RUTHENIUM(2+)

Code	Class Resolution	Description
4mj9	nuc      0.97	(10-METHYLDIPYRIDO[3,2-A:2',3'-C]PHENAZINE- KAPPA~2~N~4~,N~5~)[BIS(PYRAZINO[2,3-F]QUINOXALINE- KAPPA~2~N~1~,N~10~)]RUTHENIUM(2+) C39 H24 N12 RU 2+	LAMBDA-[RU(TAP)2(DPPZ-10-ME)]2+ BOUND TO A SYNTHETIC DNA OLI DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA METHYL-SUBSTITUTED, INTERCALATION, RUTHENIUM, ASYMMETRIC SUBSTITUTION, DNA

2L8    [(2R,3S,5R)-3-[(1-{[(2R,3S,5R)-3-HYDROXY-5-(5-METHYL-2, 4-DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL)TETRAHYDROFURAN- 2-YL]METHYL}-1H-1,2,3-TRIAZOL-4-YL)METHOXY]-5-(5- METHYL-2,4-DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL) TETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHA

Code	Class Resolution	Description
2l8i	nuc      NMR    	[(2R,3S,5R)-3-[(1-{[(2R,3S,5R)-3-HYDROXY-5-(5-METHYL-2, 4-DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL)TETRAHYDROFURAN- 2-YL]METHYL}-1H-1,2,3-TRIAZOL-4-YL)METHOXY]-5-(5- METHYL-2,4-DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL) TETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHA C23 H30 N7 O12 P	A BIOCOMPATIBLE BACKBONE MODIFICATION? - STRUCTURE AND DYNAM TRIAZOLE-LINKED DNA DUPLEX DNA (5'-D(*CP*GP*AP*CP*G*(2L8)P*TP*GP*CP*AP*GP*C) CHAIN: B, DNA (5'-D(*GP*CP*TP*GP*CP*AP*AP*AP*CP*GP*TP*CP*G) CHAIN: A DNA DNA

2LA    2-AMINO-5-(AMINOMETHYL)-7-(2-DEOXY-5-O-PHOSPHONO-BETA- D-ERYTHRO-PENTOFURANOSYL)-3,7-DIHYDRO-4H-PYRROLO[2,3- D]PYRIMIDIN-4-ONE

Code	Class Resolution	Description
2lia	nuc      NMR    	2-AMINO-5-(AMINOMETHYL)-7-(2-DEOXY-5-O-PHOSPHONO-BETA- D-ERYTHRO-PENTOFURANOSYL)-3,7-DIHYDRO-4H-PYRROLO[2,3- D]PYRIMIDIN-4-ONE 2(C12 H18 N5 O7 P)	SOLUTION NMR STRUCTURE OF A DNA DODECAMER CONTAINING THE 7- AMINOMETHYL-7-DEAZA-2'-DEOXYGUANOSINE ADDUCT DNA (5'-D(*GP*AP*GP*AP*(2LA)P*CP*GP*CP*TP*CP*TP*C CHAIN: A, B DNA DNA

2LE    (2R,5S)-5-PENTYLTETRAHYDROFURAN-2-OL

Code	Class Resolution	Description
2lg2	nuc      NMR    	(2R,5S)-5-PENTYLTETRAHYDROFURAN-2-OL C9 H18 O2	STRUCTURE OF THE DUPLEX CONTAINING HNE DERIVED (6S,8R,11S) N CYCLIC HEMIACETAL WHEN PLACED OPPOSITE DT DNA (5'-D(*GP*CP*TP*AP*GP*CP*GP*AP*GP*TP*CP*C)-3' CHAIN: A, DNA (5'-D(*GP*GP*AP*CP*TP*TP*GP*CP*TP*AP*GP*C)-3' CHAIN: B DNA TRANS-4-HYDROXYNONENAL, N2-DG CYCLIC HEMIACETAL, DNA

2LF    (6S,7S,8S,10R)-2-AMINO-8-HYDROXY-4-OXO-3,6,7,8,9,10- HEXAHYDRO-4H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
2lfa	nuc      NMR    	(6S,7S,8S,10R)-2-AMINO-8-HYDROXY-4-OXO-3,6,7,8,9,10- HEXAHYDRO-4H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O7 P	OLIGONUCLEOTIDE DUPLEX CONTANING (5'S)-8,5'-CYCLO-2'-DEOXYGU DNA (5'-D(*AP*CP*AP*AP*AP*CP*AP*CP*GP*CP*AP*C)-3' CHAIN: B, DNA (5'-D(*GP*TP*GP*CP*(2LF)P*TP*GP*TP*TP*TP*GP*T CHAIN: A DNA (5'S)-8,5'-CYCLO-2'-DEOXYGUANOSINE, CYCLOPURINE, CYCLO-DG, D
2lfx	nuc      NMR    	(6S,7S,8S,10R)-2-AMINO-8-HYDROXY-4-OXO-3,6,7,8,9,10- HEXAHYDRO-4H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O7 P	STRUCTURE OF THE DUPLEX WHEN (5'S)-8,5'-CYCLO-2'-DEOXYGUANOS PLACED OPPOSITE DT DNA (5'-D(*GP*TP*GP*CP*(2LF)P*TP*GP*TP*TP*TP*GP*T CHAIN: A, DNA (5'-D(*AP*CP*AP*AP*AP*CP*AP*TP*GP*CP*AP*C)-3' CHAIN: B DNA (5'S)-8,5'-CYCLO-2'-DEOXYGUANOSINE, CYCLOPURINE, CYCLO-DG, D
2lfy	nuc      NMR    	(6S,7S,8S,10R)-2-AMINO-8-HYDROXY-4-OXO-3,6,7,8,9,10- HEXAHYDRO-4H-7,10-EPOXYAZEPINO[1,2-E]PURIN-6-YL DIHYDROGEN PHOSPHATE C10 H12 N5 O7 P	STRUCTURE OF THE DUPLEX WHEN (5'S)-8,5'-CYCLO-2'-DEOXYGUANOS PLACED OPPOSITE DA DNA (5'-D(*GP*TP*GP*CP*(2LF)P*TP*GP*TP*TP*TP*GP*T CHAIN: A, DNA (5'-D(*AP*CP*AP*AP*AP*CP*AP*AP*GP*CP*AP*C)-3' CHAIN: B DNA (5'S)-8,5'-CYCLO-2'-DEOXYGUANOSINE, CYCLOPURINE, CYCLO-DG, D

2MG    2N-METHYLGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1ehz	nuc      1.93	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	THE CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRNA AT 1.93 A TRANSFER RNA (PHE) RNA TRNA, YEAST, PHENYLALANINE, RNA
1evv	nuc      2.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRANSFER RNA AT 2.0 RESOLUTION PHENYLALANINE TRANSFER RNA RNA TRANSFER RNA, PHENYLALANINE, PHE-TRNA, YEAST, AMINO-ACID TRA RNA
1fcw	nuc      17.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 5(C11 H16 N5 O8 P)	TRNA POSITIONS DURING THE ELONGATION CYCLE TRNAPHE RIBOSOME RIBOSOME, TRNA BINDING SITES, PROTEIN SYNTHESIS, ELONGATION
1fir	nuc      3.30	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) RNA MAMMALIAN TRANSFERT RIBONUCLEIC ACID, HIV-1 PRIMER TRNA, AMI TRANSPORT, CANONICAL TRNA STRUCTURE, CANONICAL ANTICODON, FRAMESHIFTING, CODON/ANTICODON MIMICRY, MODIFIED BASES, RNA
1ipl	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3' RIBONUCLEIC ACID TRANSLOCATION, LARGE RIBOSOMAL RNA, SMALL RIBOSOMAL RNA, TRNA, MRNA
1k7n	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 2) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7o	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 3) P-SITE TRNA, A-SITE TRNA, MRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7p	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 4) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7r	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 1) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1ks1	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	A MODEL FOR A FIVE-PRIME STACKED TRNA PHENYLALANINE TRANSFER RNA RIBONUCLEIC ACID FIVE-PRIME STACK, TRNA
1nrt	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 3(C11 H16 N5 O8 P)	APE-SITE TRNA, THEORETICAL MODEL TRANSFER RIBONUCLEIC ACID AMINO-ACID TRANSPORT AMINO-ACID TRANSPORT, TRNA, MODEL
1q49	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1q5s	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxu	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxv	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rcz	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd0	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B2) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd1	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C2) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd2	nuc      model  	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1tn1	nuc      3.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE TRNA TRNAPHE RNA TRANSLATION, RNA
1tn2	nuc      3.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE T-RNA TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1tra	nuc      3.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	RESTRAINED REFINEMENT OF THE MONOCLINIC FORM OF YEAST PHENYL TRANSFER RNA. TEMPERATURE FACTORS AND DYNAMICS, COORDINATED AND BASE-PAIR PROPELLER TWIST ANGLES TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1wts	nuc      NMR    	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	HELIX 45 (16S RRNA) FROM B. STEAROTHERMOPHILUS, NMR, MINIMIZED AVERAGE STRUCTURE RNA (5'- R(*GP*GP*AP*CP*CP*2MGP*GP*MA6P*MA6P*GP*GP*UP*CP*C)-3'): HELIX 45 STEM-LOOP RNA RIBONUCLEIC ACID, RIBOSOME, RNA, 16S, MODIFIED NUCLEOTIDES, TETRALOOP
1wtt	nuc      NMR    	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	HELIX 45 (16S RRNA) FROM B. STEAROTHERMOPHILUS, NMR, 11 STRUCTURES RNA (5'- R(*GP*GP*AP*CP*CP*2MGP*GP*MA6P*MA6P*GP*GP*UP*CP*C)-3'): HELIX 45 STEM-LOOP RNA RIBONUCLEIC ACID, RIBOSOME, RNA, 16S, MODIFIED NUCLEOTIDES, TETRALOOP
1yfg	nuc      3.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	YEAST INITIATOR TRNA YEAST INITIATOR TRNA T-RNA AMINO ACID TRANSPORT, TRANSFER RIBONUCLEIC ACID, T-RNA
2z9q	nuc      11.70	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	TRANSFER RNA IN THE HYBRID P/E STATE TRNA RNA DISTORTED ANTICODON-STEM-LOOP, TWISTED CCA ARM, RNA
486d	nuc      7.50	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	X-RAY CRYSTAL STRUCTURES OF 70S RIBOSOME FUNCTIONAL COMPLEXE E-SITE TRNA OF 70S RIBOSOME, A-SITE TRNA OF 70S RIBOSOME, P-SITE CODON OF 70S RIBOSOME, P-SITE TRNA OF 70S RIBOSOME, A-SITE CODON OF 70S RIBOSOME, 900 STEM-LOOP OF 16S RRNA IN THE 70S RIBOSOME, PENULTIMATE STEM OF 16S RRNA IN THE 70S RIBOSOME RIBOSOME FUNCTIONAL MODELS OF 70S RIBOSOME, TRNA, RIBOSOME
4tna	nuc      2.50	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	FURTHER REFINEMENT OF THE STRUCTURE OF YEAST T-RNA-PHE TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
4tra	nuc      3.00	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPA AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
6tna	nuc      2.70	2N-METHYLGUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O8 P	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE T-RNA. I.CRYSTALLOG REFINEMENT TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS

2MU    2',5-DIMETHYLURIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1fir	nuc      3.30	2',5-DIMETHYLURIDINE-5'-MONOPHOSPHATE C11 H17 N2 O9 P	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) RNA MAMMALIAN TRANSFERT RIBONUCLEIC ACID, HIV-1 PRIMER TRNA, AMI TRANSPORT, CANONICAL TRNA STRUCTURE, CANONICAL ANTICODON, FRAMESHIFTING, CODON/ANTICODON MIMICRY, MODIFIED BASES, RNA
1pwf	nuc      1.16	2',5-DIMETHYLURIDINE-5'-MONOPHOSPHATE 2(C11 H17 N2 O9 P)	ONE SUGAR PUCKER FITS ALL: PAIRING VERSATILITY DESPITE CONFORMATIONAL UNIFORMITY IN TNA 5'-D(*GP*CP*GP*TP*AP*(2MU)P*(FA2)P*CP*GP*C)-3' DNA A-DNA, HYDROGEN BONDING, NUCLEIC ACID ETIOLOGY, TETROSE, FOUR CARBON SUGAR, X-RAY CRYSTALLOGRAPHY, NUCLEIC ACID ANALOGUE

2NT    2'-O-[2-[HYDROXY(METHYLENEAMINO)OXY]ETHYL THYMIDINE- 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1y7f	nuc      1.60	2'-O-[2-[HYDROXY(METHYLENEAMINO)OXY]ETHYL THYMIDINE- 5'-MONOPHOSPHATE 2(C13 H22 N3 O11 P)	CRYSTAL STRUCTURE OF THE A-DNA GCGTAT*CGC WITH A 2'-O-[2- [HYDROXY(METHYLENEAMINO)OXY]ETHYL] THYMIDINE (T*) 5'-D(*GP*CP*GP*TP*AP*(2NT)P*AP*CP*GP*C)-3') DNA A-DNA, MODIFIED

2OP    (2S)-2-HYDROXYPROPANOIC ACID

Code	Class Resolution	Description
5ihd	nuc      1.57	(2S)-2-HYDROXYPROPANOIC ACID 2(C3 H6 O3)	CALCIUM(II) AND COPPER(II) BOUND TO THE Z-DNA FORM OF D(CGCG COMPLEXED BY L-LACTATE AND SUCCINATE DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, COPPER(II), DNA

2OT    2'-O-[2-(N,N-DIMETHYLAMINOOXY)ETHYL] THYMIDINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
1yb9	nuc      1.65	2'-O-[2-(N,N-DIMETHYLAMINOOXY)ETHYL] THYMIDINE-5'- MONOPHOSPHATE 2(C14 H24 N3 O10 P)	CRYSTAL STRUCTURE OF THE A-DNA GCGTAT*CGC WITH A 2'-O-[2-(N, N-DIMETHYLAMINOOXY)ETHYL] THYMIDINE (T*) 5'-D(*GP*CP*GP*TP*AP*(2OT)P*AP*CP*GP*C)-3') DNA CRYSTAL STRUCTURE, A-DNA, O2'-MODIFICATION, DECAMER

2PR    2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
2kv0	nuc      NMR    	2-AMINO-9-[2-DEOXYRIBOFURANOSYL]-9H-PURINE-5'- MONOPHOSPHATE C10 H14 N5 O6 P	2-AMINOPURINE INCORPORATION PERTURBS THE DYNAMICS AND STRUCT DNA (5'-D(*CP*GP*AP*CP*GP*TP*TP*TP*GP*CP*AP*GP*C) CHAIN: B, DNA (5'-D(*GP*CP*TP*GP*CP*AP*(2PR)P*AP*CP*GP*TP*C CHAIN: A DNA DNA, 2-AMINOPURINE, FLUOROPHORE, STRUCTURE PERTURBATION

2PT    1-[2-(ACRIDIN-9-YLAMINO)ETHYL]-1,3-DIMETHYLTHIOUREA- PLATINUM(II)-ETHANE-1,2-DIAMINE

Code	Class Resolution	Description
1xrw	nuc      NMR    	1-[2-(ACRIDIN-9-YLAMINO)ETHYL]-1,3-DIMETHYLTHIOUREA- PLATINUM(II)-ETHANE-1,2-DIAMINE C20 H29 N6 PT S 3+	SOLUTION STRUCTURE OF A PLATINUM-ACRIDINE MODIFIED OCTAMER 5'-D(*CP*CP*TP*CP*GP*TP*CP*C)-3', 5'-D(*GP*GP*AP*CP*GP*AP*GP*G)-3' DNA PLATINUM, ACRIDINE, DUAL BINDING MODE, MAJOR GROOVE, UNWINDI

2QB    5-(AZIDOMETHYL)-2-METHYLPYRIMIDIN-4-AMINE

Code	Class Resolution	Description
4nya	nuc      2.65	5-(AZIDOMETHYL)-2-METHYLPYRIMIDIN-4-AMINE 2(C6 H8 N6)	CRYSTAL STRUCTURE OF THE E. COLI THIM RIBOSWITCH IN COMPLEX (AZIDOMETHYL)-2-METHYLPYRIMIDIN-4-AMINE THIM TPP RIBOSWITCH RNA FRAGMENT-BASED DRUG DISCOVERY, RIBOSWITCH, RNA

2QC    1-[4-(1,2,3-THIADIAZOL-4-YL)PHENYL]METHANAMINE

Code	Class Resolution	Description
4nyb	nuc      3.10	1-[4-(1,2,3-THIADIAZOL-4-YL)PHENYL]METHANAMINE C9 H9 N3 S	CRYSTAL STRUCTURE OF THE E. COLI THIM RIBOSWITCH IN COMPLEX (1,2,3-THIADIAZOL-4-YL)PHENYL)METHANAMINE THIM TPP RIBOSWITCH RNA FRAGMENT-BASED DRUG DISCOVERY, RIBOSWITCH, RNA

2QL    (11R,12R,13R)-11,12,13,14-TETRAHYDRONAPHTHO[1,2,3,4- PQR]TETRAPHENE-11,12,13-TRIOL

Code	Class Resolution	Description
2miv	nuc      NMR    	(11R,12R,13R)-11,12,13,14-TETRAHYDRONAPHTHO[1,2,3,4- PQR]TETRAPHENE-11,12,13-TRIOL C24 H18 O3	NMR STUDIES OF N2-GUANINE ADDUCTS DERIVED FROM THE TUMORIGEN DIBENZO[A,L]PYRENE IN DNA: IMPACT OF ADDUCT STEREOCHEMISTRY AND LOCAL DNA STRUCTURE ON SOLUTION CONFORMATIONS DNA_(5'-D(*GP*GP*TP*AP*GP*GP*AP*TP*GP*G)-3'), DNA_(5'-D(*CP*CP*AP*TP*CP*GP*CP*TP*AP*CP*C)-3') DNA DNA, 14S(-)-TRANS-ANTI-DB[A,L]P-N2-DG, DNA ADDUCT
2miw	nuc      NMR    	(11R,12R,13R)-11,12,13,14-TETRAHYDRONAPHTHO[1,2,3,4- PQR]TETRAPHENE-11,12,13-TRIOL C24 H18 O3	NUCLEAR MAGNETIC RESONANCE STUDIES OF N2-GUANINE ADDUCTS DER THE TUMORIGEN DIBENZO[A,L]PYRENE IN DNA: IMPACT OF ADDUCT STEREOCHEMISTRY, SIZE, AND LOCAL DNA STRUCTURE ON SOLUTION CONFORMATIONS DNA_(5'-D(*GP*GP*TP*AP*GP*CP*GP*AP*TP*GP*G)-3'), DNA_(5'-D(*CP*CP*AP*TP*CP*GP*CP*TP*AP*CP*C)-3') DNA DNA, 14S (-)-TRANS-ANTI-DB[A,L]P-N2-DG, DNA ADDUCT

2SB   

Code	Class Resolution	Description
2irk	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO BIS[5-(2-AMIDINO)-2-BENZIMIDAZOLYL]METHANE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

2SG    GUANOSINE PHOSPHORODITHIOATE

Code	Class Resolution	Description
4rby	nuc      1.19	GUANOSINE PHOSPHORODITHIOATE C10 H16 N5 O6 P S2	FIRST X-RAY STRUCTURE OF RNA CONTAINING GUANOSINE PHOSPHOROD 5'-R(*CP*GP*CP*(2SG)P*AP*AP*UP*UP*AP*GP*CP*G)-3' RNA PHOSPHORODITHIOATE RNA, GUANOSINE PHOSPHORODITHIOATE, PHOSPHOROTHIOATE, GUANOSINE ANALOGUE, HYDROPHOBIC, BACKBONE
4rc0	nuc      1.13	GUANOSINE PHOSPHORODITHIOATE C10 H16 N5 O6 P S2	X-RAY STRUCTURE OF RNA CONTAINING GUANOSINE PHOSPHORODITHIOA 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*(A2M)P*(2SG)P*CP*G) CHAIN: A RNA PHOSPHORODITHIOATE RNA, GUANOSINE PHOSPHORODITHIOATE, PHOSPHOROTHIOATE, GUANOSINE ANALOGUE, HYDROPHOBIC, BACKBONE
5do5	nuc      1.20	GUANOSINE PHOSPHORODITHIOATE C10 H16 N5 O6 P S2	CRYSTAL STRUCTURE OF 2'-FLUORO-RNA BEARING A PHOSPHORODITHIO RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*(AF2)P*(2SG)P* CHAIN: A RNA RNA, 2'-FLUORO-RNA, PHOSPHORODITHIOATE RNA, PS2-RNA

2ST    5-METHYL-2'-SE-METHYL-2'-SELENOURIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2hc7	nuc      1.40	5-METHYL-2'-SE-METHYL-2'-SELENOURIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H17 N2 O8 P SE	2'-SELENIUM-T A-DNA [G(TSE)GTACAC] 5'-D(*GP*(2ST)P*GP*TP*AP*CP*AP*C)-3' DNA SE-DNA, 2'-SE-T-DNA
4fp6	nuc      1.28	5-METHYL-2'-SE-METHYL-2'-SELENOURIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H17 N2 O8 P SE	DNA OCTAMER D(GTGGCCAC) WITH 2'-SE MODIFICATION DNA (5'-D(*GP*(2ST)P*GP*GP*CP*CP*AP*C)-3') DNA 2'-SE-THYMIDINE DNA, DNA
4h5a	nuc      1.42	5-METHYL-2'-SE-METHYL-2'-SELENOURIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H17 N2 O8 P SE	DNA OCTAMER D (GTSEGTACAC) PARTIALLY CROSSLINKED WITH PLATIN DNA (5'-D(*GP*(2ST)P*GP*GP*CP*CP*AP*C)-3') DNA SELENIUM MODIFICATION TO FACILITATE CRYSTALLIZATION, DNA
4i1g	nuc      1.25	5-METHYL-2'-SE-METHYL-2'-SELENOURIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H17 N2 O8 P SE	DNA OCTAMER D(GTSEGTACAC) PARTIALLY CROSSLINKED WITH TWO PLA DNA (5'-D(*GP*(2ST)P*GP*GP*CP*CP*AP*C)-3') DNA PLATINUM CROSSLINK, SELENIUM, DNA

2TB    1,3-DIAMINO-4,5,6-TRIHYDROXY-CYCLOHEXANE

Code	Class Resolution	Description
2tob	nuc      NMR    	1,3-DIAMINO-4,5,6-TRIHYDROXY-CYCLOHEXANE C6 H16 N2 O3 2+	SOLUTION STRUCTURE OF THE TOBRAMYCIN-RNA APTAMER COMPLEX, NMR, 13 STRUCTURES RNA (5'- R(*AP*CP*UP*UP*GP*GP*UP*UP*UP*AP*GP*GP*UP*AP*AP*UP*GP*AP*GP *U)-3') RNA AMINOGLYCOSIDE-RNA RECOGNITION, TOBRAMYCIN

38E    (5Z)-5-(3,5-DIFLUORO-4-HYDROXYBENZYLIDENE)-2,3- DIMETHYL-3,5-DIHYDRO-4H-IMIDAZOL-4-ONE

Code	Class Resolution	Description
4ts0	nuc      2.80	(5Z)-5-(3,5-DIFLUORO-4-HYDROXYBENZYLIDENE)-2,3- DIMETHYL-3,5-DIHYDRO-4H-IMIDAZOL-4-ONE C12 H10 F2 N2 O2	CRYSTAL STRUCTURE OF THE SPINACH RNA APTAMER IN COMPLEX WITH BARIUM IONS SPINACH RNA APTAMER, BIMOLECULAR CONSTRUCT, SPINACH RNA APTAMER, BIMOLECULAR CONSTRUCT RNA APTAMER, FLUORESCENCE, G-QUADRUPLEX, RNA
4ts2	nuc      2.88	(5Z)-5-(3,5-DIFLUORO-4-HYDROXYBENZYLIDENE)-2,3- DIMETHYL-3,5-DIHYDRO-4H-IMIDAZOL-4-ONE C12 H10 F2 N2 O2	CRYSTAL STRUCTURE OF THE SPINACH RNA APTAMER IN COMPLEX WITH MAGNESIUM IONS SPINACH APTAMER RNA, BIMOLECULAR CONSTRUCT, SPINACH APTAMER RNA, BIMOLECULAR CONSTRUCT RNA APTAMER, FLUORESCENCE, G-QUADRUPLEX, RNA

3AD    3'-DEOXYADENOSINE

Code	Class Resolution	Description
3b4b	nuc      2.70	3'-DEOXYADENOSINE C10 H13 N5 O3	T. TENGCONGENSIS GLMS RIBOZYME WITH G40A MUTATION, BOUND TO GLUCOSAMINE-6-PHOSPHATE AND A SUBSTRATE RNA WITH A 2'5'- PHOSPHODIESTER LINKAGE GLMS RIBOZYME SUBSTRATE WITH 2'5'-PHOSPHODIESTER LINKAGE, GLMS RIBOZYME RNA RNA RIBOZYME, RIBOSWITCH, GLUCOSAMINE-6-PHOSPHATE, RNA
3b4c	nuc      3.00	3'-DEOXYADENOSINE C10 H13 N5 O3	T. TENGCONGENSIS GLMS RIBOZYME BOUND TO GLUCOSAMINE-6- PHOSPHATE AND A SUBSTRATE RNA WITH A 2'5'-PHOSPHODIESTER LINKAGE GLMS RIBOZYME SUBSTRATE WITH A 2'5'- PHOSPHODIESTER LINKAGE, GLMS RIBOZYME RNA RNA RIBOZYME, RIBOSWITCH, GLUCOSAMINE-6-PHOSPHATE, RNA

3AF    2,5-BIS{[4-(2-PENTYL)DIAMINOMETHYL]PHENYL}FURAN

Code	Class Resolution	Description
2gxe	nuc      model  	2,5-BIS{[4-(2-PENTYL)DIAMINOMETHYL]PHENYL}FURAN C28 H40 N4 O	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 2,5-BIS{[4-(2-PENTYL)DIAMINOMETHYL]PHENYL}FURAN. DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, FURAN DERIVATIVE

3AW    6-METHYL-1,3,5-TRIAZINE-2,4-DIAMINE

Code	Class Resolution	Description
2xnz	nuc      1.59	6-METHYL-1,3,5-TRIAZINE-2,4-DIAMINE C4 H7 N5	XPT-PBUX C74U RIBOSWITCH FROM B. SUBTILIS BOUND TO ACETOGUAN IDENTIFIED BY VIRTUAL SCREENING GUANINE RIBOSWITCH: APTAMER DOMAIN, RESIDUES 15-81 RNA RNA, APTAMER, RNA-LIGAND COMPLEX, MRNA

3AY    PYRIMIDINE-2,4,6-TRIAMINE

Code	Class Resolution	Description
2g9c	nuc      1.70	PYRIMIDINE-2,4,6-TRIAMINE C4 H7 N5	MODIFIED PYRIMIDINES SPECIFICALLY BIND THE PURINE RIBOSWITCH GUANINE RIBOSWITCH RNA MRNA, RIBOSWITCH, TRIAMINOPYRIMIDINE, RNA-LIGAND COMPLEX

3B5    AIK-18/51

Code	Class Resolution	Description
2mne	nuc      NMR    	AIK-18/51 2(C30 H38 N9 O4 S 1+)	RECOGNITION COMPLEX OF DNA D(CGACTAGTCG)2 WITH THIAZOTROPSIN AIK-18/51 5'-D(*CP*GP*AP*CP*TP*AP*GP*TP*CP*G)-3' DNA THIAZOTROPSINS, DNA RECOGNITION, ISOTHERMAL TITRATION CALORI NMR, SELF-ASSEMBLY, MINOR GROOVE BINDER, DNA

3BF    THIAZOTROPSIN B

Code	Class Resolution	Description
2mnd	nuc      NMR    	THIAZOTROPSIN B 2(C25 H36 N9 O4 S 1+)	RECOGNITION COMPLEX OF DNA D(CGACGCGTCG)2 WITH THIAZOTROPSIN 5'-D(*CP*GP*AP*CP*GP*CP*GP*TP*CP*G)-3' DNA THIAZOTROPSINS, DNA RECOGNITION, ISOTHERMAL TITRATION CALORI NMR, SELF-ASSEMBLY, MINOR GROOVE BINDER, DNA

3CO    COBALT (III) ION

Code	Class Resolution	Description
1eg6	nuc      2.00	COBALT (III) ION 2(CO 3+)	CRYSTAL STRUCTURE ANALYSIS OF D(CG(5-BRU)ACG) COMPLEXES TO A PHENAZINE 5'-D(*CP*GP*(BRO)UP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, INTERCALATION, MAJOR GROOVE BINDING, DOUBLE HELIX
1g5l	nuc      NMR    	COBALT (III) ION CO 3+	CO(III)-BLEOMYCIN-OOH BOUND TO AN OLIGONUCLEOTIDE CONTAINING A PHOSPHOGLYCOLATE LESION 5'-D(*CP*CP*CP*AP*GP*TP*AP*CP*TP*TP*TP*GP*G)-3', 5'-D(P*AP*CP*TP*GP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*G)-3' DNA DAMAGED DNA, DNA-DRUG COMPLEX, INTERCALATION
1gj2	nuc      NMR    	COBALT (III) ION CO 3+	CO(III)-BLEOMYCIN-OOH BOUND TO AN OLIGONUCLEOTIDE CONTAINING A PHOSPHOGLYCOLATE LESION 5'-D(*CP*CP*CP*AP*GP*TP*AP*CP*TP*TP*TP*GP*G)-3', 5'-D(P*AP*CP*TP*GP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*G)-3' DNA DAMAGED DNA, DNA-DRUG COMPLEX, INTERCALATION
1mtg	nuc      NMR    	COBALT (III) ION CO 3+	NMR STRUCTURE OF HO2-CO(III)BLEOMYCIN A(2) BOUND TO D(GAGCTC 5'-D(*GP*AP*GP*CP*TP*C)-3' DNA DRUG-DNA COMPLEX, COBALT(III), DNA
1mxk	nuc      NMR    	COBALT (III) ION CO 3+	NMR STRUCTURE OF HO2-CO(III)BLEOMYCIN A(2) BOUND TO D(GGAAGCTTCC)(2) 5'-D(*GP*GP*AP*AP*GP*CP*TP*TP*CP*C)-3' DNA DRUG-DNA COMPLEX, COBALT(III)
1y6t	nuc      2.60	COBALT (III) ION 5(CO 3+)	HIV-1 DIS(MAL) DUPLEX CO HEXAMINE-SOAKED 5'- R(*CP*UP*UP*GP*CP*UP*GP*AP*GP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP *CP*AP*AP*G)-3' RNA HIV-1, RNA, METAL IONS
2gun	nuc      2.80	COBALT (III) ION 2(CO 3+)	RNA-BINDING AFFINITIES AND CRYSTAL STRUCTURE OF OLIGONUCLEOTIDES CONTAINING FIVE-ATOM AMIDE-BASED BACKBONE STRUCTURES 5'-D(*TP*TP*CP*(T2T)P*(CBR)P*TP*TP*C)-3', 5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3' DNA/RNA DNA:RNA HYBRID, AMIDE BEARING DNA, THYMIDINE DIMERS, INTERNUCLEOSIDIC AMIDE LINKAGE, DNA, RNA, DNA/RNA COMPLEX
4f2x	nuc      1.57	COBALT (III) ION 6(CO 3+)	STRUCTURE OF 3'-FLUORO CYCLOHEXENYL NUCLEIC ACID HEPTAMER 5'-D(*CP*GP*CP*AP*CP*GP*C)-3', 5'-D(*GP*CP*GP*(XTF)P*GP*CP*G)-3' DNA FLUORO CYCLOHEXENYL NUCLEIC ACID, F-CENA, MODIFIED DNA, B-FO DNA
5mvt	nuc      1.90	COBALT (III) ION CO 3+	CRYSTAL STRUCTURE OF AN A-DNA DODECAMER FEATURING AN ALTERNA PYRIMIDINE-PURINE SEQUENCE DNA DNA A-DNA, UNMODIFIED, SELF-COMPLEMENTARY, DNA

3DA    3'-DEOXYADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2p7f	nuc      2.35	3'-DEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O6 P	THE NOVEL USE OF A 2',5'-PHOSPHODIESTER LINKAGE AS A REACTION INTERMEDIATE AT THE ACTIVE SITE OF A SMALL RIBOZYME SUBSTRATE STRAND, LOOP B S-TURN STRAND, LOOP B RIBOZYME STRAND, LOOP A RIBOZYME STRAND RNA HAIRPIN RIBOZYME; 2',5' PHOSPHODIESTER; VANADATE; REACTION INTERMEDIATE; TRANSITION-STATE STABILIZATION; ACTIVE SITE WATERS; INDUCED FIT, RNA
4g6r	nuc      2.83	3'-DEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O6 P	MINIMAL HAIRPIN RIBOZYME IN THE TRANSITION STATE WITH G8I VA LOOP B S-TURN STRAND, LOOP A SUBSTRATE STRAND, LOOP A RIBOZYME STRAND, LOOP B RIBOZYME STRAND RNA RNA, STRUCTURE-ACTIVITY RELATIONSHIP, NUCLEIC ACID CONFORMAT
4g6s	nuc      2.84	3'-DEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O6 P	MINIMAL HAIRPIN RIBOZYME IN THE TRANSITION STATE WITH A38P V LOOP A SUBSTRATE STRAND, LOOP A AND LOOP B RIBOZYME STRAND, LOOP B OF THE RIBOZYME STRAND RNA RNA, STRUCTURE-ACTIVITY RELATIONSHIP, NUCLEIC ACID CONFORMAT

3DR    1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE

Code	Class Resolution	Description
1fzl	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	DNA WITH PYRENE PAIRED AT ABASIC SITES 5'-D(*GP*TP*GP*CP*(3DR)P*TP*GP*TP*TP*TP*GP*TP*G)- 3', 5'-D(*CP*AP*CP*AP*AP*AP*CP*AP*(PYP)P*GP*CP*AP*C)- 3' DNA PYRENE, TETRAHYDROFURAN, NON-HYDROGEN BONDED DNA BASE PAIR
1fzs	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	DNA WITH PYRENE PAIRED AT ABASIC SITE 5'-D(*GP*TP*GP*CP*(3DR)P*TP*GP*TP*TP*TP*GP*TP*G)- 3', 5'-D(*CP*AP*CP*AP*AP*AP*CP*AP*(PYP))-3' DNA PYRENE, FURAN, NON-POLAR DNA PAIR
1ht4	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	SOLUTION STRUCTURE OF A BISTRAND ABASIC SITE LESION STAGGERED IN A 3'-ORIENTATION. 5'-D(*CP*GP*CP*AP*TP*GP*(3DR)P*GP*TP*AP*CP*GP*C)- 3', 5'-D(*GP*CP*GP*TP*AP*CP*AP*(3DR)P*AP*TP*GP*CP*G)- 3' DNA DOUBLE HELIX, ABASIC SITES, CLUSTERED LESIONS, DNA
1ht7	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	STRUCTURE OF A DNA DUPLEX CONTAINING A BISTRAND ABASIC SITE LESION STAGGERED IN A 5'-ORIENTATION. 5'-D(*CP*GP*CP*AP*TP*GP*(3DR)P*GP*TP*AP*CP*GP*C)- 3', 5'-D(*GP*CP*GP*TP*AP*(3DR)P*AP*CP*AP*TP*GP*CP*G)- 3' DNA DOUBLE HELIX, ABASIC SITES, CLUSTERED DAMAGE, EXTRUDED RESIDUES., DNA
1yct	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CLUSTERED ABASIC LESIONS IN DNA: NMR SOLUTION STRUCTURE OF C BISTRANDED +1 ABASIC LESION 5'-D(*CP*GP*CP*AP*TP*GP*(3DR)P*GP*TP*AP*CP*GP*C)- CHAIN: A, 5'-D(*GP*CP*GP*TP*AP*(3DR)P*CP*CP*AP*TP*GP*CP*G)- CHAIN: B DNA DOUBLE HELIX, ABASIC SITES, CLUSTERED DAMAGE, EXTRUDED RESID REDUCED AP SITE, FURAN, BISTRANDED ABASIC LESION., DNA
1ycw	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	CLUSTERED ABASIC LESIONS IN DNA: NMR SOLUTION STRUCTURES OF BISTRANDED-1 ABASIC LESION 5'-D(*GP*CP*GP*TP*AP*CP*CP*(3DR)P*AP*TP*GP*CP*G)- CHAIN: B, 5'-D(*CP*GP*CP*AP*TP*GP*(3DR)P*GP*TP*AP*CP*GP*C)- CHAIN: A DNA DOUBLE HELIX, ABASIC SITES, CLUSTERED DAMAGE, EXTRUDED RESID REDUCED AP SITE, FURAN, BISTRANDED ABASIC LESION, DNA
2kh0	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	2-HYDROXY-7-NITROFLUORENE COVALENTLY LINKED INTO A 13MER DNA DUPLEX - SOLUTION STRUCTURE OF THE FACE-DOWN ORIENTATION 5'-D(*GP*CP*TP*GP*CP*AP*(3DR)P*AP*CP*GP*TP*CP*G)- 3', 5'-D(*CP*GP*AP*CP*GP*TP*(3DR)P*TP*GP*CP*AP*GP*C)- 3' DNA DNA, SOLUTION STRUCTURE, BASE PAIR MIMIC, CONFORMATIONAL FLEXIBILITY
2kh1	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	2-HYDROXY-7-NITROFLUORENE COVALENTLY LINKED INTO A 13MER DNA DUPLEX - SOLUTION STRUCTURE OF THE FACE-UP ORIENTATION 5'-D(*GP*CP*TP*GP*CP*AP*(3DR)P*AP*CP*GP*TP*CP*G)- 3', 5'-D(*CP*GP*AP*CP*GP*TP*(3DR)P*TP*GP*CP*AP*GP*C)- 3' DNA DNA, SOLUTION STRUCTURE, BASE PAIR MIMIC, CONFORMATIONAL FLEXIBILITY
2l2u	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	NMR SOLUTION STRUCTURES OF +3 (5' STAGGERED) BISTRANDED ABAS LESIONS IN DNA DNA (5'-D(*CP*AP*GP*CP*GP*(3DR)P*GP*TP*AP*TP*AP*A 3'), DNA (5'-D(*GP*CP*TP*TP*AP*(3DR)P*AP*CP*AP*CP*GP*C 3') DNA ABASIC LESION, BISTRANDED DNA LESIONS, CLUSTERED DNA DAMAGE, DNA DAMAGE, IONIZING RADIATION, DNA
2l2v	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE 2(C5 H11 O6 P)	NMR SOLUTION STRUCTURES OF -3 (3' STAGGERED) BISTRANDED ABAS LESIONS IN DNA DNA_(5'-D(*CP*AP*GP*CP*TP*AP*TP*GP*(3DR)P*GP*AP*A 3')_, DNA_(5'-D(*GP*CP*TP*TP*CP*AP*CP*AP*(3DR)P*AP*GP*C 3')_ DNA ABASIC LESION, BISTRANDED DNA LESIONS, CLUSTERED DNA DAMAGE, DNA DAMAGE, IONIZING RADIATION, DNA
2m40	nuc      NMR    	1',2'-DIDEOXYRIBOFURANOSE-5'-PHOSPHATE C5 H11 O6 P	DNA CONTAINING A CLUSTER OF 8-OXO-GUANINE AND THF LESION DNA (5'-D(*CP*GP*CP*TP*CP*(3DR)P*CP*AP*CP*GP*C)-3 CHAIN: A, DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3 CHAIN: B DNA DNA LESION CLUSTER, 8-OXO-GUANINE, THF, DNA

3EZ    N,N'-BIS[3-(1,4,5,6-TETRAHYDROPYRIMIDIN-2-YL) PHENYL]BIPHENYL-4,4'-DICARBOXAMIDE

Code	Class Resolution	Description
4u8a	nuc      1.48	N,N'-BIS[3-(1,4,5,6-TETRAHYDROPYRIMIDIN-2-YL) PHENYL]BIPHENYL-4,4'-DICARBOXAMIDE C34 H32 N6 O2	CRYSTAL STRUCTURE OF D(CGCGAATTCGCG)2 COMPLEXED WITH BPH-150 DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' CHAIN: A, B DNA/ANTIBIOTIC ANTIBACTERIAL AGENTS, BISAMIDINES, MINOR GROOVE BINDERS, MOD MOLECULAR, NUCLEIC ACID CONFORMATION, OLIGODEOXYRIBONUCLEOT

3F2    N,N'-BIS[3-(4,5-DIHYDRO-1H-IMIDAZOL-2-YL) PHENYL]BIPHENYL-4,4'-DICARBOXAMIDE

Code	Class Resolution	Description
4u8b	nuc      1.31	N,N'-BIS[3-(4,5-DIHYDRO-1H-IMIDAZOL-2-YL) PHENYL]BIPHENYL-4,4'-DICARBOXAMIDE C32 H28 N6 O2	CRYSTAL STRUCTURE OF D(CGCGAATTCGCG)2 COMPLEXED WITH BPH-135 DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' CHAIN: A, B DNA/ANTIBIOTIC ANTIBACTERIAL AGENTS, BISAMIDINES, MINOR GROOVE BINDERS, MOD MOLECULAR, NUCLEIC ACID CONFORMATION, OLIGODEOXYRIBONUCLEOT DNA-ANTIBIOTIC COMPLEX

3F6    2,2'-BENZENE-1,4-DIYLBIS[6-(1,4,5,6- TETRAHYDROPYRIMIDIN-2-YL)-1H-INDOLE]

Code	Class Resolution	Description
4u8c	nuc      1.24	2,2'-BENZENE-1,4-DIYLBIS[6-(1,4,5,6- TETRAHYDROPYRIMIDIN-2-YL)-1H-INDOLE] C30 H28 N6	CRYSTAL STRUCTURE OF D(CGCGAATTCGCG)2 COMPLEXED WITH BPH-140 DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' CHAIN: A, B DNA/ANTIBIOTIC ANTIBACTERIAL AGENTS, BISAMIDINES, MINOR GROOVE BINDERS, MOD MOLECULAR, NUCLEIC ACID CONFORMATION, OLIGODEOXYRIBONUCLEOT

3ME    2'-O-{2-[2-(DIMETHYLAMINO)ETHOXY]ETHYL}-5-METHYLURIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
1nzg	nuc      1.60	2'-O-{2-[2-(DIMETHYLAMINO)ETHOXY]ETHYL}-5-METHYLURIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C16 H28 N3 O10 P)	CRYSTAL STRUCTURE OF A-DNA DECAMER GCGTA(3ME)ACGC, WITH A MO METHYLURIDINE 5'-D(*GP*CP*GP*TP*AP*(3ME)P*AP*CP*GP*C)-3' DNA A-DNA, 2'-MODIFIED OLIGONUCLEOTIDES, DNA

3SB   

Code	Class Resolution	Description
2gxx	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO BIS[5-(2- IMIDAZOLINYL)-2-BENZIMIDAZOLYL]METHANE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

3WB    (10,12-DIMETHYLDIPYRIDO[3,2-A:2',3'-C]PHENAZINE- KAPPA~2~N~4~,N~5~)[BIS(PYRAZINO[2,3-F]QUINOXALINE- KAPPA~2~N~1~,N~10~)]RUTHENIUM

Code	Class Resolution	Description
4x1a	nuc      0.89	(10,12-DIMETHYLDIPYRIDO[3,2-A:2',3'-C]PHENAZINE- KAPPA~2~N~4~,N~5~)[BIS(PYRAZINO[2,3-F]QUINOXALINE- KAPPA~2~N~1~,N~10~)]RUTHENIUM C40 H26 N12 RU	LAMBDA-[RU(TAP)2(DPPZ-10,12-ME)]2+ BOUND TO D(TCGGCGCCGA) DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA RUTHENIUM, DNA, POLYPYRIDYL

3ZO    2'-DEOXY-XANTHOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2mwz	nuc      NMR    	2'-DEOXY-XANTHOSINE-5'-MONOPHOSPHATE C10 H13 N4 O8 P	XANTHINE AND 8-OXOGUANINE IN G-QUADRUPLEXES: FORMATION OF A TETRAD DNA (5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*(8OG) P*GP*GP*TP*TP*AP*GP*GP*(3ZO)P*TP*TP*AP*GP*GP*GP*A)-3') DNA XANTHOSINE, DNA

42B    4-AMINO-2-HYDROXYBUTANOIC ACID

Code	Class Resolution	Description
1o9m	nuc      2.40	4-AMINO-2-HYDROXYBUTANOIC ACID C4 H9 N O3	THE COMPLEX OF A NOVEL ANTIBIOTIC WITH THE AMINOACYL SITE OF THE BACTERIAL RIBOSOME REVEALED BY X-RAY CRYSTALLOGRAPHY. EUBACTERIAL A-SITE ANTIBIOTIC/RNA ANTIBIOTIC/RNA, RNA-ANTIBIOTIC INTERACTIONS, A-SITE

44D    7-[5-(4-AMINO-5-HYDROXY-6-METHYL-TETRAHYDRO-PYRAN-2- YLOXY)-4-HYDROXY-6-METHYL-TETRAHYDRO-PYRAN-2-YLOXY]-6, 9,11-TRIHYDROXY-9-(2-HYDROXY-ACETYL)-7,8,9,10- TETRAHYDRO-NAPHTHACENE-5,12-DIONE

Code	Class Resolution	Description
1nab	nuc      2.15	7-[5-(4-AMINO-5-HYDROXY-6-METHYL-TETRAHYDRO-PYRAN-2- YLOXY)-4-HYDROXY-6-METHYL-TETRAHYDRO-PYRAN-2-YLOXY]-6, 9,11-TRIHYDROXY-9-(2-HYDROXY-ACETYL)-7,8,9,10- TETRAHYDRO-NAPHTHACENE-5,12-DIONE 2(C32 H37 N O13)	THE CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN A DISACCHARIDE ANTHRACYCLINE AND THE DNA HEXAMER D(CGATCG) REVEALS TWO DIF BINDING SITES INVOLVING TWO DNA DUPLEXES 5'-D(*CP*GP*AP*TP*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DNA

45A    5'-O-[(S)-HYDROXY(METHYL)PHOSPHORYL]ADENOSINE

Code	Class Resolution	Description
4y27	nuc      1.00	5'-O-[(S)-HYDROXY(METHYL)PHOSPHORYL]ADENOSINE C11 H16 N5 O6 P	E.COLI 23S SARCIN-RICIL LOOP, MODIFIED WITH A 2-ME ON G2661 METHYLPHOSPHONATE ON A2662 27-MER SRL RNA RNA RNA, MODIFICATION, RIBOSOME

4AC    N(4)-ACETYLCYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
5tra	nuc      model  	N(4)-ACETYLCYTIDINE-5'-MONOPHOSPHATE C11 H16 N3 O9 P	SOLUTION STRUCTURE OF A TRNA WITH A LARGE VARIABLE REGION: YEAST TRNA-SER T-RNA (85-MER) AMINO-ACID TRANSPORT T-RNA

4BW    2-AMINO-9-[(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-9- (6-AMINO-9H-PURIN-9-YL)-3,5,10,12-TETRAHYDROXY-5,12- DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3,2-D:3',2'-J][1,3,7,9, 2,8]TETRAOXADIPHOSPHACYCLODODECIN-2-YL]-1,9-DIHYDRO- 6H-PURIN-6-ONE

Code	Class Resolution	Description
4yaz	nuc      2.00	2-AMINO-9-[(2R,3R,3AS,5R,7AR,9R,10R,10AS,12R,14AR)-9- (6-AMINO-9H-PURIN-9-YL)-3,5,10,12-TETRAHYDROXY-5,12- DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3,2-D:3',2'-J][1,3,7,9, 2,8]TETRAOXADIPHOSPHACYCLODODECIN-2-YL]-1,9-DIHYDRO- 6H-PURIN-6-ONE 2(C20 H24 N10 O13 P2)	3',3'-CGAMP RIBOSWITCH BOUND WITH 3',3'-CGAMP RNA (84-MER) RNA RIBOSWITCH, 3', 3'-CGAMP, SPINACH, RNA STRUCTURE, C-DI-GMP,

4E9    2'-DEOXY-8-[(7-OXO-7H-BENZO[DE]ANTHRACEN-3-YL) AMINO]GUANOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2n4m	nuc      NMR    	2'-DEOXY-8-[(7-OXO-7H-BENZO[DE]ANTHRACEN-3-YL) AMINO]GUANOSINE 5'-(DIHYDROGEN PHOSPHATE) C27 H23 N6 O8 P	BASE-DISPLACED INTERCALATED STRUCTURE OF THE N-(2'DEOXYGUANO 3-AMINOBENZANTHRONE DNA ADDUCT DNA (5'-D(*AP*CP*AP*AP*AP*CP*AP*CP*GP*CP*AP*C)-3' CHAIN: B, DNA (5'-D(*GP*TP*GP*CP*(4E9)P*TP*GP*TP*TP*TP*GP*T CHAIN: A DNA DNA

4EN    [(2R,3S,5R)-5-(4-AZANYLPYRAZOLO[3,4-D]PYRIMIDIN-2-YL)- 3-OXIDANYL-OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
2n5o	nuc      NMR    	[(2R,3S,5R)-5-(4-AZANYLPYRAZOLO[3,4-D]PYRIMIDIN-2-YL)- 3-OXIDANYL-OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE C10 H14 N5 O6 P	UNIVERSAL BASE OLIGONUCLEOTIDE STRUCTURE DNA_(5'-D(*AP*TP*GP*GP*(4EN)P*GP*CP*TP*C)-3'), DNA_(5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3') DNA NUCLEIC ACID, DNA, UNIVERSAL BASE, SYNTHETIC BASE

4JA    (2S)-3-[(6-DEOXY-BETA-D-GLUCOPYRANOSYL)OXY]-2- HYDROXYPROPYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
2n9f	nuc      NMR    	(2S)-3-[(6-DEOXY-BETA-D-GLUCOPYRANOSYL)OXY]-2- HYDROXYPROPYL DIHYDROGEN PHOSPHATE C9 H19 O10 P	GLUCOSE AS NON NATURAL NUCLEOBASE DNA (5'-D(*CP*TP*AP*GP*CP*GP*GP*TP*CP*AP*TP*C)-3' CHAIN: A, DNA (5'-D(*GP*AP*TP*GP*AP*CP*(4JA)P*GP*CP*TP*AP*G CHAIN: B DNA CARBOHYDRATE-DNA INTERACTION, CARBOHYDRATE NUCLEOBASE, DNA
2n9h	nuc      NMR    	(2S)-3-[(6-DEOXY-BETA-D-GLUCOPYRANOSYL)OXY]-2- HYDROXYPROPYL DIHYDROGEN PHOSPHATE C9 H19 O10 P	GLUCOSE AS A NUCLEASE MIMIC IN DNA DNA (5'-D(*GP*AP*TP*GP*AP*CP*TP*GP*CP*TP*AP*G)-3' CHAIN: A, DNA (5'-D(*CP*TP*AP*GP*CP*(GL6)P*GP*TP*CP*AP*TP*C CHAIN: B DNA CARBOHYDRATE-DNA INTERACTION, GLUCOSE-NUCLEOBASE, DNA

4JF    (1R,1'R,2S,2'S,3R,3'R,5AR,10AR,11A'S)-2'-[(2,6-DIDEOXY- 3-O-METHYL-ALPHA-L-ARABINO-HEXOPYRANOSYL)OXY]-2,2'- DIETHYL-11,11'-DIHYDRAZINYL-6,6',9,9'-TETRAHYDROXY-4, 4',5,5',10,10'-HEXAOXO-1,1'-BIS{[2,4,6-TRIDEOXY-4- (DIMETHYLAMINO)-BETA-L-ARABINO-HEXOPYRANOS

Code	Class Resolution	Description
2n96	nuc      NMR    	(1R,1'R,2S,2'S,3R,3'R,5AR,10AR,11A'S)-2'-[(2,6-DIDEOXY- 3-O-METHYL-ALPHA-L-ARABINO-HEXOPYRANOSYL)OXY]-2,2'- DIETHYL-11,11'-DIHYDRAZINYL-6,6',9,9'-TETRAHYDROXY-4, 4',5,5',10,10'-HEXAOXO-1,1'-BIS{[2,4,6-TRIDEOXY-4- (DIMETHYLAMINO)-BETA-L-ARABINO-HEXOPYRANOS C68 H90 N6 O24	AN UNEXPECTED MODE OF SMALL MOLECULE DNA BINDING PROVIDES TH STRUCTURAL BASIS FOR DNA CLEAVAGE BY THE POTENT ANTIPROLIFE AGENT (-)-LOMAIVITICIN A DNA (5'-D(*GP*CP*TP*AP*TP*AP*GP*C)-3') DNA DIAZOFLUORENE, INTERCALATOR, DNA

4L1    5-(4-METHYLPIPERAZIN-1-YL)-2'-(PYRIDIN-2-YL)-1H,1'H-2, 5'-BIBENZIMIDAZOLE

Code	Class Resolution	Description
4z4b	nuc      1.97	5-(4-METHYLPIPERAZIN-1-YL)-2'-(PYRIDIN-2-YL)-1H,1'H-2, 5'-BIBENZIMIDAZOLE C24 H23 N7	2-PYRIDYL HOECHST - A NEW GENERATION DNA-BINDING RADIOPROTEC DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*G)-3' CHAIN: A, B DNA DNA, HOECHST

4PC    3-(2'-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-3,7-DIHYDRO-2H-PYRROLO[2,3- D]PYRIMIDIN-2-ONE

Code	Class Resolution	Description
2gi5	nuc      model  	3-(2'-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-3,7-DIHYDRO-2H-PYRROLO[2,3- D]PYRIMIDIN-2-ONE C12 H16 N3 O7 P	7-MER DNA DUPLEX CONTAINING PYRROLO-DC SUBSTITUTION 5'-D(*CP*CP*TP*(4PC)P*TP*GP*C)-3', 5'-D(*GP*CP*AP*GP*AP*GP*G)-3' DEOXYRIBONUCLEIC ACID PYRROLO-DC DUPLEX DNA

4PD    3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-1,3-DIHYDRO-2H-PYRROLO[2,3- D]PYRIMIDIN-2-ONE

Code	Class Resolution	Description
2gi6	nuc      model  	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-1,3-DIHYDRO-2H-PYRROLO[2,3- D]PYRIMIDIN-2-ONE C12 H16 N3 O7 P	7-MER DNA DUPLEX CONTAINING PYRROLO-DC SUBSTITUTION (TAUTOMER 2) 5'-D(*CP*CP*TP*(4PD)P*TP*GP*C)-3', 5'-D(*GP*CP*AP*GP*AP*GP*G)-3' DEOXYRIBONUCLEIC ACID PYRROLO-DC DNA DUPLEX

4PE    3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-3H-PYRROLO[2,3-D]PYRIMIDIN-2- OL

Code	Class Resolution	Description
2gi8	nuc      model  	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-METHYL-3H-PYRROLO[2,3-D]PYRIMIDIN-2- OL C12 H16 N3 O7 P	7-MER DNA DUPLEX CONTAINING PYRROLO-DC MODIFICATION (TAUTOMER 3) 5'-D(*GP*CP*AP*GP*AP*GP*G)-3', 5'-D(*CP*CP*TP*(4PE)P*TP*GP*C)-3' DEOXYRIBONUCLEIC ACID PYRROLO-DC DNA DUPLEX

4PQ    5-HYDROXY-L-TRYPTOPHAN

Code	Class Resolution	Description
5kpy	nuc      2.00	5-HYDROXY-L-TRYPTOPHAN C11 H12 N2 O3	STRUCTURE OF A 5-HYDROXYTRYPTOPHAN APTAMER 5-HYDROXYTRYPTOPHAN RNA APTAMER RNA RNA, APTAMER, RIBOSWITCH, 5-HYDROXYTRYPTOPHAN

4SB   

Code	Class Resolution	Description
2gxy	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 1,2-BIS[5-(2-AMIDINO)-2-BENZIMIDAZOLYL]ETHANE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

4SU    4-THIOURIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
3bbv	nuc      10.00	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	THE TRNA(PHE) FITTED INTO THE LOW RESOLUTION CRYO-EM MAP OF 50S.NC-TRNA.HSP15 COMPLEX TRNA(PHE) RIBOSOME PHE, TRNA, RESCUE STALLED RIBOSOME, RIBOSOME
3cw5	nuc      3.10	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	E. COLI INITIATOR TRNA INITIATOR TRNA RNA TRNA, INITIATOR, RNA
3cw6	nuc      3.30	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	E. COLI INITIATOR TRNA INITIATOR TRNA RNA TRNA, INITIATOR, RNA
5l4o	nuc      2.80	4-THIOURIDINE-5'-MONOPHOSPHATE C9 H13 N2 O8 P S	STRUCTURE OF AN E.COLI INITIATOR TRNAFMET A1-U72 VARIANT TRNA (76-MER) TRANSLATION TRNA-TRANSLATION INITIATION, TRANSLATION

50B    13-DIPHENYLALKYL BERBERINE

Code	Class Resolution	Description
5cdb	nuc      1.70	13-DIPHENYLALKYL BERBERINE C36 H34 N O4 1+	STRUCTURE OF THE COMPLEX OF A BIMOLECULAR HUMAN TELOMERIC DN 13-DIPHENYLALKYL BERBERINE DERIVATIVE HUMAN TELOMERIC DNA DNA DRUG-DNA COMPLEX, G-QUADRUPLEX, DNA

50L    [(2R,3S,4R,5R)-5-(4-AZANYL-2-OXIDANYLIDENE-1$L^{4},3,5, 7-TETRAZABICYCLO[4.3.0]NONA-1(6),3,8-TRIEN-7-YL)-3,4- BIS(OXIDANYL)OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
5c7w	nuc      3.22	[(2R,3S,4R,5R)-5-(4-AZANYL-2-OXIDANYLIDENE-1$L^{4},3,5, 7-TETRAZABICYCLO[4.3.0]NONA-1(6),3,8-TRIEN-7-YL)-3,4- BIS(OXIDANYL)OXOLAN-2-YL]METHYL DIHYDROGEN PHOSPHATE C10 H15 N5 O8 P	5'-MONOPHOSPHATE Z:P GUANINE RIBOSWITCH BOUND TO HYPOXANTHIN 5'-MONOPHOSPHATE Z:P GUANINE RIBOSWITCH RNA EXPANDED RNA; RIBOSWITCH; UNNATURAL BASE PAIR, RNA

50N    (1S)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-5-O-PHOSPHONO-D-RIBITOL

Code	Class Resolution	Description
5c7w	nuc      3.22	(1S)-1-(6-AMINO-2-HYDROXY-5-NITROPYRIDIN-3-YL)-1,4- ANHYDRO-5-O-PHOSPHONO-D-RIBITOL C10 H14 N3 O10 P	5'-MONOPHOSPHATE Z:P GUANINE RIBOSWITCH BOUND TO HYPOXANTHIN 5'-MONOPHOSPHATE Z:P GUANINE RIBOSWITCH RNA EXPANDED RNA; RIBOSWITCH; UNNATURAL BASE PAIR, RNA

51B    2-[(3S)-1-{[2-(METHYLAMINO)PYRIMIDIN-5- YL]METHYL}PIPERIDIN-3-YL]-6-(THIOPHEN-2-YL)PYRIMIDIN- 4(1H)-ONE

Code	Class Resolution	Description
5c45	nuc      2.93	2-[(3S)-1-{[2-(METHYLAMINO)PYRIMIDIN-5- YL]METHYL}PIPERIDIN-3-YL]-6-(THIOPHEN-2-YL)PYRIMIDIN- 4(1H)-ONE C19 H22 N6 O S	SELECTIVE SMALL MOLECULE INHIBITION OF THE FMN RIBOSWITCH FMN RIBOSWITCH, FMN RIBOSWITCH RNA/INHIBITOR RNA, TRANSLATION, RNA-INHIBITOR COMPLEX

51O    AU(CAFFEIN-2-YLIDENE)2

Code	Class Resolution	Description
5ccw	nuc      1.89	AU(CAFFEIN-2-YLIDENE)2 3(C18 H24 AU N8 O4 3+)	STRUCTURE OF THE COMPLEX OF A HUMAN TELOMERIC DNA WITH AU(CA YLIDENE)2 HUMAN TELOMERIC DNA DRUG/DNA DRUG-DNA COMPLEX, G-QUADRUPLEX

58F    P-IODO HOECHST

Code	Class Resolution	Description
5dam	nuc      1.95	P-IODO HOECHST C25 H23 I N6	CRYSTAL STRUCTURE OF P-IODOHOECHST BOUND TO D(CGCAAATTTGCG) DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*G)-3' CHAIN: A, B DNA MINOR GROOVE BINDER DNA, DNA

5A1   

Code	Class Resolution	Description
2gy6	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-AMIDINO)-2-[2-(4-HYDROXYPHENYL)-5- BENZIMIDAZOLYL]BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5A2   

Code	Class Resolution	Description
2gy8	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-AMIDINO)-2-[2-(4-METHOXYPHENYL)-5- BENZIMIDAZOLYL]BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5A3   

Code	Class Resolution	Description
2gye	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-AMIDINO)-2-[2-(4-ETHOXYPHENYL)-5- BENZIMIDAZOLYL]BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5A4   

Code	Class Resolution	Description
2gyf	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-IMIDAZOLINYL)-2-[2-(4-ETHOXYPHENYL)-5- BENZIMIDAZOLYL]BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5A5   

Code	Class Resolution	Description
2gyg	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-IMIDAZOLINYL)-2-[2-(4-ETHOXYPHENYL)-5- BENZIMIDAZOLYL]BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5A6   

Code	Class Resolution	Description
2gyh	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-PYRIMIDINYL)-2-[2-(4-HYDROXYPHENYL)-5- BENZIMIDAZOLYL]BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5A7   

Code	Class Resolution	Description
2gyj	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-IMIDAZOLINYL)-2-[2-(2-IMIDAZOLINYL)-5- BENZIMIDAZOLYL]BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5A8   

Code	Class Resolution	Description
2gyl	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2- PYRIMIDINYL)-2-[2-(2- PYRIMIDINYL)-5- BENZIMIDAZOLYL]BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5AF    2,5-BIS{[4-(3-PENTYL)DIAMINOMETHYL]PHENYL}FURAN

Code	Class Resolution	Description
2gxi	nuc      model  	2,5-BIS{[4-(3-PENTYL)DIAMINOMETHYL]PHENYL}FURAN C28 H40 N4 O	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 2,5-BIS{[4-(3-PENTYL)DIAMINOMETHYL]PHENYL}FURAN DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, FURAN DERIVATIVE

5AT    5'-AMINO-5'-DEOXYTHYMIDINE

Code	Class Resolution	Description
1c95	nuc      NMR    	5'-AMINO-5'-DEOXYTHYMIDINE 2(C10 H15 N3 O4)	SOLUTION STRUCTURE OF THE AMINOACYL-CAPPED OLIGODEOXYRIBONUCLEOTIDE DUPLEX TRP-D(TGCGCAC)2 5'-D((5AT)TP*GP*CP*GP*CP*AP*C)-3' DNA DOUBLE HELIX, AMINOACYL-CAPPED DNA
1kse	nuc      NMR    	5'-AMINO-5'-DEOXYTHYMIDINE 2(C10 H15 N3 O4)	SOLUTION STRUCTURE OF A QUINOLONE-CAPPED DNA DUPLEX 5'-D(*(5AT)P*GP*CP*GP*CP*A)-3' DNA DNA, QUINOLONE, SYNTHETIC HYBRID, DISRUPTED TERMINAL BASEPAIRS
1on5	nuc      NMR    	5'-AMINO-5'-DEOXYTHYMIDINE 2(C10 H15 N3 O4)	SOLUTION STRUCTURE OF A CHOLIC ACID-CAPPED DNA DUPLEX STEROID-DNA HYBRID DNA DNA, STEROID, SYNTHETIC HYBRID

5AZ    6-AMINO-1,3,5-TRIAZIN-2(1H)-ONE

Code	Class Resolution	Description
3la5	nuc      1.70	6-AMINO-1,3,5-TRIAZIN-2(1H)-ONE C3 H4 N4 O	X-RAY CRYSTAL STRUCTURE OF MC6 RNA RIBOSWITCH BOUND TO AZACYTOSINE ADENOSINE RIBOSWITCH RNA RNA, RIBOSWITCH, GENE REGULATION, SYNTHETIC BIOLOGY

5BD    N,N'-(9,10-DIOXO-9,10-DIHYDROANTHRACENE-2,7-DIYL)BIS[2- (DIMETHYLAMINO)ACETAMIDE]

Code	Class Resolution	Description
3gdd	nuc      2.80	N,N'-(9,10-DIOXO-9,10-DIHYDROANTHRACENE-2,7-DIYL)BIS[2- (DIMETHYLAMINO)ACETAMIDE] 4(C22 H24 N4 O4)	AN INVERTED ANTHRAQUINONE-DNA CRYSTAL STRUCTURE 5'-D(*(BRU)P*AP*GP*G)-3' DNA ANTHRAQUINONE, TELOMERE DNA SEQUENCE, DRUG-DNA COMPLEX, DNA

5BT    5-BROMO-2'-DEOXYCYTIDINE

Code	Class Resolution	Description
5lfs	nuc      1.85	5-BROMO-2'-DEOXYCYTIDINE C9 H12 BR N3 O4	LAMBDA-[RU(BPY)2(DPPZ)]2+ BOUND TO BROMINATED DNA DNA (5'-D(*(CBR)P*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*G)-3') DNA DNA, RUTHENIUM, INTERCALATION, LIGHT-SWITCH
5lfw	nuc      1.28	5-BROMO-2'-DEOXYCYTIDINE C9 H12 BR N3 O4	LAMBDA-[RU(PHEN)2(DPPZ)]2+ BOUND TO A SHORT SUBSTITUTED DNA DNA (5'-D(*(CBR)P*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*G)-3') DNA DNA, RUTHENIUM, INTERCALATION, LIGHT-SWITCH
5lfx	nuc      1.56	5-BROMO-2'-DEOXYCYTIDINE C9 H12 BR N3 O4	LAMBDA-[RU(PHEN)2(DPPZ-11,12-ME)]2+ BOUND TO A SHORT SUBSTIT SEQUENCE DNA (5'-D(*(CBR)P*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*G)-3') DNA DNA, RUTHENIUM, LIGHT-SWITCH, INTERCALATION

5BU    5-BROMO-URIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1f1t	nuc      2.80	5-BROMO-URIDINE-5'-MONOPHOSPHATE 5(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE MALACHITE GREEN APTAMER COMPLEXED WITH TETRAMETHYL-ROSAMINE MALACHITE GREEN APTAMER RNA RNA U-TURN, BASE QUADRUPLE, BASE TRIPLE, GNRA TETRALOOP, 5- BROMO-URIDINE, RNA
1jzv	nuc      1.70	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF A BULGED RNA FROM THE SL2 STEM-LOOP OF THE HIV-1 PSI-RNA 5'-R(*GP*GP*CP*GP*AP*CP*(5BU)P*G)-3', 5'-R(*CP*AP*GP*UP*AP*CP*GP*(5IC)P*C)-3' RNA A-BULGE, A-RNA, HIV-1 SL2, X-RAY
1kfo	nuc      1.60	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	CRYSTAL STRUCTURE OF AN RNA HELIX RECOGNIZED BY A ZINC- FINGER PROTEIN: AN 18 BASE PAIR DUPLEX AT 1.6 RESOLUTION 5'- R(*GP*AP*AP*UP*GP*CP*CP*UP*GP*CP*GP*AP*GP*CP*AP*(5BU) P*CP*CP*C)-3' RNA RNA
1kh6	nuc      2.90	5-BROMO-URIDINE-5'-MONOPHOSPHATE 6(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF AN RNA TERTIARY DOMAIN ESSENTIAL TO HCV MEDIATED TRANSLATION INITIATION. JIIIABC RNA TRANSLATION, RNA STRUCTURE, IRES, HCV, BROMINE, FOUR-WAY JUN RNA
1y3o	nuc      2.70	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	HIV-1 DIS RNA SUBTYPE F- MN SOAKED 5'-R(*CP*UP*(5BU) P*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP*CP*AP*AP* G)-3' RNA RNA, LOOP-LOOP COMPLEX, HIV-1
1y3s	nuc      2.25	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	HIV-1 DIS RNA SUBTYPE F- MPD FORM 5'-R(*CP*UP*(5BU) P*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP*CP*AP*AP* G)-3' RNA RNA, LOOP-LOOP COMPLEX, HIV-1
1y90	nuc      3.08	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	HIV-1 DIS(MAL) DUPLEX MN-SOAKED 5'-R(*CP*(5BU) P*UP*GP*CP*UP*GP*AP*GP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP*CP*AP* AP*G)-3' RNA HIV-1, RNA, METAL IONS, BULGE
1yxp	nuc      2.40	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	HIV-1 DIS RNA SUBTYPE F- ZN SOAKED 5'-R(*CP*UP*(5BU) P*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP*CP*AP*AP* G)-3' RNA HIV-1, RNA, KISSING-LOOP, METAL IONS
1zci	nuc      1.65	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	HIV-1 DIS RNA SUBTYPE F- MONOCLINIC FORM 5'-R(*CP*(5BU) P*UP*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP*CP*AP* AP*G)-3' RNA HIV-1, RNA, LOOP-LOOP COMPLEX, METAL IONS
2ao5	nuc      2.10	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF AN RNA DUPLEX R(GGCGBRUGCGCU)2 WITH TERMINAL AND INTERNAL TANDEM G-U BASE PAIRS 5'-R(*GP*GP*CP*GP*(5BU)P*GP*CP*GP*CP*U)-3' RNA G-U BASE PAIR, RNA DUPLEX
2fcx	nuc      2.00	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	HIV-1 DIS KISSING-LOOP IN COMPLEX WITH NEAMINE HIV-1 DIS RNA RNA HIV-1, RNA, AMINOGLYCOSIDE, ANTIBIOTICS
2fcy	nuc      2.20	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	HIV-1 DIS KISSING-LOOP IN COMPLEX WITH NEOMYCIN HIV-1 DIS RNA RNA HIV-1, RNA, AMINOGLYCOSIDE, ANTIBIOTICS
2fcz	nuc      2.01	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	HIV-1 DIS KISSING-LOOP IN COMPLEX WITH RIBOSTAMYCIN HIV-1 DIS RNA RNA HIV-1, RNA, AMINOGLYCOSIDE, ANTIBIOTICS
2fd0	nuc      1.80	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	HIV-1 DIS KISSING-LOOP IN COMPLEX WITH LIVIDOMYCIN HIV-1 DIS RNA RNA HIV-1, RNA, AMINOGLYCOSIDE, ANTIBIOTICS
2jlt	nuc      2.90	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF AN RNA KISSING COMPLEX R06, TAR RNA RNA, KISSING COMPLEX
2oeu	nuc      2.00	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	FULL-LENGTH HAMMERHEAD RIBOZYME WITH MN(II) BOUND HAMMERHEAD RIBOZYME, 5'-R(*GP*GP*CP*GP*UP*(OMC)P*CP*UP*GP*GP*(5BU) P*AP*UP*CP*CP*AP*AP*UP*CP*(DC))-3' RNA RIBOZYME, HAMMERHEAD RNA, STEM-LOOP INTERACTION, URIDINE TURN, A-FORM HELIX, MANGANESE, MN
2pn3	nuc      2.90	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF HEPATITIS C VIRUS IRES SUBDOMAIN IIA 5'-R(*GP*CP*GP*(5BU) P*GP*UP*CP*GP*UP*GP*CP*AP*GP*CP*CP*(5BU)P*CP*CP*GP*G)-3': HCV IRES SUBDOMAIN IIA (RESIDUE 98-117), 5'- R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP*UP*GP*UP*CP*UP*UP*CP *AP*CP*GP*CP*C)-3': HCV IRES SUBDOMAIN IIA (RESIDUE 47-70) RNA HCV, IRES, LOOP IIA, RNA, MAGNESIUM, CRYSTALLIZATION, CRYSTAL STRUCTURE
2pn4	nuc      2.32	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF HEPATITIS C VIRUS IRES SUBDOMAIN IIA 5'-R(*GP*CP*GP*(5BU) P*GP*UP*CP*GP*UP*GP*CP*AP*GP*CP*CP*(5BU)P*CP*CP*GP*G)-3': HCV IRES SUBDOMAIN IIA (RESIDUE 98-117), 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP*UP*GP*U *CP*AP*CP*GP*CP*C)-3': HCV IRES SUBDOMAIN IIA (RESIDUE 47-70) RNA HCV, IRES, SUBDOAMIN IIA, RNA, STRONTIUM, HEPATITIS
2r1s	nuc      1.40	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	STRUCTURE OF THE RNA BROMINATED TRIDECAMER R(GCGUU- 5BUGAAACGC) AT 1.4 A (BR1) RNA (5'-R(*GP*CP*GP*UP*UP*(5BU) P*GP*AP*AP*AP*CP*GP*C)-3') RNA ASYMMETRY, ELECTROSTATIC, MONOVALENT CATIONS, STRUCTURAL PLASTICITY, RNA
2r20	nuc      1.30	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	STRUCTURE OF THE RNA BROMINATED TRIDECAMER R(GCGUU- 5BUGAAACGC) AT 1.3 A (BR2) RNA (5'-R(*GP*CP*GP*UP*UP*(5BU) P*GP*AP*AP*AP*CP*GP*C)-3') RNA ASYMMETRY, METAL ION BINDING, UNSTACKING, ELECTROSTATIC, RNA
2r21	nuc      1.59	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	STRUCTURE OF THE RNA BROMINATED TRIDECAMER R(GCGUU- 5BUGAAACGC) AT 1.6 A (BRMN) RNA (5'-R(*GP*CP*GP*UP*UP*(5BU) P*GP*AP*AP*AP*CP*GP*C)-3') RNA MANGANESE, ASYMMETRY, ELECROSTATIC, MNOVALENT, RNA
3bno	nuc      2.35	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE HOMO SAPIENS MITOCHONDRIAL RIBOSOMAL DECODING SITE (BR-DERIVATIVE) A SITE OF HUMAN MITOCHONDRIAL RIBOSOME RNA RIBOSOME, DECODING SITE, RNA
3bnq	nuc      2.00	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE HOMO SAPIENS MITOCHONDRIAL RIBOSOMAL DECODING SITE IN THE PRESENCE OF SRCL2 (A1555G MUTANT, BR-DERIVATIVE) A SITE OF HUMAN MITOCHONDRIAL RIBOSOME, B CHAIN, A SITE OF HUMAN MITOCHONDRIAL RIBOSOME, A CHAIN RNA RIBOSOME, DECODING SITE, RNA
3bnr	nuc      2.10	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE HOMO SAPIENS MITOCHONDRIAL RIBOSOMAL DECODING SITE IN THE PRESENCE OF NONSPECIFICALLY BOUND PAROMOMYCIN (A1555G MUTANT, BR-DERIVATIVE) A SITE OF HUMAN MITOCHONDRIAL RIBOSOME, CHAIN THREE, A SITE OF HUMAN MITOCHONDRIAL RIBOSOME, CHAIN TWO, A SITE OF HUMAN MITOCHONDRIAL RIBOSOME, CHAIN ONE RNA RIBOSOME, DECODING SITE, RNA
3bns	nuc      1.90	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE HOMO SAPIENS MITOCHONDRIAL RIBOSOMA SITE (A1555G MUTANT, BR-DERIVATIVE) A SITE OF HUMAN MITOCHONDRIAL RIBOSOME, CHAIN TWO CHAIN: B, A SITE OF HUMAN MITOCHONDRIAL RIBOSOME, CHAIN THR CHAIN: D, A SITE OF HUMAN MITOCHONDRIAL RIBOSOME, CHAIN THR CHAIN: A, C RNA RIBOSOME, DECODING SITE, RNA
3bnt	nuc      2.30	5-BROMO-URIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O9 P	CRYSTAL STRUCTURE OF THE HOMO SAPIENS MITOCHONDRIAL RIBOSOMAL DECODING SITE IN THE PRESENCE OF [CO(NH3)6]CL3 (A1555G MUTANT, BR-DERIVATIVE) A SITE OF HUMAN MITOCHONDRIAL RIBOSOME RNA RIBOSOME, DECODING SITE, RNA
3ibk	nuc      2.20	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF A TELOMERIC RNA QUADRUPLEX RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*GP*GP*GP*U CHAIN: A, B RNA RNA QUADRUPLEX, BIMOLECULAR QUADRUPLEX, PARALLEL STRANDED, R
3loa	nuc      2.30	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE ANALYSIS OF THE RNA CONSTRUCT WITH TWO ADJ LIGAND BINDING SITES OF HELIX H44 IN 16S RIBOSOMAL RNA 5'-R(*CP*CP*GP*CP*GP*CP*CP*CP*GP*(5BU) P*CP*AP*CP*AP*CP*CP*AP*CP*CP*CP*G)-3', 5'-R(*GP*GP*GP*(5BU) P*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*UP*AP*AP*CP*GP*CP*GP*GP*C)- CHAIN: B RNA RNA, A-SITE, HYGROMYCIN B BINDING SITE, AMINOGLYCOSIDE
3mei	nuc      1.97	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	REGULATORY MOTIF FROM THE THYMIDYLATE SYNTHASE MRNA RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP*AP*(5BU) P*GP*CP*CP*UP*GP*UP*GP*GP*CP*GP*G)-3') RNA S-TURN, C-C BASE PAIR, RNA
3p59	nuc      2.18	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	FIRST CRYSTAL STRUCTURE OF A RNA NANOSQUARE RNA (5'-R(*CP*CP*GP*GP*CP*AP*GP*CP*CP*U)-3'), RNA (5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP P*G)-3') RNA RNA SQUARE, RNA
3td0	nuc      1.60	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408G-MUTANT AND THE PRO CYTOPLASMIC RIBOSOMAL DECODING SITE RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP*(5BU) P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') RNA DECODING, RIBOSOME, RNA
3td1	nuc      2.10	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408G-MUTANT AND THE PRO CYTOPLASMIC RIBOSOMAL DECODING SITE IN COMPLEX WITH GENETIC RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP*(5BU) P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') RNA/ANTIBIOTIC DECODING, RIBOSOME, RNA-ANTIBIOTIC COMPLEX
3zd5	nuc      2.20	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	THE 2.2 A STRUCTURE OF A FULL-LENGTH CATALYTICALLY ACTIVE HAMMERHEAD RIBOZYME HAMMERHEAD RIBOZYME, ENZYME STRAND, HAMMERHEAD RIBOZYME, SUBSTRATE STRAND RNA CATALYTIC RNA, IN-LINE ATTACK, HAMMERHEAD RNA, STEM-LOOP INTERACTION, URIDINE TURN, A-FORM HELIX, RNA
406d	nuc      1.80	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP*UP*(BRO) UP*CP*GP*GP*UP* RNA (5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP*UP*(5BU) P*CP*GP*GP*UP*G)-3') RNA DISORDERED, RNA, DOUBLE HELIX
4p3s	nuc      2.30	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408C-MUTANT RIBOSOMAL D SITE IN COMPLEX WITH GENETICIN 5'-R(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU) P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3' RNA/ANTIBIOTIC RIBOSOME, ANTIBIOTIC-RESISTANCE, AMINOGLYCOSIDE, DECODING, R ANTIBIOTIC COMPLEX
4p3t	nuc      1.60	5-BROMO-URIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408C-MUTANT RIBOSOMAL D SITE 5'-D(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU) P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3' RNA RIBOSOME, ANTIBIOTIC-RESISTANCE, AMINOGLYCOSIDE, DECODING, R
4p3u	nuc      3.00	5-BROMO-URIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O9 P)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408U-MUTANT RIBOSOMAL D SITE (C2 FORM 1) 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU) P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3' RNA RIBOSOME, ANTIBIOTIC-RESISTANCE, AMINOGLYCOSIDE, DECODING, R

5CF    5-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
3jxq	nuc      1.45	5-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H13 F N3 O8 P)	X-RAY STRUCTURE OF R[CGCG(5-FLUORO)CG]2 R[CGCG(5-FLUORO)CG]2 RNA RNA, DOUBLE HELIX
3jxr	nuc      1.25	5-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 3(C9 H13 F N3 O8 P)	X-RAY STRUCTURE OF R[CGCG(5-FLUORO)CG]2 R[CGCG(5-FLUORO)CG]2 RNA RNA, DOUBLE HELIX

5CM    5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
122d	nuc      1.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	DNA HELIX STRUCTURE AND REFINEMENT ALGORITHM: COMPARISON OF MODELS FOR D(CCAGGCM==5==CTGG) DERIVED FROM NUCLSQ, TNT, AND X-PLOR DNA (5'-D(*CP*CP*AP*GP*GP*CP*(5CM)P*TP*GP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
123d	nuc      1.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	DNA HELIX STRUCTURE AND REFINEMENT ALGORITHM: COMPARISON OF MODELS FOR D(CCAGGCM==5==CTGG) DERIVED FROM NUCLSQ, TNT, AND X-PLOR DNA (5'-D(*CP*CP*AP*GP*GP*CP*(5CM)P*TP*GP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
145d	nuc      1.25	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 5(C10 H16 N3 O7 P)	STRUCTURE AND THERMODYNAMICS OF NONALTERNATING C/G BASE PAIRS IN Z-DNA: THE 1.3 ANGSTROMS CRYSTAL STRUCTURE OF THE ASYMMETRIC HEXANUCLEOTIDE D(M(5)CGGGM(5) CG)/D(M(5) CGCCM(5)CG) DNA (5'-D(*(MCY)P*GP*GP*GP*(5CM)P*G)-3'), DNA (5'-D(*(5CM)P*DGP*DGP*DGP*(5CM)P*DG)-3'), DNA (5'-D(*(MCY)P*GP*CP*CP*(5CM)P*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1d17	nuc      2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	DNA-NOGALAMYCIN INTERACTIONS DNA (5'-D(*(5CM)P*GP*TP*AP*(5CM)P*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIE
1d21	nuc      1.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	BINDING OF THE ANTITUMOR DRUG NOGALAMYCIN AND ITS DERIVATIVE STRUCTURAL COMPARISON DNA (5'-D(*(5CM)P*GP*TP*(AS)P*(5CM)P*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIE
1d22	nuc      1.80	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	BINDING OF THE ANTITUMOR DRUG NOGALAMYCIN AND ITS DERIVATIVES TO DNA: STRUCTURAL COMPARISON DNA (5'-D(*(5CM)P*GP*TP*(AS)P*(5CM)P*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
1d40	nuc      1.30	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	BASE SPECIFIC BINDING OF COPPER(II) TO Z-DNA: THE 1.3- ANGSTROMS SINGLE CRYSTAL STRUCTURE OF D(M5CGUAM5CG) IN THE PRESENCE OF CUCL2 DNA (5'-D(*(5CM)P*(CU)GP*UP*AP*(5CM)P*(CU)G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1d41	nuc      1.30	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	STABILIZATION OF Z-DNA BY DEMETHYLATION OF THYMINE BASES: 1.3 ANGSTROMS SINGLE-CRYSTAL STRUCTURE OF D(M5CGUAM5CG) DNA (5'-D(*(5CM)P*GP*UP*AP*(5CM)P*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1el2	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	SOLUTION STRUCTURE OF A MODIFIED HUMAN TELOMERE FRAGMENT (STRUCTURE "A") 5'-D(*CP*CP*CP*TP*AP*AP*(5CM) P*CP*CP*TP*AP*AP*CP*CP*CP*UP*AP*AP*CP*CP*CP*T)-3' DNA DNA SOLUTION STRUCTURE, I-MOTIF, INTERACTING LOOPS, LOOP MOTIONS, NMR, TELOMERE
1eln	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	SOLUTION STRUCTURE OF A MODIFIED HUMAN TELOMERE FRAGMENT (STRUCTURE "S") 5'-D(*CP*CP*CP*TP*AP*AP*(5CM) P*CP*CP*TP*AP*AP*CP*CP*CP*UP*AP*AP*CP*CP*CP*T)-3' DNA DNA SOLUTION STRUCTURE, I-MOTIF, INTERACTING LOOPS, LOOP MOTIONS, NMR, TELOMERE
1f6e	nuc      2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF THE A-DNA HEXAMER GGCGM5CC DNA (5'-D(*GP*GP*CP*GP*(5CM)P*C)-3') DNA A-DNA, E-DNA, DOUBLE HELIX
1f6i	nuc      2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF THE E-DNA HEXAMER GGCGM5CC DNA (5'-D(*GP*GP*CP*GP*(5CM)P*C)-3') DNA E-DNA, DOUBLE HELIX, METHYLATION
1fv7	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 8(C10 H16 N3 O7 P)	A TWO B-Z JUNCTION CONTAINING DNA RESOLVES INTO AN ALL RIGHT DOUBLE HELIX 5'-D(*(5CM)P*GP*(5CM)P*GP*(0DC)P*(0DG)P*(5CM)P*GP P*G)-3' DNA DNA POLYMORPHISM, L ENANTIOMERY, ANTISENSE, DNA
1ih3	nuc      2.40	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 16(C10 H16 N3 O7 P)	MULTI-CONFORMATION CRYSTAL STRUCTURE OF GGM5CGM5CC 5'-D(*GP*GP*(5CM)P*GP*(5CM)P*C)-3' DNA B TO A DNA TRANSITION, DNA TRANSITION, STRUCTURAL TRANSITION
1ih4	nuc      1.90	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 8(C10 H16 N3 O7 P)	MULTI-CONFORMATION CRYSTAL STRUCTURE OF GGM5CGCC 5'-D(*GP*GP*(5CM)P*GP*CP*C)-3' DNA B TO A DNA TRANSITION, DNA TRANSITION, STRUCTURAL TRANSITION
1l6b	nuc      1.50	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE ANALYSIS OF THE ALL DNA HOLLIDAY JUNCTION STRUCTURE OF CCGGTACM5CGG 5'-D(*CP*CP*GP*GP*TP*AP*CP*(5CM)P*GP*G)-3' DNA HOLLIDAY JUNCTION, DNA FOUR-WAY JUNCTION, CYTOSINE METHYLATION
1r3z	nuc      1.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURES OF D(GM5CGM5CGCGC) AND D(GCGCGM5CGM5C): EFFECTS OF METHYLATION ON ALTERNATING DNA OCTAMERS 5'-D(*GP*(5CM)P*GP*(5CM)P*GP*CP*GP*C)-3' DNA DNA
1r41	nuc      1.90	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURES OF D(GM5CGM5CGCGC) AND D(GCGCGM5CGM5C): EFFECTS OF METHYLATION ON ALTERNATING DNA OCTAMERS 5'-D(*GP*CP*GP*CP*GP*(5CM)P*GP*(5CM))-3' DNA DNA
1s1l	nuc      2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	INFLUENCE OF GROOVE INTERACTIONS ON THE FORMATION OF DNA HOLLIDAY JUNCTIONS 5'-D(*CP*CP*(OIP)*GP*TP*AP*CP*(5CM)P*GP*G)-3' DNA HOLLIDAY JUNCTION, DNA FOUR-WAY JUNCTION, X-RAY DIFFRACTION, MAJOR GROOVE, INOSINE, MINOR GROOVE
1vtv	nuc      1.30	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O7 P)	MOLECULAR STRUCTURE OF (M5DC-DG)3: THE ROLE OF THE METHYL GR METHYL CYTOSINE IN STABILIZING Z-DNA DNA (5'-D(*(CH3)CP*GP*(CH3)CP*GP*(CH3)CP*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED, DNA
1vtw	nuc      1.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	AT BASE PAIRS ARE LESS STABLE THAN GC BASE PAIRS IN Z-DNA: T STRUCTURE OF D(M(5)CGTAM(5)CG) DNA (5'-D(*(CH3)CP*GP*TP*AP*(CH3)CP*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED, DNA
1y9h	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	METHYLATION OF CYTOSINE AT C5 IN A CPG SEQUENCE CONTEXT CAUSES A CONFORMATIONAL SWITCH OF A BENZO[A]PYRENE DIOL EPOXIDE-N2-GUANINE ADDUCT IN DNA FROM A MINOR GROOVE ALIGNMENT TO INTERCALATION WITH BASE DISPLACEMENT 5'-D(*GP*GP*TP*AP*GP*CP*GP*AP*TP*GP*G)-3', 5'-D(*CP*CP*AP*TP*(5CM)P*(BPG)P*CP*TP*AP*CP*C)- 3' DNA CONFORMATIONAL SWITCH, CYTOSINE METHYLATION, P53 MUTATION HOT SPOT, DNA ADDUCT, BENZO[A]PYRENE, BPDE
213d	nuc      1.60	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF THE A-DNA DECAMER D(CCIGGCCM5CGG) AT 1.6 ANGSTROMS SHOWING THE UNEXPECTED WOBBLE I.M5C BASE PAIR DNA (5'-D(*CP*CP*IP*GP*GP*CP*CP*(5CM)P*GP*G)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
229d	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	DNA ANALOG OF YEAST TRANSFER RNA PHE ANTICODON DOMAIN WITH MODIFIED BASES 5-METHYL CYTOSINE AND 1-METHYL GUANINE DNA (5'-D(*CP*CP*AP*GP*AP*CP*(UMP) P*GP*AP*AP*(MG1)P*AP*(UMP)P*(5CM)P*(UMP)P*GP*G)-3') DNA DNA, TRANSFER RNA, ANTICODON, HAIRPIN LOOP
254d	nuc      1.90	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	ALTERNATING AND NON-ALTERNATING DG-DC HEXANUCLEOTIDES CRYSTALLIZE AS CANONICAL A-DNA DNA (5'-D(*GP*(5CM)P*GP*(5CM)P*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
256d	nuc      2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	ALTERNATING AND NON-ALTERNATING DG-DC HEXANUCLEOTIDES CRYSTALLIZE AS CANONICAL A-DNA DNA (5'-D(*GP*(5CM)P*GP*CP*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
265d	nuc      2.01	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	STRUCTURAL STUDIES ON NUCLEIC ACIDS DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*(5CM)P*GP* CHAIN: A, B DNA B-DNA, DOUBLE HELIX, MODIFIED, DNA
266d	nuc      2.03	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL STUDIES ON NUCLEIC ACIDS DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA B-DNA, DOUBLE HELIX, MODIFIED, DNA
267d	nuc      2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL STUDIES ON NUCLEIC ACIDS DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA B-DNA, DOUBLE HELIX, MODIFIED, COMPLEXED WITH DRUG, DNA
268d	nuc      2.02	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL STUDIES ON NUCLEIC ACIDS DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA B-DNA, DOUBLE HELIX, MODIFIED, COMPLEXED WITH DRUG, DNA
269d	nuc      2.15	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL STUDIES ON NUCLEIC ACIDS DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA B-DNA, DOUBLE HELIX, MODIFIED, COMPLEXED WITH DRUG, DNA
270d	nuc      2.01	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL STUDIES ON NUCLEIC ACIDS DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA B-DNA, DOUBLE HELIX, MODIFIED, DNA
275d	nuc      2.00	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	ALTERNATING AND NON-ALTERNATING DG-DC HEXANUCLEOTIDES CRYSTALLIZE AS CANONICAL A-DNA DNA (5'-D(*GP*(5CM)P*CP*GP*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
285d	nuc      2.50	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	X-RAY AND SOLUTION STUDIES OF DNA OLIGOMERS AND IMPLICATIONS FOR THE STRUCTURAL BASIS OF A-TRACT-DEPENDENT CURVATURE DNA (5'-D(*CP*GP*CP*AP*IP*AP*TP*(5CM) P*TP*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
297d	nuc      2.50	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	X-RAY AND SOLUTION STUDIES OF DNA OLIGOMERS AND IMPLICATIONS FOR THE STRUCTURAL BASIS OF A-TRACT-DEPENDENT CURVATURE DNA (5'-D(*CP*GP*CP*AP*IP*AP*TP*(5CM) P*TP*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
2d25	nuc      1.75	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	C-C-A-G-G-C-M5C-T-G-G; HELICAL FINE STRUCTURE, HYDRATION, AND COMPARISON WITH C-C-A-G-G-C-C-T-G-G DNA (5'-D(*CP*CP*AP*GP*GP*CP*(5CM)P*TP*GP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
313d	nuc      1.68	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	Z-DNA HEXAMER WITH 5' OVERHANGS THAT FORM A REVERSE HOOGSTEEN BASE PAIR DNA (5'-D(*GP*(5CM)P*GP*CP*GP*CP*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED, OVERHANGING BASE, FLIPPED- OUT BASE
322d	nuc      2.50	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURES OF D(CCGGGCCM5CGG)-HEXAGONAL FORM DNA (5'-D(*CP*CP*GP*GP*GP*CP*CP*(5CM)P*GP*G)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
323d	nuc      2.15	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURES OF D(CCGGGCCM5CGG)-ORTHOGONAL FORM DNA (5'-D(*CP*CP*GP*GP*GP*CP*CP*(5CM)P*GP*G)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
324d	nuc      2.15	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURES OF D(CCGGGCCM5CGG)-ORTHOGONAL FORM DNA (5'-D(*CP*CP*GP*GP*GP*CP*CP*(5CM)P*GP*G)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
325d	nuc      2.50	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	CRYSTAL STRUCTURES OF D(CM5CGGGCCM5CGG)-HEXAGONAL FORM DNA (5'-D(*CP*(5CM)P*GP*GP*GP*CP*CP*(5CM)P*GP*G)- 3') DNA A-DNA, DOUBLE HELIX, MODIFIED
326d	nuc      2.15	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	CRYSTAL STRUCTURES OF D(CM5CGGGCCM5CGG)-ORTHOGONAL FORM DNA (5'-D(*CP*(5CM)P*GP*GP*GP*CP*CP*(5CM)P*GP*G)- 3') DNA A-DNA, DOUBLE HELIX, MODIFIED
327d	nuc      1.94	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURES OF D(GM5CGM5CGCGCGC) DNA (5'-D(*GP*(5CM)P*GP*(5CM)P*GP*CP*GP*CP*GP*C)- 3') DNA A-DNA, DOUBLE HELIX, MODIFIED
329d	nuc      2.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	EFFECT OF CYTOSINE METHYLATION ON DNA-DNA RECOGNITION AT CPG STEPS DNA (5'-D(*AP*CP*CP*GP*CP*(5CM) P*GP*GP*CP*GP*CP*C)-3'), DNA (5'-D(*GP*GP*CP*GP*CP*(5CM) P*GP*GP*CP*GP*GP*T)-3') DNA B-DNA, DOUBLE HELIX
337d	nuc      1.85	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*CP*GP*(5CM)P*GP*(5CM)P*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
338d	nuc      1.85	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*(5CM)P*GP*CP*GP*CP*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
339d	nuc      2.20	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*(5CM)P*GP*CP*GP*(5CM)P*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
340d	nuc      1.60	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*(5CM)P*GP*(5CM)P*GP*CP*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
341d	nuc      1.75	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*(5CM)P*GP*(5CM)P*GP*CP*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
342d	nuc      2.10	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 3(C10 H16 N3 O7 P)	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*(5CM)P*GP*(5CM)P*GP*(5CM)P*GP*C)- 3') DNA A-DNA, DOUBLE HELIX, MODIFIED
343d	nuc      2.10	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 8(C10 H16 N3 O7 P)	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*(5CM)P*TP*AP*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
345d	nuc      1.85	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*(5CM)P*GP*CP*GP*CP*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
346d	nuc      2.10	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 3(C10 H16 N3 O7 P)	STRUCTURAL PARAMETERS FROM SINGLE-CRYSTAL STRUCTURES FOR ACCURATE MODELS OF A-DNA DNA (5'-D(*GP*(5CM)P*GP*(5CM)P*GP*(5CM)P*GP*C)- 3') DNA A-DNA, DOUBLE HELIX, MODIFIED
383d	nuc      1.70	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O7 P)	HYDRATION AND RECOGNITION OF METHYLATED CPG STEPS IN DNA DNA (5'-D(*CP*(5CM)P*GP*CP*(5CM)P*GP*GP*(5CM) P*GP*G)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED DEOXYRIBONUCLEIC ACID
384d	nuc      2.15	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O7 P)	HYDRATION AND RECOGNITION OF METHYLATED CPG STEPS IN DNA 5'-D(*CP*(5CM)P*GP*CP*(5CM)P*GP*GP*(5CM)P*GP*G)- 3' DNA A-DNA, DOUBLE HELIX, MODIFIED
400d	nuc      1.65	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	THE INTRINSIC STRUCTURE AND STABILITY OF OUT-OF-ALTERNATION IN Z-DNA DNA (5'-D(*(5CM)P*GP*GP*CP*(5CM)P*G)-3') DNA Z-DNA DOUBLE HELIX, DNA
4c63	nuc      1.32	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	ULTRA HIGH RESOLUTION DICKERSON-DREW DODECAMER B-DNA WITH 5- METHYLCYSTOSINE MODIFICATION 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*5CMP*GP*CP*GP)-3' DNA DNA, CYTOSINE MODIFICATION
4gju	nuc      1.41	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	5-METHYLCYTOSINE MODIFIED DNA OLIGOMER 5-METHYLCYTOSINE MODIFIED DNA OLIGOMER DNA DOUBLE-STRANDED B-DNA, 5-METHYLCYTOSINE, EPIGENETICS, DNA
4glg	nuc      1.72	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	DNA DODECAMER CONTAINING 5-METHYL CYTOSINE DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA B-DNA DODECAMER, EPIGENETICS, 5-METHYL CYTOSINE, DNA
4mkw	nuc      1.22	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	COMPARISON OF THE STRUCTURAL AND DYNAMIC EFFECTS OF 5-METHYL AND 5-CHLOROCYTOSINE IN A CPG DINUCLEOTIDE SEQUENCE 5METHYLC DNA DODECAMER DNA MODIFIED DNA DODECAMER, DNA
4u6l	nuc      1.90	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF DNA/RNA DUPLEX OBTAINED IN THE PRESENCE [CO(NH3)6]CL3 AND SRCL2 DNA (5'-D(*(5CM)P*TP*CP*TP*TP*CP*TP*TP*(5CM))-3') CHAIN: B, RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3') DNA/RNA DNA/RNA HYBRID DUPLEX, ANTISENSE, DNA-RNA COMPLEX
4u6m	nuc      1.90	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF DNA/RNA DUPLEX OBTAINED IN THE PRESENCE SPERMINE DNA (5'-D(*(5CM)P*TP*CP*TP*TP*CP*TP*TP*(5CM))-3') CHAIN: B, RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3') DNA/RNA DNA/RNA HYBRID DUPLEX, ANTISENSE, DNA-RNA COMPLEX
5dsa	nuc      1.69	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF HOLLIDAY JUNCTIONS STABILIZED BY 5-METH IN GCC JUNCTION CORE 5'-D(*CP*CP*GP*GP*CP*GP*5CMP*CP*GP*G)-3' DNA HOLLIDAY JUNCTION, 5-METHYLCYTOSINE, DNA
5l06	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE POSITION DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, CPG SITE
5l2g	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE POSITION DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, CPG SITE
5tmi	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE POSITION AND 9TH POSITION DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*(5CM)P*GP* CHAIN: A, B DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, CPG SITE
5uz1	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE POSITION AND 8-OXOGUANINE AT THE 10TH POSITION DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P* CHAIN: A, B DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, 8-OXOGUANINE, OXIDIZED DNA, CPG SITE
5uz2	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE AND 9TH POSITION AND 8-OXOGUANINE AT THE 10TH POSITION DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8O 3') DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, 8-OXOGUANINE, OXIDIZED DNA, CPG SITE
5uz3	nuc      NMR    	5-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE POSITION AND 8-OXOGUANINE AT THE 10TH POSITION DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(DMC)P*(8OG)P* CHAIN: A, B DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, CPG SITE, 8-OXOGUANINE, 5-METHYLCYTOSINE

5FC    5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1ve8	nuc      1.65	5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H14 N3 O8 P)	X-RAY ANALYSES OF OLIGONUCLEOTIDES CONTAINING 5- FORMYLCYTOSINE, SUGGESTING A STRUCTURAL REASON FOR CODON- ANTICODON RECOGNITION OF MITOCHONDRIAL TRNA-MET; PART 1, D(CGCGAATT(F5C)GCG) 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5FC)P*GP*CP*G)-3' DNA 5-FORMYLCYTOSINE, ANTICODON OF TRNA-MET, DNA DODECAMER
4qc7	nuc      1.90	5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H14 N3 O8 P)	DODECAMER STRUCTURE OF 5-FORMYLCYTOSINE CONTAINING DNA SHORT DNA STRANDS DNA DOUBLE HELIX, B-FORM DNA, 5-FORMYLCYTOSINE, DNA
4qkk	nuc      1.40	5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 3(C10 H14 N3 O8 P)	CRYSTAL STRUCTURE OF AN OLIGONUCLEOTIDE CONTAINING 5-FORMYLC DNA (5'-D(*CP*TP*AP*(5FC)P*GP*(5FC)P*GP*(5FC)P*GP 3') DNA OLIGONUCLEOTIDE, EPIGENETIC TEN-ELEVEN, TRANSLOCATION PROTEI THYMINE DNA GLYCOSYLASE, FORMYLCYTOSINE, DNA
5mvu	nuc      2.30	5-FORMYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 6(C10 H14 N3 O8 P)	CRYSTAL STRUCTURE OF AN A-DNA DODECAMER CONTAINING 5-FORMYLC 3 CONSECUTIVE CPG STEPS DNA DNA A-DNA, DNA, 5-FORMYLCYTOSINE, CPG

5GP    GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1me0	nuc      NMR    	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CHIMERIC HAIRPIN WITH 2',5'-LINKED RNA LOOP AND DNA STEM DNA/RNA (5'-D(*GP*GP*AP*C)-R(P*(U25)P*(U25)P*(C25 D(P*GP*TP*CP*C)-3') DNA, RNA HAIRPIN, (2',5')-RNA, DNA, RNA
1me1	nuc      NMR    	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CHIMERIC HAIRPIN WITH 2',5'-LINKED RNA LOOP AND RNA STEM 5'-R(*GP*GP*AP*CP*(U25)P*(U25)P*(C25)P*(5GP)P*GP* 3' RNA HAIRPIN, (2',5')-RNA, RNA
3slq	nuc      2.50	GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND GUANOSINE-5'-MONOPHOSPHATE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
5dhb	nuc      1.80	GUANOSINE-5'-MONOPHOSPHATE 4(C10 H14 N5 O8 P)	COOPERATIVITY AND DOWNSTREAM BINDING IN RNA REPLICATION RNA (5'-R(*(LCC)P*(TLN)P*(LCG)P*UP*AP*CP*A)-3') RNA RNA, COOPERATIVITY, MONOMER
5dhc	nuc      1.55	GUANOSINE-5'-MONOPHOSPHATE 8(C10 H14 N5 O8 P)	COOPERATIVITY AND DOWNSTREAM BINDING IN RNA REPLICATION RNA (5'-R(*(LCC)P*(LCC)P*(LCA)P*(LCG) P*AP*CP*UP*UP*AP*AP*GP*UP*CP*U)-3') RNA RNA, MONOMER, COOPERATIVITY

5HC    2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'- (DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
4c5x	nuc      1.30	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'- (DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	ULTRA HIGH RESOLUTION DICKERSON-DREW DODECAMER B-DNA WITH 5-HYDROXYMETHYL-CYTOSINE MODIFICATION 5'-D(CP*GP*CP*GP*AP*AP*TP*TP*5HCP*GP*CP*GP)-3': DICKERSON-DREW SEQUENCE DODECAMER DNA DNA, CYTOSINE MODIFICATION
4glc	nuc      1.83	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	DNA DODECAMER CONTAINING 5-HYDROXYMETHYL-CYTOSINE DNA (5'-D(*CP*GP*(5HC)P*GP*AP*AP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA B-DNA DODECAMER, EPIGENETICS, 5-HYDROXYMETHYL CYTOSINE, DNA
4glh	nuc      1.66	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	DNA DODECAMER CONTAINING 5-HYDROXYMETHYL CYTOSINE DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5HC)P*GP*CP*G CHAIN: A, B DNA B-DNA DODECAMER, EPIGENETICS, 5-HYDROXYMETHYL CYTOSINE, DNA
4hli	nuc      1.99	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	DNA DODECAMER CONTAINING 5-HYDROXYMETHYL-CYTOSINE DNA (5'-D(*CP*GP*(5HC)P*GP*AP*AP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA B-DNA DODECAMER, EPIGENETICS, 5-HYDROXYMETHYL CYTOSINE, DNA
4i9v	nuc      1.02	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	THE ATOMIC STRUCTURE OF 5-HYDROXYMETHYL 2'-DEOXYCITIDINE BAS WITH 2'-DEOXYGUANOSINE IN DICKERSON DREW DODECAMER DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5HC)P*GP*CP*G CHAIN: A, B DNA 5-HYDROXYMETHYL 2' DEOXYCITIDINE, 5-HYDROXYMETHYL-DC ADDUCT, DDD, DODECAMER OF B-DNA, DNA
5ch0	nuc      1.40	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C10 H16 N3 O8 P	CRYSTAL STRUCTURE OF AN A-FORM DNA DUPLEX CONTAINING 5- HYDROXYLMETHYLCYTIDINE DNA (5'-R(*G)-D(P*(UMS))-R(P*G)-D(P*T)-R(P*A)-D(P R(P*AP*C)-3') DNA A-FORM DNA DUPLEX, 5HMC, DNA
5cjy	nuc      1.55	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF A B-FORM DNA DUPLEX CONTAINING 5- HYDROXYLMETHYLCYTIDINE DNA (5'-D(*CP*GP*(5HC)P*GP*AP*AP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA DNA DUPLEX, B-FORM, 5-HYDROXYLMETHYLCYTIDINE, DNA
5dsb	nuc      1.50	2'-DEOXY-5-(HYDROXYMETHYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF HOLLIDAY JUNCTIONS STABILIZED BY 5- HYDROXYMETHYLCYTOSINE IN GCC JUNCTION CORE 5'-D(*CP*CP*GP*GP*CP*GP*5HCP*CP*GP*G)-3' DNA HOLLIDAY JUNCTION, 5-HYDROXYMETHYLCYTOSINE, DNA

5IC    5-IODO-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1jzv	nuc      1.70	5-IODO-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 I N3 O8 P)	CRYSTAL STRUCTURE OF A BULGED RNA FROM THE SL2 STEM-LOOP OF THE HIV-1 PSI-RNA 5'-R(*GP*GP*CP*GP*AP*CP*(5BU)P*G)-3', 5'-R(*CP*AP*GP*UP*AP*CP*GP*(5IC)P*C)-3' RNA A-BULGE, A-RNA, HIV-1 SL2, X-RAY

5IU    5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1omk	nuc      1.30	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 I N2 O8 P)	THE CRYSTAL STRUCTURE OF D(CACG(5IU)G) 5'-D(*CP*AP*CP*GP*(5IU)P*G)-3' DNA Z-DNA, 5-IODO-2'-DEOXYURIDINE
454d	nuc      1.20	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 10(C9 H12 I N2 O8 P)	INTERCALATION AND MAJOR GROOVE RECOGNITION IN THE 1.2 A RESOLUTION CRYSTAL STRUCTURE OF RH[ME2TRIEN]PHI BOUND TO 5'-G(5IU)TGCAAC-3' 5'-D(*GP*(5IU)P*TP*GP*CP*AP*AP*C)-3' DNA METALLOINTERCALATOR, INTERCALATION, MAJOR GROOVE RECOGNITION, PHOTOEXCITABLE, DNA
4gre	nuc      1.70	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	DNA HOLLIDAY JUNCTION STABILIZED BY IODINE HALOGEN BOND. I2J OF RELATED REFERENCE DNA (5'-D(*CP*CP*GP*AP*TP*AP*CP*CP*GP*G)-3'), DNA (5'-D(*CP*CP*GP*GP*TP*AP*(IOU)P*CP*GP*G)-3') DNA DNA HOLLIDAY JUNCTION, HALOGEN BOND, DNA
4gs2	nuc      1.90	5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 I N2 O8 P	DNA HOLLIDAY JUNCTION STABILIZED BY IODINE HALOGEN BOND. I1J IN RELATED REFERENCE. DNA (5'-D(*CP*CP*GP*AP*TP*AP*CP*CP*GP*G)-3'), DNA (5'-D(*CP*CP*GP*GP*TP*AP*(5IU)P*CP*GP*G)-3') DNA DNA HOLLIDAY JUNCTION, HALOGEN BOND, DNA

5JO    2'-O-PROP-2-YN-1-YLADENOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
5e36	nuc      1.60	2'-O-PROP-2-YN-1-YLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 3(C13 H16 N5 O7 P)	CRYSTAL STRUCTURE OF 2'-PROPARGYL-MODIFIED DNA 8MER-DUPLEX DNA (5'-D(*GP*(OMU)P*GP*TP*(5JO)P*CP*AP*C)-3') DNA MODIFIED DNA, 2'-PROPARGYL, DNA

5MC    5-METHYLCYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1c2w	nuc      7.50	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	23S RRNA STRUCTURE FITTED TO A CRYO-ELECTRON MICROSCOPIC MAP ANGSTROMS RESOLUTION 23S RIBOSOMAL RNA RIBOSOME 23S RRNA, RIBOSOME, LARGE RIBOSOMAL SUBUNIT, ATOMIC PROTEIN BIOSYNTHESIS, RIBONUCLEIC ACID, EM-RECONSTRUCTION, 3D ARRAN FITTING
1ehz	nuc      1.93	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	THE CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRNA AT 1.93 A TRANSFER RNA (PHE) RNA TRNA, YEAST, PHENYLALANINE, RNA
1evv	nuc      2.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRANSFER RNA AT 2.0 RESOLUTION PHENYLALANINE TRANSFER RNA RNA TRANSFER RNA, PHENYLALANINE, PHE-TRNA, YEAST, AMINO-ACID TRA RNA
1fcw	nuc      17.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 10(C10 H16 N3 O8 P)	TRNA POSITIONS DURING THE ELONGATION CYCLE TRNAPHE RIBOSOME RIBOSOME, TRNA BINDING SITES, PROTEIN SYNTHESIS, ELONGATION
1fir	nuc      3.30	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) RNA MAMMALIAN TRANSFERT RIBONUCLEIC ACID, HIV-1 PRIMER TRNA, AMI TRANSPORT, CANONICAL TRNA STRUCTURE, CANONICAL ANTICODON, FRAMESHIFTING, CODON/ANTICODON MIMICRY, MODIFIED BASES, RNA
1ipl	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3' RIBONUCLEIC ACID TRANSLOCATION, LARGE RIBOSOMAL RNA, SMALL RIBOSOMAL RNA, TRNA, MRNA
1k7n	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 2) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7o	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 3) P-SITE TRNA, A-SITE TRNA, MRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7p	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 4) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7r	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 1) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1ks1	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	A MODEL FOR A FIVE-PRIME STACKED TRNA PHENYLALANINE TRANSFER RNA RIBONUCLEIC ACID FIVE-PRIME STACK, TRNA
1luu	nuc      NMR    	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	NMR SOLUTION STRUCTURE OF THE ANTICODON OF YEAST TRNA-PHE WITH 4 MODIFICATIONS (OMC32 OMG34 1MG37 5MC40) 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG) P*AP*AP*(1MG)P*AP*UP*(5MC)P*UP*GP*G)-3' RNA TRNA, ANTICODON STEM LOOP, TRNA DOMAIN, RNA HAIRPIN, 1MG, 2'-O-METHYL, 5MC
1lux	nuc      NMR    	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	NMR SOLUTION STRUCTURE OF THE ANTICODON OF YEAST TRNA-PHE WITH 3 MODIFICATIONS (OMC32 OMG34 M5C40) 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG) P*AP*AP*GP*AP*UP*(5MC)P*UP*GP*G)-3' RNA TRNA, ANTICODON STEM LOOP, TRNA DOMAIN, RNA HAIRPIN, 2'-O- METHYL, M5C
1nrt	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 6(C10 H16 N3 O8 P)	APE-SITE TRNA, THEORETICAL MODEL TRANSFER RIBONUCLEIC ACID AMINO-ACID TRANSPORT AMINO-ACID TRANSPORT, TRNA, MODEL
1q49	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1q5s	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxu	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxv	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rcz	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd0	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B2) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd1	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C2) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd2	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1tn1	nuc      3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE TRNA TRNAPHE RNA TRANSLATION, RNA
1tn2	nuc      3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE T-RNA TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1tra	nuc      3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	RESTRAINED REFINEMENT OF THE MONOCLINIC FORM OF YEAST PHENYL TRANSFER RNA. TEMPERATURE FACTORS AND DYNAMICS, COORDINATED AND BASE-PAIR PROPELLER TWIST ANGLES TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1vtq	nuc      3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	THREE-DIMENSIONAL STRUCTURE OF YEAST T-RNA-ASP. I. STRUCTURE DETERMINATION TRNAASP RNA T-RNA, SINGLE STRAND, LOOPS, RNA
1yfg	nuc      3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	YEAST INITIATOR TRNA YEAST INITIATOR TRNA T-RNA AMINO ACID TRANSPORT, TRANSFER RIBONUCLEIC ACID, T-RNA
2tra	nuc      3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPA AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAASP T-RNA T-RNA, SINGLE STRAND, LOOPS
2z9q	nuc      11.70	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	TRANSFER RNA IN THE HYBRID P/E STATE TRNA RNA DISTORTED ANTICODON-STEM-LOOP, TWISTED CCA ARM, RNA
3tra	nuc      3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPARTIC ACID AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAASP T-RNA T-RNA, SINGLE STRAND, LOOPS
486d	nuc      7.50	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 4(C10 H16 N3 O8 P)	X-RAY CRYSTAL STRUCTURES OF 70S RIBOSOME FUNCTIONAL COMPLEXE E-SITE TRNA OF 70S RIBOSOME, A-SITE TRNA OF 70S RIBOSOME, P-SITE CODON OF 70S RIBOSOME, P-SITE TRNA OF 70S RIBOSOME, A-SITE CODON OF 70S RIBOSOME, 900 STEM-LOOP OF 16S RRNA IN THE 70S RIBOSOME, PENULTIMATE STEM OF 16S RRNA IN THE 70S RIBOSOME RIBOSOME FUNCTIONAL MODELS OF 70S RIBOSOME, TRNA, RIBOSOME
4tna	nuc      2.50	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	FURTHER REFINEMENT OF THE STRUCTURE OF YEAST T-RNA-PHE TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
4tra	nuc      3.00	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPA AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
5tra	nuc      model  	5-METHYLCYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O8 P	SOLUTION STRUCTURE OF A TRNA WITH A LARGE VARIABLE REGION: YEAST TRNA-SER T-RNA (85-MER) AMINO-ACID TRANSPORT T-RNA
6tna	nuc      2.70	5-METHYLCYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE T-RNA. I.CRYSTALLOG REFINEMENT TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS

5MU    5-METHYLURIDINE 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1c2w	nuc      7.50	5-METHYLURIDINE 5'-MONOPHOSPHATE 4(C10 H15 N2 O9 P)	23S RRNA STRUCTURE FITTED TO A CRYO-ELECTRON MICROSCOPIC MAP ANGSTROMS RESOLUTION 23S RIBOSOMAL RNA RIBOSOME 23S RRNA, RIBOSOME, LARGE RIBOSOMAL SUBUNIT, ATOMIC PROTEIN BIOSYNTHESIS, RIBONUCLEIC ACID, EM-RECONSTRUCTION, 3D ARRAN FITTING
1ehz	nuc      1.93	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	THE CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRNA AT 1.93 A TRANSFER RNA (PHE) RNA TRNA, YEAST, PHENYLALANINE, RNA
1evv	nuc      2.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRANSFER RNA AT 2.0 RESOLUTION PHENYLALANINE TRANSFER RNA RNA TRANSFER RNA, PHENYLALANINE, PHE-TRNA, YEAST, AMINO-ACID TRA RNA
1fcw	nuc      17.00	5-METHYLURIDINE 5'-MONOPHOSPHATE 5(C10 H15 N2 O9 P)	TRNA POSITIONS DURING THE ELONGATION CYCLE TRNAPHE RIBOSOME RIBOSOME, TRNA BINDING SITES, PROTEIN SYNTHESIS, ELONGATION
1i9v	nuc      2.60	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE ANALYSIS OF A TRNA-NEOMYCIN COMPLEX PHENYLALANINE TRANSFER RNA RNA AMINO-ACID TRANSPORT, YEAST, PHE-TRNA,PHENYLALANINE, TRANSFER RNA, AMINOGLYCOSIDE, NEOMYCIN B
1ipl	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3' RIBONUCLEIC ACID TRANSLOCATION, LARGE RIBOSOMAL RNA, SMALL RIBOSOMAL RNA, TRNA, MRNA
1ipx	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRANSFER RNA BOUND TO P SITE, TRANSFER RNA BOUND TO R SITE RIBONUCLEIC ACID TRNA-TRNA INTERACTION
1ipz	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRANSFER RNA BOUND TO P SITE, TRANSFER RNA BOUND TO R SITE RIBONUCLEIC ACID NONCOGNATE TRNA-TRNA INTERACTION
1k7n	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 2) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7o	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 3) P-SITE TRNA, A-SITE TRNA, MRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7p	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 4) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7r	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 1) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1kos	nuc      NMR    	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	SOLUTION NMR STRUCTURE OF AN ANALOG OF THE YEAST TRNA PHE T STEM LOOP CONTAINING RIBOTHYMIDINE AT ITS NATURALLY OCCURRING POSITION 5'-R(*CP*UP*GP*UP*GP*(5MU)P*UP*CP*GP*AP*UP*(CH) P*CP*AP*CP*AP*G)- 3': TPSIC DOMAIN OF TRNA RNA TRNA, T STEM LOOP, TRNA DOMAIN, RNA HAIRPIN, RNA FOLDING
1ks1	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	A MODEL FOR A FIVE-PRIME STACKED TRNA PHENYLALANINE TRANSFER RNA RIBONUCLEIC ACID FIVE-PRIME STACK, TRNA
1q49	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1q5s	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxu	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxv	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rcz	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd0	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B2) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd1	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C2) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd2	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE 2(C10 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1tn1	nuc      3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE TRNA TRNAPHE RNA TRANSLATION, RNA
1tn2	nuc      3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE T-RNA TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1tra	nuc      3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	RESTRAINED REFINEMENT OF THE MONOCLINIC FORM OF YEAST PHENYL TRANSFER RNA. TEMPERATURE FACTORS AND DYNAMICS, COORDINATED AND BASE-PAIR PROPELLER TWIST ANGLES TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1vtq	nuc      3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	THREE-DIMENSIONAL STRUCTURE OF YEAST T-RNA-ASP. I. STRUCTURE DETERMINATION TRNAASP RNA T-RNA, SINGLE STRAND, LOOPS, RNA
2tra	nuc      3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPA AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAASP T-RNA T-RNA, SINGLE STRAND, LOOPS
2z9q	nuc      11.70	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	TRANSFER RNA IN THE HYBRID P/E STATE TRNA RNA DISTORTED ANTICODON-STEM-LOOP, TWISTED CCA ARM, RNA
3bbv	nuc      10.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	THE TRNA(PHE) FITTED INTO THE LOW RESOLUTION CRYO-EM MAP OF 50S.NC-TRNA.HSP15 COMPLEX TRNA(PHE) RIBOSOME PHE, TRNA, RESCUE STALLED RIBOSOME, RIBOSOME
3cw5	nuc      3.10	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	E. COLI INITIATOR TRNA INITIATOR TRNA RNA TRNA, INITIATOR, RNA
3cw6	nuc      3.30	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	E. COLI INITIATOR TRNA INITIATOR TRNA RNA TRNA, INITIATOR, RNA
3tra	nuc      3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPARTIC ACID AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAASP T-RNA T-RNA, SINGLE STRAND, LOOPS
486d	nuc      7.50	5-METHYLURIDINE 5'-MONOPHOSPHATE 3(C10 H15 N2 O9 P)	X-RAY CRYSTAL STRUCTURES OF 70S RIBOSOME FUNCTIONAL COMPLEXE E-SITE TRNA OF 70S RIBOSOME, A-SITE TRNA OF 70S RIBOSOME, P-SITE CODON OF 70S RIBOSOME, P-SITE TRNA OF 70S RIBOSOME, A-SITE CODON OF 70S RIBOSOME, 900 STEM-LOOP OF 16S RRNA IN THE 70S RIBOSOME, PENULTIMATE STEM OF 16S RRNA IN THE 70S RIBOSOME RIBOSOME FUNCTIONAL MODELS OF 70S RIBOSOME, TRNA, RIBOSOME
4tna	nuc      2.50	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	FURTHER REFINEMENT OF THE STRUCTURE OF YEAST T-RNA-PHE TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
4tra	nuc      3.00	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPA AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
5l4o	nuc      2.80	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	STRUCTURE OF AN E.COLI INITIATOR TRNAFMET A1-U72 VARIANT TRNA (76-MER) TRANSLATION TRNA-TRANSLATION INITIATION, TRANSLATION
5tra	nuc      model  	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	SOLUTION STRUCTURE OF A TRNA WITH A LARGE VARIABLE REGION: YEAST TRNA-SER T-RNA (85-MER) AMINO-ACID TRANSPORT T-RNA
6tna	nuc      2.70	5-METHYLURIDINE 5'-MONOPHOSPHATE C10 H15 N2 O9 P	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE T-RNA. I.CRYSTALLOG REFINEMENT TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS

5OC    2'-DEOXY-5-HYDROXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2mo2	nuc      NMR    	2'-DEOXY-5-HYDROXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C9 H14 N3 O8 P)	SOLUTION NMR STRUCTURE OF DNA DODECAMER CONTAINING THE 5- HYDROXYCYTOSINE DNA_(5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5OC)P*GP*CP*G CHAIN: A, B DNA DNA, 5-HYDROXYCYTOSINE
4f3u	nuc      1.40	2'-DEOXY-5-HYDROXYCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C9 H14 N3 O8 P)	CRYSTAL STRUCTURE OF 5-HYDROXY-2'-DEOXYCYTIDINE BASE PAIRED DEOXYGUANOSINE IN DICKERSON DREW DODECAMER DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5OC)P*GP*CP*G CHAIN: A, B DNA 5-HYDROXY-DC, MODIFIED DICKERSON, 5-HYDROXY-2'-DEOXYCYTIDINE

5PC    5(1-PROPYNYL)-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1nts	nuc      NMR    	5(1-PROPYNYL)-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE 4(C12 H16 N3 O7 P)	5'(DCCPUPCPCPUPUP)3':3'(RAGGAGGAAA)5', WHERE P=PROPYNYL 5'-D(*(5PC)P*(5PC)P*(PDU)P*(5PC)P*(5PC)P*(PDU) P*(PDU))-3', 5'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3' RNA/DNA DNA, RNA, HYBRID, PROPYNYL, RNA/DNA COMPLEX
1ntt	nuc      NMR    	5(1-PROPYNYL)-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE 3(C12 H16 N3 O7 P)	5'(DCPCPUPCPCPUPUP)3':(RAGGAGGAAA)5', WHERE P=PROPYNYL 5'-D(*CP*(5PC)P*(PDU)P*(5PC)P*(5PC)P*(PDU) P*(PDU))-3', 5'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3' RNA/DNA DNA, RNA, HYBRID, PROPYNYL, RNA/DNA COMPLEX
1oo7	nuc      NMR    	5(1-PROPYNYL)-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE 3(C12 H16 N3 O7 P)	DNA.RNA HYBRID DUPLEX CONTAINING A 5-PROPYNE DNA STRAND AND PURINE-RICH RNA STRAND, NMR, 4 STRUCTURES 5'-D(*GP*(5PC)P*(PDU)P*(PDU)P*(5PC)P*(PDU) P*(5PC)P*(PDU)P*(PDU)P*C)-3', 5'-R(*GP*AP*AP*GP*AP*GP*AP*AP*GP*C)-3' DNA-RNA HYBRID DNA.RNA HYBRID, PURINE/PYRIMIDINE-RICH STRANDS, ANTISENSE, DNA/RNA COMPLEX, DNA-RNA HYBRID

5PM    4,4'-SULFANEDIYLBIS{N-[(1E)-PYRIDIN-2- YLMETHYLIDENE]ANILINE}

Code	Class Resolution	Description
3fx8	nuc      2.44	4,4'-SULFANEDIYLBIS{N-[(1E)-PYRIDIN-2- YLMETHYLIDENE]ANILINE} 2(C24 H18 N4 S)	DISTINCT RECOGNITION OF THREE-WAY DNA JUNCTIONS BY A THIOESTER VARIANT OF A METALLO-SUPRAMOLECULAR CYLINDER ('HELICATE') (5'-D(*CP*GP*TP*AP*CP*G)-3' DNA SELF-ASSEMBLY, DNA-BASED NANOMATERIAL, DNA

5SB   

Code	Class Resolution	Description
2irl	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 1,2-BIS[5-(2-IMIDAZOLINYL)-2-BENZIMIDAZOLYL]ETHANE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

5SE    2'-DEOXY-5-(METHYLSELANYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
3ijn	nuc      1.80	2'-DEOXY-5-(METHYLSELANYL)CYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C10 H16 N3 O7 P SE	5-SEME-CYTIDINE MODIFIED DNA 8MER 5'-D(*GP*(UMS)P*GP*TP*AP*(5SE)P*AP*C)-3' DNA SELENIUM, DNA, 5-SEME-CYTIDINE

61Q    4-(3-AMINOPROPOXY)-8-({[4-(3-AMINOPROPOXY)-8-({[4-(3- AMINOPROPOXY)-8-({[4-(3-AMINOPROPOXY)-8-NITROQUINOLIN- 2-YL]CARBONYL}AMINO)QUINOLIN-2-YL]CARBONYL}AMINO) QUINOLIN-2-YL]CARBONYL}AMINO)QUINOLINE-2-CARBOXYLIC ACID

Code	Class Resolution	Description
5hix	nuc      2.48	4-(3-AMINOPROPOXY)-8-({[4-(3-AMINOPROPOXY)-8-({[4-(3- AMINOPROPOXY)-8-({[4-(3-AMINOPROPOXY)-8-NITROQUINOLIN- 2-YL]CARBONYL}AMINO)QUINOLIN-2-YL]CARBONYL}AMINO) QUINOLIN-2-YL]CARBONYL}AMINO)QUINOLINE-2-CARBOXYLIC ACID C52 H52 N12 O11	COCRYSTAL STRUCTURE OF AN ANTI-PARALLEL DNA G-QUADRUPLEX AND QUINOLINE FOLDAMER DIMERIC G-QUADRUPLEX DNA DNA G-QUADRUPLEX, FOLDAMER, FOLDAMER-QUADRUPLEX, G-QUADRUPLE LIGANDS, DNA

63G    (6S)-3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-HYDROXY-5,6,7,8- TETRAHYDROPYRIMIDO[1,2-A]PURIN-10(3H)-ONE

Code	Class Resolution	Description
2kd9	nuc      NMR    	(6S)-3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-HYDROXY-5,6,7,8- TETRAHYDROPYRIMIDO[1,2-A]PURIN-10(3H)-ONE C13 H18 N5 O8 P	SOLUTION STRUCTURE OF DNA CONTAINING ALPHA-OH-PDG: THE MUTAGENIC ADDUCT PRODUCED BY ACROLEIN 5'-D(*CP*GP*TP*AP*CP*(63G)P*CP*AP*TP*GP*C)-3', 5'-D(*GP*CP*AP*TP*GP*CP*GP*TP*AP*CP*G)-3' DNA ACROLEIN LESIONS, DNA DAMAGED, DNA STRUCTURE, EXOCYCLIC, PROPANO-DG LESIONS
2lt0	nuc      NMR    	(6S)-3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-HYDROXY-5,6,7,8- TETRAHYDROPYRIMIDO[1,2-A]PURIN-10(3H)-ONE C13 H18 N5 O8 P	NMR STRUCTURE OF DUPLEX DNA CONTAINING THE BETA-OH-PDG DA BA MUTAGENIC INTERMEDIATE OF ACROLEIN DNA (5'-D(*GP*CP*AP*TP*GP*AP*GP*TP*AP*CP*G)-3'), DNA (5'-D(*CP*GP*TP*AP*CP*(63G)P*CP*AP*TP*GP*C)-3 CHAIN: B DNA ACROLEIN ADDUCTS, DNA LESIONS, DAMAGED DNA STRUCTURE, DNA

63H    (6R)-3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-HYDROXY-5,6,7,8- TETRAHYDROPYRIMIDO[1,2-A]PURIN-10(3H)-ONE

Code	Class Resolution	Description
2kda	nuc      NMR    	(6R)-3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-HYDROXY-5,6,7,8- TETRAHYDROPYRIMIDO[1,2-A]PURIN-10(3H)-ONE C13 H18 N5 O8 P	SOLUTION STRUCTURE OF DNA CONTAINING ALPHA-OH-PDG: THE MUTAGENIC ADDUCT PRODUCED BY ACROLEIN 5'-D(*GP*CP*AP*TP*GP*CP*GP*TP*AP*CP*G)-3', 5'-D(*CP*GP*TP*AP*CP*(63H)P*CP*AP*TP*GP*C)-3' DNA ACROLEIN LESIONS, DNA DAMAGED, DNA STRUCTURE, EXOCYCLIC, PROPANO-DG LESIONS
2lsz	nuc      NMR    	(6R)-3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-6-HYDROXY-5,6,7,8- TETRAHYDROPYRIMIDO[1,2-A]PURIN-10(3H)-ONE C13 H18 N5 O8 P	NMR STRUCTURE OF DUPLEX DNA CONTAINING THE ALPHA-OH-PDG DA B A MUTAGENIC INTERMEDIATE OF ACROLEIN DNA (5'-D(*CP*GP*TP*AP*CP*(63H)P*CP*AP*TP*GP*C)-3 CHAIN: B, DNA (5'-D(*GP*CP*AP*TP*GP*AP*GP*TP*AP*CP*G)-3') DNA ACROLEIN ADDUCTS, DNA LESIONS, DAMAGED DNA STRUCTURE, DNA

63T    [(2R,3S)-3-HYDROXY-5-OXOTETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHATE (NON-PREFERRED NAME)

Code	Class Resolution	Description
5hqf	nuc      NMR    	[(2R,3S)-3-HYDROXY-5-OXOTETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHATE (NON-PREFERRED NAME) C5 H9 O7 P	DNA DUPLEX CONTAINING A RIBONOLACTONE LESION DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3 CHAIN: B, DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3 CHAIN: A DNA DNA LESION, CLUSTER 8-OXO-GUANINE RIBONOLACTONE, DNA
5hqq	nuc      NMR    	[(2R,3S)-3-HYDROXY-5-OXOTETRAHYDROFURAN-2-YL]METHYL DIHYDROGEN PHOSPHATE (NON-PREFERRED NAME) C5 H9 O7 P	DNA DUPLEX CONTAINING A RIBONOLACTONE LESION DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3 CHAIN: A, DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3 CHAIN: B DNA DNA LESION CLUSTER 8-OXO-GUANINE RIBONOLACTONE, DNA

64T    5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1cfl	nuc      NMR    	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	DNA DECAMER DUPLEX CONTAINING T5-T6 PHOTOADDUCT DNA (5'-D(*GP*CP*GP*TP*GP*AP*TP*GP*CP*G)-3'), DNA (5'-D(*CP*GP*CP*AP*(64T)P*TP*AP*CP*GP*C)-3') DNA NMR, DNA PHOTOPRODUCT, (6-4) ADDUCT, MUTAGENESIS, DEOXYRIBONUCLEIC ACID
1qkg	nuc      NMR    	5-HYDROXY-THYMIDINE-5'-MONOPHOSPHATE C10 H17 N2 O9 P	DNA DECAMER DUPLEX CONTAINING T-T DEWAR PHOTOPRODUCT DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3'), DNA (5'-D(*GP*CP*GP*TP*GP*AP*TP*GP*CP*G)-3') DNA DEOXYRIBONUCLEIC ACID, DNA PHOTOPRODUCT, DEWAR PRODUCT, (6-4) ADDUCT, MUTAGENESIS, TRANSLESION REPLICATION

6AP    9H-PURINE-2,6-DIAMINE

Code	Class Resolution	Description
2b57	nuc      2.15	9H-PURINE-2,6-DIAMINE C5 H6 N6	GUANINE RIBOSWITCH C74U MUTANT BOUND TO 2,6-DIAMINOPURINE 65-MER: G-BOX RNA RNA RNA-LIGAND COMPLEX, DOUBLE HELIX, BASE TRIPLES, BASE QUADRUPLES, MRNA, PURINE
4feo	nuc      1.60	9H-PURINE-2,6-DIAMINE C5 H6 N6	CRYSTAL STRUCTURE OF THE AU25A/A46G/C74U MUTANT XPT-PBUX GUA RIBOSWITCH APTAMER DOMAIN IN COMPLEX WITH 2,6-DIAMINOPURINE U25A/A46G/C74U MUTANT OF THE B. SUBTILIS XPT-PBUX RIBOSWITCH APTAMER DOMAIN RNA THREE-WAY JUNCTION WITH DISTAL TERTIARY INTERACTION, GENETIC REGULATORY ELEMENT, 2,6-DIAMINOPURINE, RNA
4fep	nuc      1.65	9H-PURINE-2,6-DIAMINE C5 H6 N6	CRYSTAL STRUCTURE OF THE A24U/U25A/A46G/C74U MUTANT XPT-PBUX RIBOSWITCH APTAMER DOMAIN IN COMPLEX WITH 2,6-DIAMINOPURINE A24U/U25A/A46G/C74U MUTANT OF THE B. SUBTILIS XPT GUANINE RIBOSWITCH APTAMER DOMAIN RNA THREE-WAY JUNCTION WITH DISTAL TERTIARY INTERACTION, GENETIC REGULATORY ELEMENT, 2,6-DIAMINOPURINE, RNA
4lvz	nuc      1.77	9H-PURINE-2,6-DIAMINE C5 H6 N6	STRUCTURE OF THE THF RIBOSWITCH BOUND TO 2,6-DIAMINOPURINE THF RIBOSWITCH RNA APTAMERS, NUCLEOTIDE, BACILLUS SUBTILIS, BACTERIAL PROTEINS, SEQUENCE, BINDING SITES, CALORIMETRY, FOLIC ACID, GENE EXPR REGULATION, BACTERIAL, GUANINE, LEUCOVORIN, LIGANDS, MAGNES MOLECULAR SEQUENCE DATA, NUCLEIC ACID CONFORMATION, POINT M PROTEIN BINDING, PROTEIN STRUCTURE, SECONDARY, RNA, RIBOSWI ADENOSYLMETHIONINE, STREPTOCOCCUS MUTANS, TERMINATOR REGION GENETIC, TETRAHYDROFOLATES, THERMODYNAMICS, TRANSCRIPTION, JUNCTION, PSEUDOKNOT, REGULATION, NCRNA, 2,6-DIAMINOPURINE,

6F7    3'-DEOXY-5-METHYLURIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
5j02	nuc      3.49	3'-DEOXY-5-METHYLURIDINE 5'-(DIHYDROGEN PHOSPHATE) C10 H15 N2 O8 P	STRUCTURE OF THE LARIAT FORM OF A CHIMERIC DERIVATIVE OF THE OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE PRESENCE OF MG2+ AND AN INACTIVE 5' EXON. GROUP II INTRON LARIAT, 5' EXON ANALOG (5'-R(*CP*UP*GP*UP*UP*AP*(5MU))-3' CHAIN: B RNA GROUP II INTRON, LARIAT, 2'-5' PHOSPHODIESTER BOND, RIBOZYME CATALYSIS, SELF-SPLICING, RNA

6FC    2'-TRIFLUOROMETHYLTHIO-2'-DEOXYCYTIDINE

Code	Class Resolution	Description
4nlf	nuc      1.00	2'-TRIFLUOROMETHYLTHIO-2'-DEOXYCYTIDINE C10 H15 F3 N3 O7 P S	2'-TRIFLUOROMETHYLTHIO-2'-DEOXYCYTIDINE-MODIFIED SRL 23S RIBOSOMAL RNA SARCIN RICIN LOOP RNA RNA HAIRPIN, STRUCTURAL, RNA

6FU    2'-TRIFLUOROMETHYLTHIO-2'-DEOXYURIDINE

Code	Class Resolution	Description
4nmg	nuc      1.01	2'-TRIFLUOROMETHYLTHIO-2'-DEOXYURIDINE C10 H14 F3 N2 O8 P S	2'-TRIFLUOROMETHYLTHIO-2'-DEOXYURIDINE-MODIFIED SRL 23S RIBOSOMAL RNA SARCIN RICIN LOOP RNA RNA HAIRPIN, STRUCTURAL, RNA
4nxh	nuc      1.16	2'-TRIFLUOROMETHYLTHIO-2'-DEOXYURIDINE C10 H14 F3 N2 O8 P S	2'-TRIFLUOROMETHYLTHIOURIDINE-MODIFIED E. COLI 23S RRNA SARC LOOP 23S RIBOSOMAL RNA SARCIN RICIN LOOP RNA HAIRPIN, STRUCTURAL, RNA

6GO    6-O-METHYLGUANINE

Code	Class Resolution	Description
3fo6	nuc      1.90	6-O-METHYLGUANINE C6 H7 N5 O	CRYSTAL STRUCTURE OF GUANINE RIBOSWITCH BOUND TO 6-O- METHYLGUANINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, 6-O-METHYLGUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION
3ges	nuc      2.15	6-O-METHYLGUANINE C6 H7 N5 O	CRYSTAL STRUCTURE OF THE GUANINE RIBOSWITCH C74U MUTANT BOUND TO 6-O-METHYLGUANINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION, BASE TRIPLE

6GU    6-CHLOROGUANINE

Code	Class Resolution	Description
3fo4	nuc      1.90	6-CHLOROGUANINE C5 H4 CL N5	CRYSTAL STRUCTURE OF GUANINE RIBOSWITCH C74U MUTANT BOUND TO 6-CHLOROGUANINE GUANINE RIBOSWITCH C74U MUTANT RNA MRNA, RIBOSWITCH, 6-CHLOROGUANINE, ADENINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION
3ger	nuc      1.70	6-CHLOROGUANINE C5 H4 CL N5	GUANINE RIBOSWITCH BOUND TO 6-CHLOROGUANINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION, BASE TRIPLE
3gog	nuc      2.10	6-CHLOROGUANINE C5 H4 CL N5	GUANINE RIBOSWITCH A21G,U75C MUTANT BOUND TO 6-CHLOROGUANINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION, BASE TRIPLE

6HA    1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(ADENIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL

Code	Class Resolution	Description
1d7z	nuc      2.21	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(ADENIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF A HEXITOL NUCLEIC ACID (HNA) DUPLEX AT 2.2 A RESOLUTION 5'-H(*(6HG)P*(6HT)P*(6HG)P*(6HT)P*(6HA)P*(6HC) P*(6HA)P*(6HC))-3' DNA HEXITOL NUCLEIC ACID, DNA ANALOGUE, DOUBLE HELIX
1ejz	nuc      NMR    	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(ADENIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL C11 H16 N5 O6 P	SOLUTION STRUCTURE OF A HNA-RNA HYBRID DNA (5'-H(*(6HG)P*(6HC)P*(6HG)P*(6HT)P*(6HA) P*(6HG)P*(6HC)P*(6HG))-3'), RNA (5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3') RNA HNA-RNA COMPLEX, DOUBLE HELIX, A-TYPE CONFORMATION
2bj6	nuc      2.60	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(ADENIN-9-YL)- 6'-O-PHOSPHORYL-D-ARABINO-HEXITOL 8()	CRYSTAL STRUCTURE OF A DECAMERIC HNA-RNA HYBRID SYNTHETIC HNA, 5'-R(*GP*GP*CP*AP*UP*UP*AP*CP*GP*GP)-3' NUCLEIC ACID (HNA/RNA) NUCLEIC ACID (HNA/RNA), DNA, RNA, HNA, HEXITOL NUCLEIC ACID, HYBRID, DUPLEX, MODIFIED NUCLEIC ACID, ANTISENSE, BACKBONE MODIFICATION
481d	nuc      1.60	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(ADENIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C11 H16 N5 O6 P)	CRYSTAL STRUCTURE OF A HEXITOL NUCLEIC ACID (HNA) DUPLEX AT 1.6A RESOLUTION 5'-H(*(6HG)P*(6HT)P*(6HG)P*(6HT)P*(6HA)P*(6HC) P*(6HA)P*(6HC))-3' DNA HEXITOL NUCLEIC ACID, DNA ANALOGUE, DOUBLE HELIX

6HB    2'-DEOXY-N-[(2S)-2-HYDROXYBUT-3-EN-1-YL]ADENOSINE 5'- (DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2mnx	nuc      NMR    	2'-DEOXY-N-[(2S)-2-HYDROXYBUT-3-EN-1-YL]ADENOSINE 5'- (DIHYDROGEN PHOSPHATE) C14 H20 N5 O7 P	MAJOR GROOVE ORIENTATION OF THE (2S)-N6-(2-HYDROXY-3-BUTEN-1 DEOXYADENOSINE DNA ADDUCT INDUCED BY 1,2-EPOXY-3-BUTENE 5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP*G)-3', 5'-D(*CP*GP*GP*AP*CP*(6HB)P*AP*GP*AP*AP*G)-3' DNA B-FORM, 11-MER, DNA

6HC    1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(CYTOSIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL

Code	Class Resolution	Description
1d7z	nuc      2.21	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(CYTOSIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF A HEXITOL NUCLEIC ACID (HNA) DUPLEX AT 2.2 A RESOLUTION 5'-H(*(6HG)P*(6HT)P*(6HG)P*(6HT)P*(6HA)P*(6HC) P*(6HA)P*(6HC))-3' DNA HEXITOL NUCLEIC ACID, DNA ANALOGUE, DOUBLE HELIX
1ec4	nuc      NMR    	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(CYTOSIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 8(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF A HEXITOL NUCLEIC ACID DUPLEX WITH FOUR CONSECUTIVE T:T BASE PAIRS HEXITOL DODECANUCLEOTIDE DNA DOUBLE HELIX, ANTISENSE, HEXITOL NUCLEIC ACID, DNA
1ejz	nuc      NMR    	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(CYTOSIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C10 H16 N3 O7 P)	SOLUTION STRUCTURE OF A HNA-RNA HYBRID DNA (5'-H(*(6HG)P*(6HC)P*(6HG)P*(6HT)P*(6HA) P*(6HG)P*(6HC)P*(6HG))-3'), RNA (5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3') RNA HNA-RNA COMPLEX, DOUBLE HELIX, A-TYPE CONFORMATION
2bj6	nuc      2.60	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(CYTOSIN-1-YL) -6'-O-PHOSPHORYL-D-ARABINO-HEXITOL 16()	CRYSTAL STRUCTURE OF A DECAMERIC HNA-RNA HYBRID SYNTHETIC HNA, 5'-R(*GP*GP*CP*AP*UP*UP*AP*CP*GP*GP)-3' NUCLEIC ACID (HNA/RNA) NUCLEIC ACID (HNA/RNA), DNA, RNA, HNA, HEXITOL NUCLEIC ACID, HYBRID, DUPLEX, MODIFIED NUCLEIC ACID, ANTISENSE, BACKBONE MODIFICATION
481d	nuc      1.60	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(CYTOSIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C10 H16 N3 O7 P)	CRYSTAL STRUCTURE OF A HEXITOL NUCLEIC ACID (HNA) DUPLEX AT 1.6A RESOLUTION 5'-H(*(6HG)P*(6HT)P*(6HG)P*(6HT)P*(6HA)P*(6HC) P*(6HA)P*(6HC))-3' DNA HEXITOL NUCLEIC ACID, DNA ANALOGUE, DOUBLE HELIX

6HG    1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(GUANIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL

Code	Class Resolution	Description
1d7z	nuc      2.21	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(GUANIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF A HEXITOL NUCLEIC ACID (HNA) DUPLEX AT 2.2 A RESOLUTION 5'-H(*(6HG)P*(6HT)P*(6HG)P*(6HT)P*(6HA)P*(6HC) P*(6HA)P*(6HC))-3' DNA HEXITOL NUCLEIC ACID, DNA ANALOGUE, DOUBLE HELIX
1ec4	nuc      NMR    	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(GUANIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 8(C11 H16 N5 O7 P)	SOLUTION STRUCTURE OF A HEXITOL NUCLEIC ACID DUPLEX WITH FOUR CONSECUTIVE T:T BASE PAIRS HEXITOL DODECANUCLEOTIDE DNA DOUBLE HELIX, ANTISENSE, HEXITOL NUCLEIC ACID, DNA
1ejz	nuc      NMR    	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(GUANIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 4(C11 H16 N5 O7 P)	SOLUTION STRUCTURE OF A HNA-RNA HYBRID DNA (5'-H(*(6HG)P*(6HC)P*(6HG)P*(6HT)P*(6HA) P*(6HG)P*(6HC)P*(6HG))-3'), RNA (5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3') RNA HNA-RNA COMPLEX, DOUBLE HELIX, A-TYPE CONFORMATION
2bj6	nuc      2.60	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(GUANIN-9-YL)- 6'-O-PHOSPHORYL-D-ARABINO-HEXITOL 8()	CRYSTAL STRUCTURE OF A DECAMERIC HNA-RNA HYBRID SYNTHETIC HNA, 5'-R(*GP*GP*CP*AP*UP*UP*AP*CP*GP*GP)-3' NUCLEIC ACID (HNA/RNA) NUCLEIC ACID (HNA/RNA), DNA, RNA, HNA, HEXITOL NUCLEIC ACID, HYBRID, DUPLEX, MODIFIED NUCLEIC ACID, ANTISENSE, BACKBONE MODIFICATION
481d	nuc      1.60	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(GUANIN-9-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF A HEXITOL NUCLEIC ACID (HNA) DUPLEX AT 1.6A RESOLUTION 5'-H(*(6HG)P*(6HT)P*(6HG)P*(6HT)P*(6HA)P*(6HC) P*(6HA)P*(6HC))-3' DNA HEXITOL NUCLEIC ACID, DNA ANALOGUE, DOUBLE HELIX

6HS    (1S,2S,3R,4S,6R)-4,6-DIAMINO-3-{[(2S,3R)-3-AMINO-6- (HYDROXYMETHYL)-3,4-DIHYDRO-2H-PYRAN-2-YL]OXY}-2- HYDROXYCYCLOHEXYL 3-DEOXY-4-C-METHYL-3-(METHYLAMINO)- BETA-L-ARABINOPYRANOSIDE

Code	Class Resolution	Description
4gpw	nuc      3.00	(1S,2S,3R,4S,6R)-4,6-DIAMINO-3-{[(2S,3R)-3-AMINO-6- (HYDROXYMETHYL)-3,4-DIHYDRO-2H-PYRAN-2-YL]OXY}-2- HYDROXYCYCLOHEXYL 3-DEOXY-4-C-METHYL-3-(METHYLAMINO)- BETA-L-ARABINOPYRANOSIDE 2(C19 H36 N4 O8)	CRYSTAL STRUCTURE OF THE PROTOZOAL CYTOPLASMIC RIBOSOMAL DEC IN COMPLEX WITH 6'-HYDROXYSISOMICIN (P21212 FORM) RNA (5'- R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP*CP*CP*GP*GP*CP*GP*AP*AP*GP C)-3') RNA/ANTIBIOTIC RIBOSOME, AMINOGLYCOSIDE, RNA-ANTIBIOTIC COMPLEX, ANTIPROTOZ ACTIVITY, ANTIBACTERIAL ACTIVITY
4gpx	nuc      2.60	(1S,2S,3R,4S,6R)-4,6-DIAMINO-3-{[(2S,3R)-3-AMINO-6- (HYDROXYMETHYL)-3,4-DIHYDRO-2H-PYRAN-2-YL]OXY}-2- HYDROXYCYCLOHEXYL 3-DEOXY-4-C-METHYL-3-(METHYLAMINO)- BETA-L-ARABINOPYRANOSIDE 2(C19 H36 N4 O8)	CRYSTAL STRUCTURE OF THE PROTOZOAL CYTOPLASMIC RIBOSOMAL DEC IN COMPLEX WITH 6'-HYDROXYSISOMICIN (P212121 FORM) RNA (5'- R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP*CP*CP*GP*GP*CP*GP*AP*AP*GP C)-3') RNA/ANTIBIOTIC RIBOSOME, AMINOGLYCOSIDE, RNA-ANTIBIOTIC COMPLEX, ANTIPROTOZ ACTIVITY, ANTIBACTERIAL ACTIVITY
4gpy	nuc      2.80	(1S,2S,3R,4S,6R)-4,6-DIAMINO-3-{[(2S,3R)-3-AMINO-6- (HYDROXYMETHYL)-3,4-DIHYDRO-2H-PYRAN-2-YL]OXY}-2- HYDROXYCYCLOHEXYL 3-DEOXY-4-C-METHYL-3-(METHYLAMINO)- BETA-L-ARABINOPYRANOSIDE 2(C19 H36 N4 O8)	CRYSTAL STRUCTURE OF THE BACTERIAL RIBOSOMAL DECODING SITE I WITH 6'-HYDROXYSISOMICIN RNA (5'- R(*UP*UP*GP*CP*GP*UP*CP*AP*CP*GP*CP*CP*GP*GP*CP*GP*AP*AP*GP C)-3') RNA/ANTIBIOTIC RIBOSOME, AMINOGLYCOSIDE, RNA-ANTIBIOTIC COMPLEX, ANTIPROTOZ ACTIVITY, ANTIBACTERIAL ACTIVITY

6HT    1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(THYMIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL

Code	Class Resolution	Description
1d7z	nuc      2.21	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(THYMIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C11 H17 N2 O8 P)	CRYSTAL STRUCTURE OF A HEXITOL NUCLEIC ACID (HNA) DUPLEX AT 2.2 A RESOLUTION 5'-H(*(6HG)P*(6HT)P*(6HG)P*(6HT)P*(6HA)P*(6HC) P*(6HA)P*(6HC))-3' DNA HEXITOL NUCLEIC ACID, DNA ANALOGUE, DOUBLE HELIX
1ec4	nuc      NMR    	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(THYMIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 8(C11 H17 N2 O8 P)	SOLUTION STRUCTURE OF A HEXITOL NUCLEIC ACID DUPLEX WITH FOUR CONSECUTIVE T:T BASE PAIRS HEXITOL DODECANUCLEOTIDE DNA DOUBLE HELIX, ANTISENSE, HEXITOL NUCLEIC ACID, DNA
1ejz	nuc      NMR    	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(THYMIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL C11 H17 N2 O8 P	SOLUTION STRUCTURE OF A HNA-RNA HYBRID DNA (5'-H(*(6HG)P*(6HC)P*(6HG)P*(6HT)P*(6HA) P*(6HG)P*(6HC)P*(6HG))-3'), RNA (5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3') RNA HNA-RNA COMPLEX, DOUBLE HELIX, A-TYPE CONFORMATION
2bj6	nuc      2.60	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(THYMIN-1-YL)- 6'-O-PHOSPHORYL-D-ARABINO-HEXITOL 8()	CRYSTAL STRUCTURE OF A DECAMERIC HNA-RNA HYBRID SYNTHETIC HNA, 5'-R(*GP*GP*CP*AP*UP*UP*AP*CP*GP*GP)-3' NUCLEIC ACID (HNA/RNA) NUCLEIC ACID (HNA/RNA), DNA, RNA, HNA, HEXITOL NUCLEIC ACID, HYBRID, DUPLEX, MODIFIED NUCLEIC ACID, ANTISENSE, BACKBONE MODIFICATION
481d	nuc      1.60	1',5'-ANHYDRO-2',3'-DIDEOXY-2'-(THYMIN-1-YL)-6'-O- PHOSPHORYL-D-ARABINO-HEXITOL 2(C11 H17 N2 O8 P)	CRYSTAL STRUCTURE OF A HEXITOL NUCLEIC ACID (HNA) DUPLEX AT 1.6A RESOLUTION 5'-H(*(6HG)P*(6HT)P*(6HG)P*(6HT)P*(6HA)P*(6HC) P*(6HA)P*(6HC))-3' DNA HEXITOL NUCLEIC ACID, DNA ANALOGUE, DOUBLE HELIX

6IA    N6-ISOPENTENYL-ADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2lbq	nuc      NMR    	N6-ISOPENTENYL-ADENOSINE-5'-MONOPHOSPHATE C15 H24 N5 O7 P	NMR STRUCTURE OF I6A37_TYRASL RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP*(6IA) P*AP*UP*CP*CP*CP*C)-3') RNA TYROSYL-TRNA, RNA
2lbr	nuc      NMR    	N6-ISOPENTENYL-ADENOSINE-5'-MONOPHOSPHATE C15 H24 N5 O7 P	CONFORMATION EFFECTS OF BASE MODIFICATION ON THE ANTICODON S OF BACILLUS SUBTILIS TRNATYR RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP*(6IA)P*A P*CP*CP*CP*C)-3') RNA TYROSYL-TRNA, RNA
5tra	nuc      model  	N6-ISOPENTENYL-ADENOSINE-5'-MONOPHOSPHATE C15 H24 N5 O7 P	SOLUTION STRUCTURE OF A TRNA WITH A LARGE VARIABLE REGION: YEAST TRNA-SER T-RNA (85-MER) AMINO-ACID TRANSPORT T-RNA

6MA    N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1da3	nuc      2.00	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	THE CRYSTAL STRUCTURE OF THE TRIGONAL DECAMER C-G-A-T-C-G- 6MEA-T-C-G: A B-DNA HELIX WITH 10.6 BASE-PAIRS PER TURN DNA (5'-D(*CP*GP*AP*TP*CP*GP*(6MA)P*TP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
1oq2	nuc      NMR    	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	NMR STRUCTURE OF HEMIMETHYLATED GATC SITE 5'-D(*GP*CP*GP*AP*GP*AP*TP*CP*TP*GP*CP*G)-3', 5'-D(*CP*GP*CP*AP*GP*(6MA)P*TP*CP*TP*CP*GP*C)-3' DNA GATC, AGATCT, HEMIMETHYLATION, SEQA, MUTH, N6-METHYL, DAM (DNA ADENINE METHYLTRANSFERASE), DNA
1uab	nuc      NMR    	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	NMR STRUCTURE OF HEMIMETHYLATED GATC SITE DNA (5'-D(*GP*CP*GP*AP*GP*AP*TP*CP*TP*GP*CP*G)- 3'), DNA (5'-D(*CP*GP*CP*AP*GP*(6MA) P*TP*CP*TP*CP*GP*C)-3') DNA GATC, AGATCT, HEMIMETHYLATION, SEQA, MUTH, N6-METHYL, DAM (DNA ADENINE METHYLTRANSFERASE)
2kal	nuc      NMR    	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	NMR STRUCTURE OF FULLY METHYLATED GATC SITE 5'-D(*DGP*DCP*DGP*DAP*DGP*(6MA) P*DTP*DCP*DTP*DGP*DCP*DG)-3', 5'-D(*DCP*DGP*DCP*DAP*DGP*(6MA) P*DTP*DCP*DTP*DCP*DGP*DC)-3' DNA GATC, N6-METHYLATED ADENINE, DNA
4dnb	nuc      2.00	N6-METHYL-DEOXY-ADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O6 P)	METHYLATION OF THE ECORI RECOGNITION SITE DOES NOT ALTER DNA CONFORMATION. THE CRYSTAL STRUCTURE OF D(CGCGAM6ATTCGCG) AT 2.0 ANGSTROMS RESOLUTION DNA (5'-D(*CP*GP*CP*GP*AP*(6MA) P*TP*TP*CP*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED

6MZ    N6-METHYLADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2jrg	nuc      NMR    	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	NMR SOLUTION STRUCTURE OF THE ANTICODON OF E. COLI TRNA-VAL3 MODIFICATIONS (CMO5U34 M6A37) 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*(6MZ) P*AP*GP*GP*AP*GP*G)-3' RNA E.COLI, VALINE, TRNA, ANTICODON STEM LOOP, TRNA DOMAIN, RNA URIDINE 5-OXYACETIC ACID, CMO5U, N6-METHYLADENOSINE, M6A, R
2jsg	nuc      NMR    	N6-METHYLADENOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	NMR SOLUTION STRUCTURE OF THE ANTICODON OF E.COLI TRNA-VAL3 MODIFICATION (M6A37) 5'-R(*CP*CP*UP*CP*CP*CP*UP*UP*AP*CP*(6MZ) P*AP*GP*GP*AP*GP*G)-3' RNA E.COLI, VALINE, TRNA, ANTICODON STEM LOOP, TRNA DOMAIN, RNA N6-METHYLADENOSINE, M6A, RNA
2mvs	nuc      NMR    	N6-METHYLADENOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	N6-METHYLADENOSINE RNA N-6_METHYL_ADENOSINE_RNA RNA N6-METHYL ADENOSINE, RNA

6O6    PLICAMYCIN, MITHRAMYCIN ANALOGUE MTM SA-TRP

Code	Class Resolution	Description
5jvw	nuc      2.00	PLICAMYCIN, MITHRAMYCIN ANALOGUE MTM SA-TRP 4(C61 H82 N2 O24)	CRYSTAL STRUCTURE OF MITHRAMYCIN ANALOGUE MTM SA-TRP IN COMP 10-MER DNA AGAGGCCTCT. DNA (5'-D(*AP*GP*AP*GP*GP*CP*CP*TP*CP*T)-3') DNA/ANTIBIOTIC ANTI-CANCER AGENT, EWING SARCOMA, TRANSCRIPTION FACTOR, MINO DNA BINDING, DNA-ANTIBIOTIC COMPLEX

6O7    PLICAMYCIN, MITHRAMYCIN ANALOGUE MTM SA-PHE

Code	Class Resolution	Description
5jw0	nuc      2.40	PLICAMYCIN, MITHRAMYCIN ANALOGUE MTM SA-PHE 4(C59 H81 N O24)	CRYSTAL STRUCTURE OF MITHRAMYCIN ANALOGUE MTM SA-PHE IN COMP 10-MER DNA AGGGTACCCT DNA (5'-D(P*AP*GP*GP*GP*TP*AP*CP*CP*CP*T)-3') DNA/ANTIBIOTIC ANTI-CANCER AGENT, DNA BINDING, NATURAL PRODUCT, TRANSCRIPTI FACTOR, EWING SARCOMA, DNA-ANTIBIOTIC COMPLEX
5jw2	nuc      3.10	PLICAMYCIN, MITHRAMYCIN ANALOGUE MTM SA-PHE 4(C59 H81 N O24)	CRYSTAL STRUCTURE OF MITHRAMYCIN ANALOGUE MTM SA-PHE IN COMP 10-MER DNA AGGGATCCCT DNA (5'-D(*AP*GP*GP*GP*AP*TP*CP*CP*CP*T)-3') DNA/ANTIBIOTIC ANTI-CANCER AGENT, DNA BINDING, NATURAL PRODUCT, TRANSCRIPTI FACTOR, EWING SARCOMA, DNA-ANTIBIOTIC COMPLEX

6OG    6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
153d	nuc      2.90	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF A MISPAIRED DODECAMER, D(CGAGAATTC(O6ME)GCG)2, CONTAINING A CARCINOGENIC O6- METHYLGUANINE DNA (5'-D(*CP*GP*AP*GP*AP*AP*TP*TP*CP*(6OG) P*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED, MISMATCHED
1d24	nuc      1.90	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	CRYSTAL AND MOLECULAR STRUCTURE OF A DNA DUPLEX CONTAINING THE CARCINOGENIC LESION O6-METHYLGUANINE DNA (5'-D(*CP*GP*CP*(6OG)P*CP*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1d27	nuc      2.00	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	HIGH-RESOLUTION STRUCTURE OF A MUTAGENIC LESION IN DNA DNA (5'-D(*CP*GP*CP*(6OG) P*AP*AP*TP*TP*TP*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED, MISMATCHED
218d	nuc      2.25	6-O-METHYL GUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	THE STRUCTURE OF A NEW CRYSTAL FORM OF A DNA DODECAMER CONTAINING T.(O6ME)G BASE PAIRS DNA (5'-D(*CP*GP*TP*GP*AP*AP*TP*TP*CP*(6OG) P*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED, MISMATCHED

6SB   

Code	Class Resolution	Description
2gy0	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 1,4-BIS[5-(2-AMIDINO)-2-BENZIMIDAZOLYL]BUTANE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

6SP   

Code	Class Resolution	Description
2gxo	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-IMIDAZOLINYL)-2-(4-ETHOXYPHENYL)BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

6XM    8,12-BIS(2-MORPHOLINOETHYL)-8H-BENZO[IJ]XANTHENO[1,9,8- CDEF][2,7]NAPHTHYRIDIN-12-IUMHEXAFLUOROPHOSPHATE

Code	Class Resolution	Description
5lig	nuc      NMR    	8,12-BIS(2-MORPHOLINOETHYL)-8H-BENZO[IJ]XANTHENO[1,9,8- CDEF][2,7]NAPHTHYRIDIN-12-IUMHEXAFLUOROPHOSPHATE 2(C31 H34 N4 O3 1+)	G-QUADRUPLEX FORMED AT THE 5'-END OF NHEIII_1 ELEMENT IN HUM PROMOTER BOUND TO TRIANGULENIUM BASED FLUORESCENCE PROBE DA DNA (5'- D(*TP*AP*GP*GP*GP*AP*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*GP*GP*T) CHAIN: A DNA DNA, G-QUADRUPLEX, C-MYC PROMOTER, LIGAND, DAOTA-M2

6YG    2-[(3~{S})-1-[(2-METHOXYPYRIMIDIN-5-YL) METHYL]PIPERIDIN-3-YL]-6-THIOPHEN-2-YL-1~{H}- PYRIMIDIN-4-ONE

Code	Class Resolution	Description
5kx9	nuc      2.90	2-[(3~{S})-1-[(2-METHOXYPYRIMIDIN-5-YL) METHYL]PIPERIDIN-3-YL]-6-THIOPHEN-2-YL-1~{H}- PYRIMIDIN-4-ONE C19 H21 N5 O2 S	SELECTIVE SMALL MOLECULE INHIBITION OF THE FMN RIBOSWITCH FMN RIBOSWITCH, FMN RIBOSWITCH RNA/INHIBITOR RNA, TRANSLATION, RNA-INHIBITOR COMPLEX

70U    5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
1fir	nuc      3.30	5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE C12 H17 N2 O10 P S	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) RNA MAMMALIAN TRANSFERT RIBONUCLEIC ACID, HIV-1 PRIMER TRNA, AMI TRANSPORT, CANONICAL TRNA STRUCTURE, CANONICAL ANTICODON, FRAMESHIFTING, CODON/ANTICODON MIMICRY, MODIFIED BASES, RNA
2l9e	nuc      NMR    	5-(O-METHYLACETO)-2-THIO-2-DEOXY-URIDINE-5'- MONOPHOSPHATE C12 H17 N2 O10 P S	SOLUTION STRUCTURE OF THE HUMAN ANTI-CODON STEM AND LOOP(HAS TRANSFER RNA LYSINE 3 (TRNALYS3) RNA (5'-R(*GP*CP*AP*GP*AP*CP*UP*(70U)P*UP*UP*(12A P*AP*UP*CP*UP*GP*C)-3') RNA RNA

74G    4-{[(2S)-3-{2,16-DIOXO-20-[(3AS,4S,6AR)-2-OXOHEXAHYDRO- 1H-THIENO[3,4-D]IMIDAZOL-4-YL]-6,9,12-TRIOXA-3,15- DIAZAICOSAN-1-YL}-2,3-DIHYDRO-1,3-BENZOTHIAZOL-2- YL]METHYL}-1-METHYLQUINOLIN-1-IUM

Code	Class Resolution	Description
5v3f	nuc      1.70	4-{[(2S)-3-{2,16-DIOXO-20-[(3AS,4S,6AR)-2-OXOHEXAHYDRO- 1H-THIENO[3,4-D]IMIDAZOL-4-YL]-6,9,12-TRIOXA-3,15- DIAZAICOSAN-1-YL}-2,3-DIHYDRO-1,3-BENZOTHIAZOL-2- YL]METHYL}-1-METHYLQUINOLIN-1-IUM 2(C38 H51 N6 O6 S2 1+)	CO-CRYSTAL STRUCTURE OF THE FLUOROGENIC RNA MANGO RNA (31-MER) RNA QUADRUPLEX FLUORESCENT RNA, RNA

7AD    9-AMINO-N-[3-(DIMETHYLAMINO)PROPYL]ACRIDINE-4- CARBOXAMIDE

Code	Class Resolution	Description
1rqy	nuc      1.55	9-AMINO-N-[3-(DIMETHYLAMINO)PROPYL]ACRIDINE-4- CARBOXAMIDE 3(C19 H22 N4 O)	9-AMINO-[N-(2-DIMETHYLAMINO)PROPLY]-ACRIDINE-4-CARBOXAMIDE BOUND TO D(CGTACG)2 5'-D(CP*GP*TP*AP*CP*G)-3' DNA B-DNA, CYTOSINE EXCHANGE, QUADRUPLEX, ACRIDINE, UNUSUAL INTERCALATION

7AT    1-(5-O-PHOSPHONO-BETA-D-RIBOFURANOSYL)-3-(1H-1,2,3- TRIAZOL-5-YL)-1H-PYRAZOLO[3,4-D]PYRIMIDIN-4-AMINE

Code	Class Resolution	Description
4nfq	nuc      1.70	1-(5-O-PHOSPHONO-BETA-D-RIBOFURANOSYL)-3-(1H-1,2,3- TRIAZOL-5-YL)-1H-PYRAZOLO[3,4-D]PYRIMIDIN-4-AMINE 3(C12 H15 N8 O7 P)	CRYSTAL STRUCTURE ANALYSIS OF THE 16MER GCAGNCUUAAGUCUGC CON TRIAZOLYL-8-AZA-7-DEAZAADENOSINE GCAG(7AT)CUUAAGUCUGC RNA RNA 16MER OLIGO, 7-TRIAZOLYL-8-AZA-7-DEAZAADENOSINE, POSITIO

7DA    7-DEAZA-2'-DEOXYADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
3opi	nuc      1.10	7-DEAZA-2'-DEOXYADENOSINE-5'-MONOPHOSPHATE 2(C11 H15 N4 O6 P)	7-DEAZA-2'-DEOXYADENOSINE MODIFICATION IN B-FORM DNA DNA (5'-D(*CP*GP*CP*GP*AP*(7DA)P*TP*TP*CP*GP*CP*G CHAIN: A, B DNA B-DNA, DODECAMER, 7-DEAZA-DEOXYADENOSINE, 7-DEAZA-DA, DNA

7DG    7-DEAZAGUANINE

Code	Class Resolution	Description
4lvw	nuc      1.77	7-DEAZAGUANINE 2(C6 H6 N4 O)	STRUCTURE OF THE THF RIBOSWITCH BOUND TO 7-DEAZAGUANINE THF RIBOSWITCH RNA APTAMERS, NUCLEOTIDE, BACILLUS SUBTILIS, BACTERIAL PROTEINS, SEQUENCE, BINDING SITES, CALORIMETRY, FOLIC ACID, GENE EXPR REGULATION, BACTERIAL, GUANINE, LEUCOVORIN, LIGANDS, MAGNES MOLECULAR SEQUENCE DATA, NUCLEIC ACID CONFORMATION, POINT M PROTEIN BINDING, PROTEIN STRUCTURE, SECONDARY, RNA, RIBOSWI ADENOSYLMETHIONINE, STREPTOCOCCUS MUTANS, TERMINATOR REGION GENETIC, TETRAHYDROFOLATES, THERMODYNAMICS, TRANSCRIPTION, JUNCTION, PSEUDOKNOT, REGULATION, NCRNA, MRNA

7GU    7-DEAZA-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2mms	nuc      NMR    	7-DEAZA-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C11 H15 N4 O7 P	AG(7-DEAZA)G FAPY MODIFIED DUPLEX DNA_(5'-D(*CP*TP*AP*AP*(FAG)P*(7GU)P*TP*TP*CP*A)- CHAIN: A, DNA_(5'-D(*TP*GP*AP*AP*CP*CP*TP*TP*AP*G)-3') DNA AFLATOXIN B1, FAPY, FORMAMIDOPYRIMIDINE, INTERCALATION, DNA DEOXYRIBONUCLEIC ACID, HYDROGEN BOND, SEQUENCE DEPENDENCE, DEAZA)G, DNA
2qef	nuc      1.60	7-DEAZA-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C11 H15 N4 O7 P)	X-RAY STRUCTURE OF 7-DEAZA-DG AND Z3DU MODIFIED DUPLEX CGCGAATXCZCG DNA (5'-D(*DCP*DGP*DCP*DGP*DAP*DAP*DTP*(ZDU) P*DCP*(7GU)P*DCP*DG)-3') DNA B-DNA, Z3DU, 7-DEAZA-DG
2qeg	nuc      1.60	7-DEAZA-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C11 H15 N4 O7 P)	B-DNA WITH 7-DEAZA-DG MODIFICATION DNA (5'- D(*DCP*DGP*DCP*DGP*DAP*DAP*DTP*DTP*DCP*(7GU)P*DCP*DG)-3') DNA B-DNA, 7-DEAZA-DG

7MG    7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1c2w	nuc      7.50	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 3(C11 H18 N5 O8 P)	23S RRNA STRUCTURE FITTED TO A CRYO-ELECTRON MICROSCOPIC MAP ANGSTROMS RESOLUTION 23S RIBOSOMAL RNA RIBOSOME 23S RRNA, RIBOSOME, LARGE RIBOSOMAL SUBUNIT, ATOMIC PROTEIN BIOSYNTHESIS, RIBONUCLEIC ACID, EM-RECONSTRUCTION, 3D ARRAN FITTING
1ehz	nuc      1.93	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	THE CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRNA AT 1.93 A TRANSFER RNA (PHE) RNA TRNA, YEAST, PHENYLALANINE, RNA
1evv	nuc      2.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRANSFER RNA AT 2.0 RESOLUTION PHENYLALANINE TRANSFER RNA RNA TRANSFER RNA, PHENYLALANINE, PHE-TRNA, YEAST, AMINO-ACID TRA RNA
1fcw	nuc      17.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 5(C11 H18 N5 O8 P)	TRNA POSITIONS DURING THE ELONGATION CYCLE TRNAPHE RIBOSOME RIBOSOME, TRNA BINDING SITES, PROTEIN SYNTHESIS, ELONGATION
1fir	nuc      3.30	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) RNA MAMMALIAN TRANSFERT RIBONUCLEIC ACID, HIV-1 PRIMER TRNA, AMI TRANSPORT, CANONICAL TRNA STRUCTURE, CANONICAL ANTICODON, FRAMESHIFTING, CODON/ANTICODON MIMICRY, MODIFIED BASES, RNA
1k7n	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 2) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7o	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 3) P-SITE TRNA, A-SITE TRNA, MRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7p	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 4) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7r	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 1) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1ks1	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	A MODEL FOR A FIVE-PRIME STACKED TRNA PHENYLALANINE TRANSFER RNA RIBONUCLEIC ACID FIVE-PRIME STACK, TRNA
1nrt	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 3(C11 H18 N5 O8 P)	APE-SITE TRNA, THEORETICAL MODEL TRANSFER RIBONUCLEIC ACID AMINO-ACID TRANSPORT AMINO-ACID TRANSPORT, TRNA, MODEL
1q49	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1q5s	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxu	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1qxv	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rcz	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL A2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd0	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL B2) A-SITE TRNA, SINGLE-STRANDED MRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd1	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL C2) P-SITE TRNA, SINGLE-STRANDED MRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1rd2	nuc      model  	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE 2(C11 H18 N5 O8 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL D2) SINGLE-STRANDED MRNA, A-SITE TRNA, P-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1tn1	nuc      3.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE TRNA TRNAPHE RNA TRANSLATION, RNA
1tn2	nuc      3.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTALLOGRAPHIC AND BIOCHEMICAL INVESTIGATION OF THE LEAD(I CATALYZED HYDROLYSIS OF YEAST PHENYLALANINE T-RNA TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1tra	nuc      3.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	RESTRAINED REFINEMENT OF THE MONOCLINIC FORM OF YEAST PHENYL TRANSFER RNA. TEMPERATURE FACTORS AND DYNAMICS, COORDINATED AND BASE-PAIR PROPELLER TWIST ANGLES TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
1yfg	nuc      3.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	YEAST INITIATOR TRNA YEAST INITIATOR TRNA T-RNA AMINO ACID TRANSPORT, TRANSFER RIBONUCLEIC ACID, T-RNA
2z9q	nuc      11.70	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	TRANSFER RNA IN THE HYBRID P/E STATE TRNA RNA DISTORTED ANTICODON-STEM-LOOP, TWISTED CCA ARM, RNA
3bbv	nuc      10.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	THE TRNA(PHE) FITTED INTO THE LOW RESOLUTION CRYO-EM MAP OF 50S.NC-TRNA.HSP15 COMPLEX TRNA(PHE) RIBOSOME PHE, TRNA, RESCUE STALLED RIBOSOME, RIBOSOME
486d	nuc      7.50	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	X-RAY CRYSTAL STRUCTURES OF 70S RIBOSOME FUNCTIONAL COMPLEXE E-SITE TRNA OF 70S RIBOSOME, A-SITE TRNA OF 70S RIBOSOME, P-SITE CODON OF 70S RIBOSOME, P-SITE TRNA OF 70S RIBOSOME, A-SITE CODON OF 70S RIBOSOME, 900 STEM-LOOP OF 16S RRNA IN THE 70S RIBOSOME, PENULTIMATE STEM OF 16S RRNA IN THE 70S RIBOSOME RIBOSOME FUNCTIONAL MODELS OF 70S RIBOSOME, TRNA, RIBOSOME
4tna	nuc      2.50	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	FURTHER REFINEMENT OF THE STRUCTURE OF YEAST T-RNA-PHE TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
4tra	nuc      3.00	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	RESTRAINED REFINEMENT OF TWO CRYSTALLINE FORMS OF YEAST ASPA AND PHENYLALANINE TRANSFER RNA CRYSTALS TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS
6tna	nuc      2.70	7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE C11 H18 N5 O8 P	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE T-RNA. I.CRYSTALLOG REFINEMENT TRNAPHE T-RNA T-RNA, SINGLE STRAND, LOOPS

7SB   

Code	Class Resolution	Description
2gy1	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 1,4-BIS[5-(2- IMIDAZOLINYL)-2-BENZIMIDAZOLYL]BUTANE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

7SP   

Code	Class Resolution	Description
2gxp	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-PYRIMIDINYL)-2-(4-HYDROXYPHENYL)BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

804    6-(1,4,5,6-TETRAHYDROPYRIMIDIN-2-YL)-2-[4'-(1,4,5,6- TETRAHYDROPYRIMIDIN-2-YL)BIPHENYL-4-YL]-1H-INDOLE

Code	Class Resolution	Description
3u05	nuc      1.27	6-(1,4,5,6-TETRAHYDROPYRIMIDIN-2-YL)-2-[4'-(1,4,5,6- TETRAHYDROPYRIMIDIN-2-YL)BIPHENYL-4-YL]-1H-INDOLE C28 H27 N5	CRYSTAL STRUCTURE OF DB1804-D(CGCGAATTCGCG)2 COMPLEX 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA A2T2, DICKERSON AND DREW DODECAMER, DOUBLE HELIX, DNA MINOR LIGAND COMPLEX, DNA MINOR GROOVE BINDER, DB1804, MG2+, DNA

881    N',N''-{FURAN-2,5-DIYLBIS[3-(PIPERIDIN-4-YLOXY)BENZENE- 4,1-DIYL]}DIPYRIDINE-2-CARBOXIMIDAMIDE

Code	Class Resolution	Description
3oie	nuc      1.90	N',N''-{FURAN-2,5-DIYLBIS[3-(PIPERIDIN-4-YLOXY)BENZENE- 4,1-DIYL]}DIPYRIDINE-2-CARBOXIMIDAMIDE C38 H40 N8 O3	CRYSTAL STRUCTURE OF THE DB1880-D(CGCGAATTCGCG)2 COMPLEX 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA NUCLEIC ACIDS, DNA, DOUBLE HELIX, MINOR GROOVE, DNA MINOR GR BINDER, DNA MINOR GROOVE-LIGAND COMPLEX, DB1880, A2T2, DICK DREW DODECAMER, CRYSTAL STRUCTURE OF B-DNA, DNA-DRUG COMPLE MAGNESIUM-WATER COMPLEX, HYDRATED MAGNESIUM, DNA HYDRATION

8AD    9-AMINO-(N-(2-DIMETHYLAMINO)BUTYL)ACRIDINE-4- CARBOXAMIDE

Code	Class Resolution	Description
1fn1	nuc      1.60	9-AMINO-(N-(2-DIMETHYLAMINO)BUTYL)ACRIDINE-4- CARBOXAMIDE C20 H24 N4 O	CRYSTAL STRUCTURE OF 9-AMINO-(N-(2-DIMETHYLAMINO)BUTYL) ACRIDINE-4-CARBOXAMIDE BOUND TO D(CG(5BR)UACG)2 DNA (5'-D(P*GP*(BRO)UP*AP*CP*G)-3'), DNA (5'-D(*CP*GP*(BRO)UP*AP*CP*G)-3') DNA 9-AMINOACRIDINE-4-CARBOAMIDE, HEXANUCLEOTIDE, X-RAY CRYSTALLOGRAPHY, INTERCALATION, QUADRUPLEX, DNA
1fn2	nuc      1.60	9-AMINO-(N-(2-DIMETHYLAMINO)BUTYL)ACRIDINE-4- CARBOXAMIDE C20 H24 N4 O	9-AMINO-(N-(2-DIMETHYLAMINO)BUTYL)ACRIDINE-4-CARBOXAMIDE BOUND TO D(CGTACG)2 DNA (5'-D(*CP*GP*TP*AP*CP*G)-3'), DNA (5'-D(P*GP*TP*AP*CP*G)-3') DNA DNA, ACRIDINE-4-CARBOXAMIDE, INTERCALATION, QUADRUPLEX

8MG    8-METHYL-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1r4d	nuc      NMR    	8-METHYL-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	SOLUTION STRUCTURE OF THE CHIMERIC L/D DNA OLIGONUCLEOTIDE D(C8METGCGC(L)G(L)CGCG)2 5'-D(*CP*(8MG)P*CP*GP*(0DC)P*(0DG)P*CP*GP*CP*G)-3 CHAIN: A, B DNA DNA POLYMORPHISM, L ENANTIOMERY, ANTISENSE, HYBRID ZBZ DNA,
1tne	nuc      NMR    	8-METHYL-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	NMR STUDY OF Z-DNA AT PHYSIOLOGICAL SALT CONDITIONS, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*CP*GP*CP*(8MG)P*CP*G)-3') DNA Z-DNA

8OG    8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
178d	nuc      2.50	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	CRYSTAL STRUCTURE OF A DNA DUPLEX CONTAINING 8- HYDROXYDEOXYGUANINE.ADENINE BASE-PAIRS DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*(8OG) P*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED, MISMATCHED
183d	nuc      1.60	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	X-RAY STRUCTURE OF A DNA DECAMER CONTAINING 7, 8-DIHYDRO-8- OXOGUANINE DNA (5'-D(*CP*CP*AP*(8OG)P*CP*GP*CP*TP*GP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
1fyi	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	11-MER DNA DUPLEX CONTAINING A 2'-DEOXYARISTEROMYCIN 8-OXO- GUANINE BASE PAIR; 5'-D(*GP*TP*GP*AP*CP*(8OG)P*CP*AP*CP*TP*G)-3', 5'-D(*CP*AP*GP*TP*GP*(2AR)P*GP*TP*CP*AP*C)-3' DNA 2'-DEOXYARISTEROMYCIN, 8-OXO-GUANINE, DNA
1n2w	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	SOLUTION STRUCTURE OF 8OG:G MISMATCH CONTAINING DUPLEX 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(8OG)P*GP*CP*G)-3' DNA 8OG, G:G MISMATCH, OXIDATIVE DAMAGE, DNA
2m3p	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	DNA CONTAINING A CLUSTER OF 8-OXO-GUANINE AND ABASIC SITE LE ALPHA ANOMER DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3 CHAIN: B, DNA (5'-D(*CP*GP*CP*TP*CP*(ORP)P*CP*AP*CP*GP*C)-3 CHAIN: A DNA DNA LESION CLUSTER, 8-OXO-GUANINE, ABASIC SITE, DNA
2m3y	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	DNA CONTAINING A CLUSTER OF 8-OXO-GUANINE AND ABASIC SITE LE ANOMER DNA (5'-D(*CP*GP*CP*TP*CP*(AAB)P*CP*AP*CP*GP*C)-3 CHAIN: A, DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3 CHAIN: B DNA DNA LESION CLUSTER, 8-OXO-GUANINE, ABASIC SITE, DNA
2m40	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	DNA CONTAINING A CLUSTER OF 8-OXO-GUANINE AND THF LESION DNA (5'-D(*CP*GP*CP*TP*CP*(3DR)P*CP*AP*CP*GP*C)-3 CHAIN: A, DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3 CHAIN: B DNA DNA LESION CLUSTER, 8-OXO-GUANINE, THF, DNA
2m43	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	DNA CONTAINING A CLUSTER OF 8-OXO-GUANINE AND ABASIC SITE LE ALPHA ANOMER (AP6, 8OG 14) DNA (5'-D(*CP*GP*CP*TP*CP*(ORP)P*CP*AP*CP*GP*C)-3 CHAIN: A, DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3 CHAIN: B DNA DNA LESION CLUSTER, 8-OXO-GUANINE, ABASIC SITE, DNA
2m44	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	DNA CONTAINING A CLUSTER OF 8-OXO-GUANINE AND ABASIC SITE LE ANOMER (6AP, 8OG14) DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3 CHAIN: B, DNA (5'-D(*CP*GP*CP*TP*CP*(AAB)P*CP*AP*CP*GP*C)-3 CHAIN: A DNA DNA LESION CLUSTER, 8-OXO-GUANINE, ABASIC SITE, DNA
2mwz	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	XANTHINE AND 8-OXOGUANINE IN G-QUADRUPLEXES: FORMATION OF A TETRAD DNA (5'-D(*TP*TP*GP*GP*GP*TP*TP*AP*(8OG) P*GP*GP*TP*TP*AP*GP*GP*(3ZO)P*TP*TP*AP*GP*GP*GP*A)-3') DNA XANTHOSINE, DNA
5hqf	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	DNA DUPLEX CONTAINING A RIBONOLACTONE LESION DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3 CHAIN: B, DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3 CHAIN: A DNA DNA LESION, CLUSTER 8-OXO-GUANINE RIBONOLACTONE, DNA
5hqq	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	DNA DUPLEX CONTAINING A RIBONOLACTONE LESION DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3 CHAIN: A, DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3 CHAIN: B DNA DNA LESION CLUSTER 8-OXO-GUANINE RIBONOLACTONE, DNA
5iv1	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	SOLUTION STRUCTURE OF DNA DODECAMER WITH 8-OXOGUANINE AT 4TH DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA DREW-DICKERSON, DNA, DODECAMER, NON-CANONICAL, MODIFIED DNA, DNA, DNA DAMAGE, DNA ADDUCT, LESION
5izp	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	SOLUTION STRUCTURE OF DNA DODECAMER WITH 8-OXOGUANINE AT 10T DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G CHAIN: A, B DNA DREW-DICKERSON, DNA, DODECAMER, NON-CANONICAL, MODIFIED DNA, DNA, DNA DAMAGE, DNA ADDUCT, LESION
5uz1	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE POSITION AND 8-OXOGUANINE AT THE 10TH POSITION DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P* CHAIN: A, B DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, 8-OXOGUANINE, OXIDIZED DNA, CPG SITE
5uz2	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE AND 9TH POSITION AND 8-OXOGUANINE AT THE 10TH POSITION DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8O 3') DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, 8-OXOGUANINE, OXIDIZED DNA, CPG SITE
5uz3	nuc      NMR    	8-OXO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O8 P)	SOLUTION STRUCTURE OF A DNA DODECAMER WITH 5-METHYLCYTOSINE POSITION AND 8-OXOGUANINE AT THE 10TH POSITION DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(DMC)P*(8OG)P* CHAIN: A, B DNA DREW-DICKERSON, DNA, NON-CANONICAL, MODIFIED DNA, METHYLATED EPIGENETICS, CPG SITE, 8-OXOGUANINE, 5-METHYLCYTOSINE

8OS    5'-O-[(S)-HYDROXY(4-METHYL-1H-IMIDAZOL-5-YL) PHOSPHORYL]GUANOSINE

Code	Class Resolution	Description
5v0h	nuc      1.90	5'-O-[(S)-HYDROXY(4-METHYL-1H-IMIDAZOL-5-YL) PHOSPHORYL]GUANOSINE 2(C14 H18 N7 O7 P)	RNA DUPLEX WITH 2-MEIMPG ANALOGUE BOUND-ONE BINDING SITE RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG) P*AP*CP*UP*UP*AP*AP*GP*UP*CP*GP*G)-3') RNA RNA, ANALOGUE
5v0j	nuc      1.50	5'-O-[(S)-HYDROXY(4-METHYL-1H-IMIDAZOL-5-YL) PHOSPHORYL]GUANOSINE 4(C14 H18 N7 O7 P)	RNA DUPLEX WITH 2-MEIMPG ANALOGUE BOUND-2 BINDING SITES RNA (5'-R(*(LCC)P*(LCC)P*(LCA)P*(LCG) P*AP*CP*UP*UP*AP*AP*GP*UP*CP*U)-3') RNA RNA
5v0k	nuc      1.60	5'-O-[(S)-HYDROXY(4-METHYL-1H-IMIDAZOL-5-YL) PHOSPHORYL]GUANOSINE 2(C14 H18 N7 O7 P)	RNA DUPLEX WITH 2-MEIMPG ANALOGUE BOUND-3 BINDING SITES RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG) P*AP*CP*UP*UP*AP*AP*GP*UP*C)-3') RNA RNA

8SB   

Code	Class Resolution	Description
2gy2	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 1,2-BIS[5-(5-(2-IMIDAZOLINYL)-2 BENZIMIDAZOLYL)-2- BENZIMIDAZOLYL]ETHANE LIGAND 1,2-BIS[5-(5 -(2-IMIDAZOLINYL)-2 BENZIMIDAZOLYL)-2-BENZIMIDAZOLYL]ETHANE MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

8SP   

Code	Class Resolution	Description
2gxr	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2-IMIDAZOLINYL)-2-(4-(2-IMIDAZOLINYL)PHENYL) BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

9AD    9-AMINO-(N-(2-DIMETHYLAMINO)ETHYL)ACRIDINE-4- CARBOXAMIDE

Code	Class Resolution	Description
452d	nuc      1.60	9-AMINO-(N-(2-DIMETHYLAMINO)ETHYL)ACRIDINE-4- CARBOXAMIDE 2(C18 H20 N4 O)	ACRIDINE BINDING TO DNA DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA INTERCALATION, GROOVE BINDING, DNA
465d	nuc      1.60	9-AMINO-(N-(2-DIMETHYLAMINO)ETHYL)ACRIDINE-4- CARBOXAMIDE 2(C18 H20 N4 O)	STRUCTURE OF THE TOPOISOMERASE II POISON BOUND TO DNA DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA TOPOISOMERASE II POISON, HEXANUCLEOTIDE, D(CGTACG)2, 9- AMINO-DACA, DNA

9SB   

Code	Class Resolution	Description
2gy3	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 1,4-BIS[5-(5-(2-AMIDINO)-2 BENZIMIDAZOLYL)-2- BENZIMIDAZOLYL]BUTANE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

9SP   

Code	Class Resolution	Description
2gxt	nuc      model  	 	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 5-(2- PYRIMIDINYL)-2-(4-(2- PYRIMIDINYL)PHENYL) BENZIMIDAZOLE DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, BENZIMIDAZOLE DERIVATIVE

9TA    1,4-BIS-[2-(2-HYDROXY-ETHYLAMINO)-ETHYLAMINO]- ANTHRAQUINONE

Code	Class Resolution	Description
1fdg	nuc      1.60	1,4-BIS-[2-(2-HYDROXY-ETHYLAMINO)-ETHYLAMINO]- ANTHRAQUINONE C14 H8 O2	BINDING OF A MACROCYCLIC BISACRIDINE AND AMETANTRONE TO CGTACG INVOLVES SIMILAR UNUSUAL INTERCALATION PLATFORMS (AMETANTRONE COMPLEX) DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA HIGH RESOLUTION CRYSTAL STRUCTURE, INTERCALATION PLATFORM, MAD, ANTICANCER DRUG, DRUG-DNA COMPLEX, METAL IONS, TERTIARY BASE PAIRS

9ZQ    RU(PHEN)2(DPPZ-11,12-ME2)

Code	Class Resolution	Description
5lfx	nuc      1.56	RU(PHEN)2(DPPZ-11,12-ME2) C44 H30 N8 RU 6+	LAMBDA-[RU(PHEN)2(DPPZ-11,12-ME)]2+ BOUND TO A SHORT SUBSTIT SEQUENCE DNA (5'-D(*(CBR)P*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*G)-3') DNA DNA, RUTHENIUM, LIGHT-SWITCH, INTERCALATION

A23    ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE

Code	Class Resolution	Description
1d4r	nuc      2.00	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	29-MER FRAGMENT OF HUMAN SRP RNA HELIX 6 29-MER OF MODIFIED SRP RNA HELIX 6: NON-NATIVE DUPLEX, 29-MER OF MODIFIED SRP RNA HELIX 6: NON-NATIVE DUPLEX RNA A-RNA HELIX, GGAG/GAGG BULGE, AC/CA TANDEM MISMATCH, GU WOBBLE BASE PAIRS, 2'3' -CYCLIC PHOSPHATE
2gcs	nuc      2.10	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	PRE-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME GLMS RIBOZYME AMINO RNA INHIBITOR, GLMS RIBOZYME RNA RNA RNA; RIBOZYME; PSEUDOKNOT; HELIX
2gcv	nuc      2.10	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	POST-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME GLMS RIBOZYME PRODUCT OLIGONUCLEOTIDE, GLMS RIBOZYME RNA RNA RNA; RIBOZYME; PSEUDOKNOT; HELIX
2h0s	nuc      2.35	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	PRE-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME GLMS RIBOZYME DEOXY RNA INHIBITOR, GLMS RIBOZYME RNA RNA RNA, RIBOZYME, PSEUDOKNOT, HELIX
2h0w	nuc      2.40	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	POST-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME GLMS RIBOZYME PRODUCT OLIGONUCLEOTIDE, GLMS RIBOZYME RNA RNA RNA, RIBOZYME, PSEUDOKNOT, HELIX
2h0x	nuc      2.30	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	PRE-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME GLMS RIBOZYME RNA, GLMS RIBOZYME AMINO RNA INHIBITOR RNA RNA, RIBOZYME, PSEUDOKNOT, HELIX
2ho6	nuc      2.80	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	POST-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME GLMS RIBOZYME SUBSTRATE RNA, GLMS RIBOZYME RNA RNA RNA; RIBOZYME; PSEUDOKNOT; HELIX
2ho7	nuc      2.90	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	PRE-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME BOUND TO GLUCOSE-6-PHOSPHATE GLMS RIBOZYME RNA, GLMS RIBOZYME SUBSTRATE RNA RNA RNA; RIBOZYME; PSEUDOKNOT; HELIX
2hoj	nuc      2.50	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO THIAMINE PYROPHOSPHATE, MANGANESE IONS THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH
3b4a	nuc      2.70	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	T. TENGCONGENSIS GLMS RIBOZYME WITH G40A MUTATION, BOUND TO GLUCOSAMINE-6-PHOSPHATE GLMS RIBOZYME SUBSTRATE RNA, GLMS RIBOZYME RNA RNA RIBOZYME, RIBOSWITCH, GLUCOSAMINE-6-PHOSPHATE, RNA
3t4b	nuc      3.55	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	CRYSTAL STRUCTURE OF THE HCV IRES PSEUDOKNOT DOMAIN HCV IRES PSEUDOKNOT DOMAIN PLUS CRYSTALLIZATION M CHAIN: A: PSEUDOKNOT DOMAIN, RESIDUES 220-270 RNA PSEUDOKNOT, FOUR-WAY JUNCTION, HCV IRES CENTRAL DOMAIN, RNA
4nyb	nuc      3.10	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	CRYSTAL STRUCTURE OF THE E. COLI THIM RIBOSWITCH IN COMPLEX (1,2,3-THIADIAZOL-4-YL)PHENYL)METHANAMINE THIM TPP RIBOSWITCH RNA FRAGMENT-BASED DRUG DISCOVERY, RIBOSWITCH, RNA
4nyc	nuc      3.15	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	CRYSTAL STRUCTURE OF THE E. COLI THIM RIBOSWITCH IN COMPLEX THIENO[2,3-B]PYRAZIN-7-AMINE THIM TPP RIBOSWITCH RNA FRAGMENT-BASED DRUG DISCOVERY, RIBOSWITCH, RNA
4nyd	nuc      2.90	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	CRYSTAL STRUCTURE OF THE E. COLI THIM RIBOSWITCH IN COMPLEX HYPOXANTHINE THIM TPP RIBOSWITCH RNA FRAGMENT-BASED DRUG DISCOVERY, RIBOSWITCH, RNA
4nyg	nuc      3.05	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	CRYSTAL STRUCTURE OF THE E. COLI THIM RIBOSWITCH IN COMPLEX THIAMINE THIM TPP RIBOSWITCH RNA FRAGMENT-BASED DRUG DISCOVERY, RIBOSWITCH, RNA
4p5j	nuc      1.99	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C10 H13 N5 O9 P2	CRYSTAL STRUCTURE OF THE TRNA-LIKE STRUCTURE FROM TURNIP YEL VIRUS (TYMV), A TRNA MIMICKING RNA TURNIP YELLOW MOSAIC VIRUS MRNA FOR THE COAT PROT CHAIN: A RNA TRNA-MIMIC VIRAL RNA PSEUDOKNOT MULTIFUNCTIONAL, RNA
4plx	nuc      3.10	ADENOSINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 3(C10 H13 N5 O9 P2)	CRYSTAL STRUCTURE OF THE TRIPLE-HELICAL STABILITY ELEMENT AT END OF MALAT1 CORE ENE HAIRPIN AND A-RICH TRACT FROM MALAT1 RNA TRIPLE HELIX, RNA STABILITY ELEMENT, MALAT1, LONG NONCODING

A2F    2-FLUOROADENINE

Code	Class Resolution	Description
3got	nuc      1.95	2-FLUOROADENINE C5 H4 F N5	GUANINE RIBOSWITCH C74U MUTANT BOUND TO 2-FLUOROADENINE. GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, BASE TRIPLE, THREE-WAY JUNCTION

A2L    3'-O-METHYOXYETHYL-ADENOSINE 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1xv6	nuc      NMR    	3'-O-METHYOXYETHYL-ADENOSINE 5'-MONOPHOSPHATE 2(C13 H20 N5 O8 P)	THE SOLUTION STRUCTURE OF 2',5'-LINKED 3'-O-(2- METHOXYETHYL)-RNA HAIRPIN 5'-R(*(C2L)P*(G2L)P*(C2L)P*(G2L)P*(A2L)P*(A2L) P*(U2L)P*(U2L)P*(C2L)P*(G2L)P*(C2L)P*(G2L))-2' RNA HAIRPIN, (2',5')-RNA, 3'-O-(2-METHOXYETHYL) RIBOSE

A2M    2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
168d	nuc      2.00	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 2(C11 H16 N5 O7 P)	STABILIZING EFFECTS OF THE RNA 2'-SUBSTITUENT: CRYSTAL STRUC OLIGODEOXYNUCLEOTIDE DUPLEX CONTAINING 2'-O-METHYLATED ADEN DNA/RNA (5'-D(*GP*CP*GP*TP*)-R(*(A2M)P*)-D(*TP*AP 3') DNA/RNA HYBRID A-DNA/RNA, DOUBLE HELIX, MODIFIED, DNA-RNA HYBRID COMPLEX
1l3m	nuc      NMR    	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 6(C11 H16 N5 O7 P)	THE SOLUTION STRUCTURE OF [D(CGC)R(AMAMAM)D(TTTGCG)]2 5'-D(*CP*GP*C)-R(P*(A39)P*(A39)P*(A39))- D(P*TP*TP*TP*GP*CP*G)-3' DNA/RNA DNA/RNA HYBRID,CHIMERIC DUPLEX,2'O-METHYL, DNA-RNA COMPLEX
1x9c	nuc      2.19	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	AN ALL-RNA HAIRPIN RIBOZYME WITH MUTATION U39C 5'-R(*CP*GP*GP*UP*GP*AP*GP*AP*AP*GP*GP*G)-3', 5'-R(*GP*GP*CP*AP*GP*AP*GP*AP*AP*AP*CP*AP*CP*AP*C 3', 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*C *C)-3', 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*CP*G)- CHAIN: A RNA HAIRPIN RIBOZYME, ALL-RNA, COBALT HEXAAMINE, MUTATION, JUNCT LOW SALT, S-TURN, E-LOOP, CATALYTIC RNA, 2'-OME, RNA
1zft	nuc      2.33	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	THE CRYSTAL STRUCTURE OF AN ALL-RNA MINIMAL HAIRPIN RIBOZYME MUTANT G8I AT THE CLEAVAGE SITE 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*CP*G)- CHAIN: A, 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*C *C)-3', 5'-R(*CP*GP*GP*UP*GP*AP*IP*AP*AP*GP*GP*G)-3', 5'-R(*GP*GP*CP*AP*GP*AP*GP*AP*AP*AP*CP*AP*CP*AP*C 3' RNA HAIRPIN RIBOZYME, ALL-RNA, COBALT HEXAAMINE, MUTATION, INOSI JUNCTIONLESS, LOW SALT, S-TURN, E-LOOP, RIBOSE ZIPPER, CATA RNA, 2'-OME, RNA
2d2k	nuc      2.65	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF A MINIMAL, NATIVE (U39) ALL-RNA HAIRPIN 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*CP*G)- CHAIN: A, 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*UP*AP*UP*UP*AP*CP*C *C)-3', 5'-R(*GP*GP*CP*AP*GP*AP*GP*AP*AP*AP*CP*AP*CP*AP*C 3', 5'-R(*CP*GP*GP*UP*GP*AP*GP*AP*AP*GP*GP*G)-3' RNA RIBOZYME, S-TURN, DUAL CONFORMATION, RNA
2d2l	nuc      2.50	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF A MINIMAL, ALL-RNA HAIRPIN RIBOZYME WIT LINKER (C3) AT POSITION U39 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*CP*G)- CHAIN: A, 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*(P1P) P*AP*UP*UP*AP*CP*CP*UP*GP*CP*C)-3', 5'-R(*GP*GP*CP*AP*GP*AP*GP*AP*AP*AP*CP*AP*CP*AP*C 3', 5'-R(*CP*GP*GP*UP*GP*AP*GP*AP*AP*GP*GP*G)-3' RNA RIBOZYME, PROPYL LINKER, RNA
2fij	nuc      1.19	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 2(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE ANALYSIS OF THE A-DNA DECAMER GCGT-2'OMEA- WITH INCORPORATED 2'-O-METHYLATED-ADENOSINE (2'OMEA) AND AR URIDINE (AU) 5'-D(*GP*CP*GP*TP*(A2M)P*(UAR)P*AP*CP*GP*C)-3' DNA ARABINONUCLEIC ACID, SUGAR MODIFICATIONS, A-FORM DNA, DNA
2fil	nuc      1.69	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 4(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE ANALYSIS OF THE A-DNA DECAMER GCGT-2'OMEA- WITH INCORPORATED 2'-O-METHYLATED-ADENOSINE (2'OMEA) AND 2' FLUOROARABINO-THYMIDINE (FAT) 5'-D(*GP*CP*GP*TP*(A2M)P*(TAF)P*AP*CP*GP*C)-3' DNA 2'-FLUOROARABINO ACID, SUGAR MODIFICATIONS, A-FORM DNA, DNA
2kwg	nuc      NMR    	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 5(C11 H16 N5 O7 P)	SOLUTION STRUCTURE OF A FULLY MODIFIED 2'-F/2'-OME SIRNA CON 5'-R(P*(A2M)P*(UFT)P*(OMG)P*(AF2)P*(A2M)P*(GF2)P* P*(AF2)P*(OMU)P*(GF2)P*(OMU)P*(AF2)P*(OMU)P*(UFT)P*(OMU)P*( P*(OMC)P*(CFZ)P*(OMC)P*(UFT)P*(OMU))-3', 5'-R(*(GF2)P*(OMG)P*(GF2)P*(OMU)P*(AF2)P*(A2M)P*( P*(OMU)P*(AF2)P*(OMC)P*(AF2)P*(OMU)P*(UFT)P*(OMC)P*(UFT)P*( P*(CFZ)P*(A2M)P*(UFT)P*(OMU)P*(UFT))-3' RNA SIRNA, 2'-FLUORO, 2'-O-METHYL, RNA
2oue	nuc      2.05	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF A JUNCTIONLESS ALL-RNA HAIRPIN RIBOZYME ANGSTROMS RESOLUTION SUBSTRATE STRAND - MINIMAL JUNCTIONLESS HAIRPIN R CHAIN: A, LOOP B S-TURN STRAND, LOOP B RIBOZYME STRAND, LOOP A RIBOZYME STRAND RNA RNA, HAIRPIN RIBOZYME, ALL-RNA, MUTATION, LOW SALT, S-TURN, RIBOSE ZIPPER, CATALYTIC RNA
3b5a	nuc      2.35	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF A MINIMALLY HINGED HAIRPIN RIBOZYME INC A38G MUTATION WITH A 2'OME MODIFICATION AT THE ACTIVE SITE LOOP B S-TURN STRAND, LOOP A SUBSTRATE STRAND29-MER LOOP A AND LOOP B RIBOZYME STRAND RNA HAIRPIN RIBOZYME, 2'O-METHYL, RIBOZYME, RNA
3b5s	nuc      2.25	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	MINIMALLY HINGED HAIRPIN RIBOZYME INCORPORATES A38DAP MUTATI O-METHYL MODIFICATION AT THE ACTIVE SITE LOOP A SUBSTRATE STRAND, 29-MER LOOP A AND LOOP B RIBOZYME STRAND, LOOP B S-TURN STRAND RNA HAIRPIN RIBOZYME; RNA; 2, 6 DIAMINOPURINE; 2'-O-METHYL, RNA
3bbi	nuc      2.35	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	MINIMALLY JUNCTIONED HAIRPIN RIBOZYME INCORPORATING A38(2AP) 2'-O-ME MODIFICATIONS NEAR ACTIVE SITE LOOP A SUBSTRATE STRAND, LOOP B S-TURN STRAND, LOOP A AND LOOP B RIBOZYME STRAND RNA HAIRPIN RIBOZYME, 2-AMINOPURINE, 2'O-METHYL, PHOSPHORYL TRAN RNA, LINKER
3bbm	nuc      2.65	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	MINIMALLY JUNCTIONED HAIRPIN RIBOZYME INCORPORATES A38C AND MODIFICATION AT ACTIVE SITE LOOP A AND LOOP B RIBOZYME STRAND, LOOP B S-TURN STRAND, LOOP A SUBSTRATE STRAND RNA HAIRPIN RIBOZYME, PHOSPHORYL TRANSFER, 2'O-METHYL, RNA, SMAL RIBOZYME
3cr1	nuc      2.25	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF A MINIMAL, MUTANT, ALL-RNA HAIRPIN RIBO (A38C, A-1OMA) GROWN FROM MGCL2 RNA (5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*C CHAIN: A, LOOP A AND B RIBOZYME STRAND, RNA (5'- R(*UP*CP*GP*UP*GP*GP*UP*CP*CP*AP*UP*UP*AP*CP*CP*UP*GP*CP*C) CHAIN: C RNA RIBOZYME, A38, RNA
3i2q	nuc      2.90	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF THE HAIRPIN RIBOZYME WITH 2'OME SUBSTRA AND N1-DEAZAADENOSINE AT POSITION A9 DNA/RNA (30-MER), 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*C *C)-3', 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*CP*GP* CHAIN: A RNA HAIRPIN RIBOZYME, N1-DEAZAADENOSINE, RNA
3i2s	nuc      2.75	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF THE HAIRPIN RIBOZYME WITH A 2'OME SUBST N1-DEAZAADENOSINE AT POSITION A10 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*CP*CP*GP* CHAIN: A, 5'-R(*UP*CP*GP*UP*GP*GP*UP*AP*CP*AP*UP*UP*AP*CP*C *C)-3', DNA/RNA (30-MER) RNA HAIRPIN RIBOZYME, N1-DEAZAADENOSINE, RNA
4g6p	nuc      2.64	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	MINIMAL HAIRPIN RIBOZYME IN THE PRECATALYTIC STATE WITH A38P LOOP A SUBSTRATE STRAND, LOOP B OF THE RIBOZYME STRAND, LOOP A AND LOOP B RIBOZYME STRAND RNA RNA, STRUCTURE-ACTIVITY RELATIONSHIP, NUCLEIC ACID CONFORMAT
4rbz	nuc      1.18	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	X-RAY STRUCTURE OF RNA CONTAINING ADENOSINE PHOSPHORODITHIOA 5'-R(*CP*GP*CP*GP*(A2M)P*(ADS)P*UP*UP*AP*GP*CP*G) CHAIN: A RNA PHOSPHORODITHIOATE RNA, ADENOSINE PHOSPHORODITHIOATE, PHOSPHOROTHIOATE, ADENOSINE ANALOGUE, HYDROPHOBIC, BACKBONE
4rc0	nuc      1.13	2'-O-METHYLADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C11 H16 N5 O7 P	X-RAY STRUCTURE OF RNA CONTAINING GUANOSINE PHOSPHORODITHIOA 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*(A2M)P*(2SG)P*CP*G) CHAIN: A RNA PHOSPHORODITHIOATE RNA, GUANOSINE PHOSPHORODITHIOATE, PHOSPHOROTHIOATE, GUANOSINE ANALOGUE, HYDROPHOBIC, BACKBONE

A38    8-OXY DEOXYADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1d75	nuc      2.80	8-OXY DEOXYADENOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O7 P)	CONFORMATION OF THE GUANINE.8-OXOADENINE BASE PAIRS IN THE CRYSTAL STRUCTURE OF D(CGCGAATT(O8A)GCG) DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(A38) P*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED, MISMATCHED
1fjb	nuc      NMR    	8-OXY DEOXYADENOSINE-5'-MONOPHOSPHATE C10 H14 N5 O7 P	NMR STUDY OF AN 11-MER DNA DUPLEX CONTAINING 7,8-DIHYDRO-8- OXOADENINE (AOXO) OPPOSITE THYMINE DNA (5'-D(*CP*GP*TP*AP*CP*(A38)P*CP*AP*TP*GP*C)- 3'), DNA (5'-D(*GP*CP*AP*TP*GP*TP*GP*TP*AP*CP*G)-3') DNA DNA

A3A    2'DEOXY-ALPHA-ANOMERIC-ADENOSINE-5'-PHOSPHATE

Code	Class Resolution	Description
1s0t	nuc      NMR    	2'DEOXY-ALPHA-ANOMERIC-ADENOSINE-5'-PHOSPHATE C10 H14 N5 O6 P	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING AN ALPHA- ANOMERIC ADENOSINE: INSIGHTS INTO SUBSTRATE RECOGNITION BY ENDONUCLEASE IV 5'-D(*GP*TP*CP*CP*(A3A)P*CP*GP*AP*CP*G)-3', 5'-D(*CP*GP*TP*CP*GP*TP*GP*GP*AP*C)-3' DNA DNA DOUBLE HELIX WITH ENLARGED MINER GROOVE AND HELICAL KINK
1s74	nuc      NMR    	2'DEOXY-ALPHA-ANOMERIC-ADENOSINE-5'-PHOSPHATE C10 H14 N5 O6 P	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING AN ALPHA- ANOMERIC ADENOSINE: INSIGHTS INTO SUBSTRATE RECOGNITION BY ENDONUCLEASE IV 5'-D(*GP*TP*CP*CP*(A3A)P*CP*GP*AP*CP*G)-3', 5'-D(*CP*GP*TP*CP*GP*TP*GP*GP*AP*C)-3' DNA DNA DOUBLE HELIX WITH ENLARGED MINER GROOVE AND HELICAL KINK
1s75	nuc      NMR    	2'DEOXY-ALPHA-ANOMERIC-ADENOSINE-5'-PHOSPHATE C10 H14 N5 O6 P	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING AN ALPHA- ANOMERIC ADENOSINE: INSIGHTS INTO SUBSTRATE RECOGNITION BY ENDONUCLEASE IV 5'-D(*CP*GP*TP*CP*GP*TP*GP*GP*AP*C)-3', 5'-D(*GP*TP*CP*CP*(A3A)P*CP*GP*AP*CP*G)-3' DNA DNA DOUBLE HELIX WITH ENLARGED MINER GROOVE AND HELICAL KINK
2lib	nuc      NMR    	2'DEOXY-ALPHA-ANOMERIC-ADENOSINE-5'-PHOSPHATE C10 H14 N5 O6 P	DNA SEQUENCE CONTEXT CONCEALS ALPHA ANOMERIC LESION DNA (5'-D(*CP*GP*TP*CP*CP*TP*GP*GP*AP*C)-3'), DNA (5'-D(*GP*TP*CP*CP*(A3A)P*GP*GP*AP*CP*G)-3') DNA ALPHA ANOMERIC ADENOSINE, DNA DAMAGE, FLANKING SEQUENCE EFFE STRUCTURAL PERTURBATION, STRUCTURAL DISTORTION, MINOR GROOV DISTORTION, ENDONUCLEASE IV, ENZYME RECOGNITION, HELICAL AX ENZYME MODULATION, DNA REPAIR, DNA PERTURBATION, DNA

A40    N2-METHYL 2'-DEOXYADENOSINE 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1d35	nuc      1.30	N2-METHYL 2'-DEOXYADENOSINE 5'-MONOPHOSPHATE C11 H17 N6 O6 P	FACILE FORMATION OF A CROSSLINKED ADDUCT BETWEEN DNA AND THE DAUNORUBICIN DERIVATIVE MAR70 MEDIATED BY FORMALDEHYDE: MOLECULAR STRUCTURE OF THE MAR70-D(CGTNACG) COVALENT ADDUC DNA (5'-D(*CP*GP*TP*(A40)P*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
2d34	nuc      1.40	N2-METHYL 2'-DEOXYADENOSINE 5'-MONOPHOSPHATE C11 H17 N6 O6 P	FORMALDEHYDE CROSS-LINKS DAUNORUBICIN AND DNA EFFICIENTLY: HPLC AND X-RAY DIFFRACTION STUDIES 5'-D(*CP*GP*TP*(A35)P*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED

A43    3'-AMINO DEOXYADENOSINE 5'-MONOPHOSPHATE

Code	Class Resolution	Description
363d	nuc      2.00	3'-AMINO DEOXYADENOSINE 5'-MONOPHOSPHATE 12(C10 H15 N6 O5 P)	HIGH-RESOLUTION CRYSTAL STRUCTURE OF A FULLY MODIFIED N3'-> PHOSPHORAMIDATE DNA DODECAMER DUPLEX 5'-D(*(C42)P*(G38)P*(C42)P*(G38)P*(A43)P*(A43)P*( P*(NYM)P*(C42)P*(G38)P*(C42)P*DG)-3' DNA A-DNA, MODIFIED, DNA

A44    2'-O-METHYOXYETHYL-ADENOSINE 5'-MONOPHOSPHATE

Code	Class Resolution	Description
2m39	nuc      NMR    	2'-O-METHYOXYETHYL-ADENOSINE 5'-MONOPHOSPHATE 4(C13 H20 N5 O8 P)	THE SOLUTION STRUCTURE OF 3',5'-LINKED 2'-O-(2-METHOXYETHYL) DUPLEX RNA (5'-R(*(C5L)P*(G48)P*(C5L)P*(G48)P*(A44)P*(A4 P*(T39)P*(C5L)P*(G48)P*(C5L)P*DG)-3') RNA DUPLEX, (3',5')-RNA, 2'-O-(2-METHOXYETHYL) RIBOSE, RNA
468d	nuc      1.80	2'-O-METHYOXYETHYL-ADENOSINE 5'-MONOPHOSPHATE 4(C13 H20 N5 O8 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA
469d	nuc      1.70	2'-O-METHYOXYETHYL-ADENOSINE 5'-MONOPHOSPHATE 4(C13 H20 N5 O8 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RNA
470d	nuc      1.95	2'-O-METHYOXYETHYL-ADENOSINE 5'-MONOPHOSPHATE 4(C13 H20 N5 O8 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA
471d	nuc      2.70	2'-O-METHYOXYETHYL-ADENOSINE 5'-MONOPHOSPHATE 4(C13 H20 N5 O8 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA

A47    N6-METHOXY ADENOSINE 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1edr	nuc      1.60	N6-METHOXY ADENOSINE 5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	MOLECULAR AND CRYSTAL STRUCTURE OF D(CGCGMO6AATTCGCG) AT 1.6 ANGSTROM 5'-D(*CP*GP*CP*GP*(A47)AP*AP*TP*TP*CP*GP*CP*G)- 3' DNA B-DNA, DOUBLE HELIX, DEOXYRIBONUCLEIC ACID, MODIFIED NUCLEOTIDE, METHOXYADENOSINE, DAMAGED DNA
456d	nuc      1.60	N6-METHOXY ADENOSINE 5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	MOLECULAR AND CRYSTAL STRUCTURE OF D(CGCGMO6AATCCGCG): THE WATSON-CRICK TYPE N6-METHOXYADENOSINE/CYTIDINE BASE-PAIRS IN B-DNA DNA (5'-D(*CP*GP*CP*GP*(A47) P*AP*TP*CP*CP*GP*CP*G)-3') DNA MODIFIED NUCLEOTIDE, MISMATCH, METHOXYADENOSINE, DNA DAMAGE, B-DNA, DOUBLE HELIX
457d	nuc      2.00	N6-METHOXY ADENOSINE 5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	MOLECULAR AND CRYSTAL STRUCTURE OF D(CGCGMO6AATTCGCG): N6- METHOXYADENOSINE/ THYMIDINE BASE-PAIRS IN B-DNA DNA (5'-D(*CP*GP*CP*GP*(A47) P*AP*TP*TP*CP*GP*CP*G)-3') DNA MODIFIED NUCLEOTIDE, METHOXYADENOSINE, DNA DAMAGE, B-DNA, DOUBLE HELIX

A4A    [1,3]BENZODIOXOLO[6,5,4-CD]BENZO[F]INDOL-5(6H)-ONE

Code	Class Resolution	Description
2lgm	nuc      NMR    	[1,3]BENZODIOXOLO[6,5,4-CD]BENZO[F]INDOL-5(6H)-ONE C16 H9 N O3	STRUCTURE OF DNA CONTAINING AN ARISTOLACTAM II-DA LESION DNA (5'-D(*CP*GP*TP*AP*CP*AP*CP*AP*TP*GP*C)-3'), DNA (5'-D(*GP*CP*AP*TP*GP*TP*GP*TP*AP*CP*G)-3') DNA DUPLEX STABILITY, NER RECOGNITION, DNA

A4C    9,9'-(HEXANE-1,6-DIYLDIIMINO)BIS{N-[2-(DIMETHYLAMINO) ETHYL]ACRIDINE-4-CARBOXAMIDE}

Code	Class Resolution	Description
2gb9	nuc      1.70	9,9'-(HEXANE-1,6-DIYLDIIMINO)BIS{N-[2-(DIMETHYLAMINO) ETHYL]ACRIDINE-4-CARBOXAMIDE} 2(C42 H50 N8 O2)	D(CGTACG)2 CROSSLINKED BIS-ACRIDINE COMPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DNA DUPLEX CROSSLINKING
2gwa	nuc      1.75	9,9'-(HEXANE-1,6-DIYLDIIMINO)BIS{N-[2-(DIMETHYLAMINO) ETHYL]ACRIDINE-4-CARBOXAMIDE} C42 H50 N8 O2	CRYSTAL STRUCTURE OF A COMPLEX FORMED BETWEEN THE DNA HOLLIDAY JUNCTION AND A BIS-ACRIDINE MOLECULE. 5'-D(*TP*CP*GP*GP*TP*AP*CP*CP*GP*A)-3' DNA DNA HOLLIDAY JUNCTION BIS-ACRIDINE

A4L    9-[(5-(ACETYLAMINO)-6-{[(1S,4R)-8-AMINO-4-[((2R)-6- AMINO-2-{2-[(1S)-5-AMINO-1- FORMYLPENTYL]HYDRAZINO}HEXANOYL)AMINO]-1-(4- AMINOBUTYL)-2,3-DIOXOOCTYL]AMINO}-6-OXOHEXYL)AMINO]-6- CHLORO-2-METHOXYACRIDINIUM

Code	Class Resolution	Description
1xcs	nuc      1.40	9-[(5-(ACETYLAMINO)-6-{[(1S,4R)-8-AMINO-4-[((2R)-6- AMINO-2-{2-[(1S)-5-AMINO-1- FORMYLPENTYL]HYDRAZINO}HEXANOYL)AMINO]-1-(4- AMINOBUTYL)-2,3-DIOXOOCTYL]AMINO}-6-OXOHEXYL)AMINO]-6- CHLORO-2-METHOXYACRIDINIUM C46 H73 CL N11 O7 1+	STRUCTURE OF OLIGONUCLEOTIDE/DRUG COMPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, DOUBLE HELIX, CO2+, DNA

A5L    9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-9H-PURIN-6-AMINE

Code	Class Resolution	Description
2kp4	nuc      NMR    	9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-9H-PURIN-6-AMINE 3(C10 H13 F N5 O6 P)	STRUCTURE OF 2'F-ANA/RNA HYBRID DUPLEX DNA (5'-D(*(GFL)P*(CFL)P*(TAF)P*(A5L)P*(TAF)P*(A5 P*(TAF)P*(GFL)P*(GFL))-3'), RNA (5'-R(*CP*CP*AP*UP*UP*AP*UP*AP*GP*C)-3') DNA/RNA 2-DEOXY-2-FLUORO-D-ARABINOSE, FANA, NUCLEIC ACID STRUCTURE, NMR/MD/TI, HYBRID DUPLEX, DNA-RNA COMPLEX

A5M    2'-AMINE-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1yrm	nuc      2.50	2'-AMINE-CYTIDINE-5'-MONOPHOSPHATE 3(C9 H15 N4 O7 P)	CRYSTAL STRUCTURE OF AN RNA DUPLEX CONTAINING SITE SPECIFIC SUBSTITUTIONS AT A C-A MISMATCH DNA/RNA (5'-R(*GP*CP*AP*GP*A)-D(P*(A5M))- R(P*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3') RNA 2'-AMINE, RNA, DUPLEX, MISMATCH
1yy0	nuc      3.20	2'-AMINE-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H15 N4 O7 P)	CRYSTAL STRUCTURE OF AN RNA DUPLEX CONTAINING A 2'-AMINE SUB AND A 2'-AMIDE PRODUCT PRODUCED BY IN-CRYSTAL ACYLATION AT MISMATCH 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP*AP*AP*UP*CP* 3', 5'-R(*GP*CP*AP*GP*AP*(M5M)P*UP*UP*AP*AP*AP*UP*CP* 3' RNA 2'-AMINE, RNA, DUPLEX, MISMATCH, 2-AMIDE, IN-CRYSTAL REACTIO
1yzd	nuc      2.35	2'-AMINE-CYTIDINE-5'-MONOPHOSPHATE 3(C9 H15 N4 O7 P)	CRYSTAL STRUCTURE OF AN RNA DUPLEX CONTAINING A SITE SPECIFI SUBSTITUTION AT A C-G WATSON-CRICK BASE PAIR RNA 5'-R(*GP*CP*AP*GP*AP*(A5M) P*UP*UP*AP*AP*GP*UP*CP*UP*GP*C)-3' RNA 2'-AMINE, RNA, DUPLEX
1z79	nuc      2.55	2'-AMINE-CYTIDINE-5'-MONOPHOSPHATE 3(C9 H15 N4 O7 P)	CRYSTAL STRUCTURE OF AN RNA DUPLEX CONTAINING SITE SPECIFIC SUBSTITUTION AT A C-A MISMATCH (AT PH 5) RNA 5'-R(*GP*CP*AP*GP*AP*(A5M) P*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3' RNA 2'-AMINE, RNA, DUPLEX, MISMATCH

A5O    ADENINE ARABINOSE-5'-PHOSPHATE

Code	Class Resolution	Description
2kp3	nuc      NMR    	ADENINE ARABINOSE-5'-PHOSPHATE 3(C10 H14 N5 O7 P)	STRUCTURE OF ANA-RNA HYBRID DUPLEX RNA (5'-R(*CP*CP*AP*UP*UP*AP*UP*AP*GP*C)-3'), RNA (5'-R(*(GAO)P*(CAR)P*(UAR)P*(A5O)P*(UAR)P*(A5 P*(UAR)P*(GAO)P*(GAO))-3') RNA ANA, ARABINONUCLEIC ACID, NUCLEIC ACID STRUCTURE, NMR/MD/TI, DUPLEX, RNA
2lsc	nuc      NMR    	ADENINE ARABINOSE-5'-PHOSPHATE 4(C10 H14 N5 O7 P)	SOLUTION STRUCTURE OF 2'F-ANA AND ANA SELF-COMPLEMENTARY DUP DNA (5'-D(*(CFL)P*(GFL)P*(CFL)P*(GFL)P*(A5O)P*(A5 P*(UAR)P*(CFL)P*(GFL)P*(CFL)P*(GFL))-3') DNA DNA, DICKERSON DREW DODECAMER

A66    2-AMINOETHYLLYSINE-CARBONYLMETHYLENE-ADENINE

Code	Class Resolution	Description
1nr8	nuc      1.66	2-AMINOETHYLLYSINE-CARBONYLMETHYLENE-ADENINE C15 H24 N8 O3	THE CRYSTAL STRUCTURE OF A D-LYSINE-BASED CHIRAL PNA-DNA DUP 5'-D(P*AP*GP*TP*GP*AP*TP*CP*TP*AP*C)-3', H-((GPN)*(TPN)*(APN)*(GPN)*(A66)*(T66)*(C66)*(APN *(TPN))-NH2 DNA/PEPTIDE NUCLEIC ACID CHIRAL PEPTIDE NUCLEIC ACID, DOUBLE STRANDED HELIX, P-FORM, PEPTIDE NUCLEIC ACID COMPLEX

A6A    2-(6-AMINO-9H-PURIN-9-YL)-1,5-ANHYDRO-2-DEOXY-6-O- PHOSPHONO-D-ALTRITOL

Code	Class Resolution	Description
3ok2	nuc      1.96	2-(6-AMINO-9H-PURIN-9-YL)-1,5-ANHYDRO-2-DEOXY-6-O- PHOSPHONO-D-ALTRITOL 6(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF THE ANA:RNA DECAMER WITHOUT LATTICE TRA DEFECTS (A6C)(A6C)(A6G)(A6U)(A6A)(A6A)(A6U)(A6G)(A6C)(A6C CHAIN: A, C, E, GGCAUUACGG RNA RNA, HYBRID, ANA, SUGAR MODIFICATION, ALTRITOL SUGAR RINGS
3ok4	nuc      1.15	2-(6-AMINO-9H-PURIN-9-YL)-1,5-ANHYDRO-2-DEOXY-6-O- PHOSPHONO-D-ALTRITOL 30(C11 H16 N5 O7 P)	CRYSTAL STRUCTURE OF THE ANA:RNA DECAMER SUFFERING FROM LATT TRANSLOCATION DEFECTS ANA, RNA RNA ALTRITOL, SUGAR MODIFICATION, RNA, LATTICE TRANSLOCATION DEF

A6C    2-(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)-1,5-ANHYDRO-2- DEOXY-6-O-PHOSPHONO-D-ALTRITOL

Code	Class Resolution	Description
3ok2	nuc      1.96	2-(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)-1,5-ANHYDRO-2- DEOXY-6-O-PHOSPHONO-D-ALTRITOL 12(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE ANA:RNA DECAMER WITHOUT LATTICE TRA DEFECTS (A6C)(A6C)(A6G)(A6U)(A6A)(A6A)(A6U)(A6G)(A6C)(A6C CHAIN: A, C, E, GGCAUUACGG RNA RNA, HYBRID, ANA, SUGAR MODIFICATION, ALTRITOL SUGAR RINGS
3ok4	nuc      1.15	2-(4-AMINO-2-OXOPYRIMIDIN-1(2H)-YL)-1,5-ANHYDRO-2- DEOXY-6-O-PHOSPHONO-D-ALTRITOL 60(C10 H16 N3 O8 P)	CRYSTAL STRUCTURE OF THE ANA:RNA DECAMER SUFFERING FROM LATT TRANSLOCATION DEFECTS ANA, RNA RNA ALTRITOL, SUGAR MODIFICATION, RNA, LATTICE TRANSLOCATION DEF

A6G    2-(2-AMINO-6-OXO-1,6-DIHYDRO-9H-PURIN-9-YL)-1,5- ANHYDRO-2-DEOXY-6-O-PHOSPHONO-D-ALTRITOL

Code	Class Resolution	Description
3ok2	nuc      1.96	2-(2-AMINO-6-OXO-1,6-DIHYDRO-9H-PURIN-9-YL)-1,5- ANHYDRO-2-DEOXY-6-O-PHOSPHONO-D-ALTRITOL 6(C11 H16 N5 O8 P)	CRYSTAL STRUCTURE OF THE ANA:RNA DECAMER WITHOUT LATTICE TRA DEFECTS (A6C)(A6C)(A6G)(A6U)(A6A)(A6A)(A6U)(A6G)(A6C)(A6C CHAIN: A, C, E, GGCAUUACGG RNA RNA, HYBRID, ANA, SUGAR MODIFICATION, ALTRITOL SUGAR RINGS
3ok4	nuc      1.15	2-(2-AMINO-6-OXO-1,6-DIHYDRO-9H-PURIN-9-YL)-1,5- ANHYDRO-2-DEOXY-6-O-PHOSPHONO-D-ALTRITOL 30(C11 H16 N5 O8 P)	CRYSTAL STRUCTURE OF THE ANA:RNA DECAMER SUFFERING FROM LATT TRANSLOCATION DEFECTS ANA, RNA RNA ALTRITOL, SUGAR MODIFICATION, RNA, LATTICE TRANSLOCATION DEF

A6U    1,5-ANHYDRO-2-DEOXY-2-(2,4-DIOXO-3,4-DIHYDROPYRIMIDIN- 1(2H)-YL)-6-O-PHOSPHONO-D-ALTRITOL

Code	Class Resolution	Description
3ok2	nuc      1.96	1,5-ANHYDRO-2-DEOXY-2-(2,4-DIOXO-3,4-DIHYDROPYRIMIDIN- 1(2H)-YL)-6-O-PHOSPHONO-D-ALTRITOL 6(C10 H15 N2 O9 P)	CRYSTAL STRUCTURE OF THE ANA:RNA DECAMER WITHOUT LATTICE TRA DEFECTS (A6C)(A6C)(A6G)(A6U)(A6A)(A6A)(A6U)(A6G)(A6C)(A6C CHAIN: A, C, E, GGCAUUACGG RNA RNA, HYBRID, ANA, SUGAR MODIFICATION, ALTRITOL SUGAR RINGS
3ok4	nuc      1.15	1,5-ANHYDRO-2-DEOXY-2-(2,4-DIOXO-3,4-DIHYDROPYRIMIDIN- 1(2H)-YL)-6-O-PHOSPHONO-D-ALTRITOL 30(C10 H15 N2 O9 P)	CRYSTAL STRUCTURE OF THE ANA:RNA DECAMER SUFFERING FROM LATT TRANSLOCATION DEFECTS ANA, RNA RNA ALTRITOL, SUGAR MODIFICATION, RNA, LATTICE TRANSLOCATION DEF

A71    (6-AMINOHEXYLAMINE)(TRIAMMINE) PLATINUM(II) COMPLEX

Code	Class Resolution	Description
2dyw	nuc      1.13	(6-AMINOHEXYLAMINE)(TRIAMMINE) PLATINUM(II) COMPLEX 3(C6 H25 N5 PT)	A BACKBONE BINDING DNA COMPLEX 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA PLATINUM, PHOSPHATE CLAMP, ANTICANCER DRUG, DNA

A72    TRANS-BIS(HEXYLAMINE)-(DIAMMINE) PLATINUM(II) COMPLEX

Code	Class Resolution	Description
2dyw	nuc      1.13	TRANS-BIS(HEXYLAMINE)-(DIAMMINE) PLATINUM(II) COMPLEX C12 H36 N4 PT	A BACKBONE BINDING DNA COMPLEX 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA PLATINUM, PHOSPHATE CLAMP, ANTICANCER DRUG, DNA

A7E    3-ETHYNYL-1-(5-O-PHOSPHONO-BETA-D-RIBOFURANOSYL)-1H- PYRAZOLO[3,4-D]PYRIMIDIN-4-AMINE

Code	Class Resolution	Description
4nfp	nuc      1.85	3-ETHYNYL-1-(5-O-PHOSPHONO-BETA-D-RIBOFURANOSYL)-1H- PYRAZOLO[3,4-D]PYRIMIDIN-4-AMINE 3(C12 H14 N5 O7 P)	CRYSTAL STRUCTURE ANALYSIS OF THE 16MER GCAGNCUUAAGUCUGC CON AZA-7-DEAZA-7-ETHYNYL ADENOSINE GCAG(A7E)CUUAAGUCUGC RNA RNA 16MER OLIGO, 8-AZA-7-DEAZA-7-ETHYNYLADENOSINE, POSITION

AAB    2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1a9g	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	APURINIC DNA WITH BOUND WATER AT THE DAMAGED SITE AND N3 OF BETA FORM, NMR, 1 STRUCTURE DNA (5'-D(*CP*GP*CP*GP*AP*AABP*AP*CP*GP*CP*C)-3') CHAIN: A, DNA (5'-D(*GP*GP*CP*GP*TP*CP*TP*CP*GP*CP*G)-3') DNA DAMAGED DNA, APURINIC DNA, WATER, DNA
1a9h	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	APURINIC DNA WITH BOUND WATER AT THE DAMAGED SITE AND O2 OF BETA FORM, NMR, 1 STRUCTURE DNA (5'-D(*CP*GP*CP*GP*AP*AABP*AP*CP*GP*CP*C)-3') CHAIN: A, DNA (5'-D(*GP*GP*CP*GP*TP*CP*TP*CP*GP*CP*G)-3') DNA DAMAGED DNA, APURINIC DNA, WATER, DNA
1a9i	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	APYRIMIDINIC DNA WITH BOUND WATER AT THE DAMAGED SITE, ALPHA NMR, 1 STRUCTURE DNA (5'-D(*CP*GP*CP*GP*AP*AABP*AP*CP*GP*CP*C)-3') CHAIN: A, DNA (5'-D(*GP*GP*CP*GP*TP*AP*TP*CP*GP*CP*G)-3') DNA DAMAGED DNA, APYRIMIDINIC DNA, WATER, DNA
1a9j	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	APYRIMIDINIC DNA WITH BOUND WATER AT THE DAMAGED SITE, BETA 1 STRUCTURE DNA (5'-D(*GP*GP*CP*GP*TP*AP*TP*CP*GP*CP*G)-3'), DNA (5'-D(*CP*GP*CP*GP*AP*AABP*AP*CP*GP*CP*C)-3') CHAIN: A DNA DAMAGED DNA, APYRIMIDINIC DNA, WATER, DNA
1g5e	nuc      NMR    	2-DEOXY-5-PHOSPHORIBOSE GROUP C5 H11 O7 P	NMR STRUCTURE OF AN OLIGONUCLEOTIDE CONTAINING AN ABASIC SITE: BETA ANOMER 5'-D(*CP*CP*CP*AP*GP*TP*AP*CP*TP*TP*TP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*GP*(AAB)P*AP*CP*TP*GP*GP*G)- 3' DNA DAMAGED DNA, APYRIMIDINIC SITE
1gj0	nuc      NMR    	2-DEOXY-5-PHOSPHORIBOSE GROUP C5 H11 O7 P	NMR STRUCTURE OF AN OLIGONUCLEOTIDE CONTAINING AN ABASIC SITE: BETA ANOMER 5'-D(*CP*CP*AP*AP*AP*GP*(AAB)P*AP*CP*TP*GP*GP*G)- 3', 5'-D(*CP*CP*CP*AP*GP*TP*AP*CP*TP*TP*TP*GP*G)-3' DNA DAMAGED DNA, APYRIMIDINIC SITE
1sjl	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	A DUPLEX DNA WITH AN ABASIC SITE IN A DA TRACT, BETA FORM, N MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*CP*GP*CP*AP*AP*AP*AP*AP*TP*GP*CP*G)-3' CHAIN: A, DNA (5'-D(*CP*GP*CP*AP*TP*TP*(AAB)P*TP*TP*GP*CP*G CHAIN: B DNA DUPLEX DNA WITH AN ABASIC SITE IN A DA TRACT, DAMAGED DNA, A DNA, DEOXYRIBONUCLEIC ACID, DNA
2hsr	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	13MER DUPLEX DNA CONTAINING AN ABASIC SITE WITH BETA ANOMER 5'-D(*CP*CP*CP*GP*GP*TP*AP*CP*TP*TP*TP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*GP*(AAB)P*AP*CP*CP*GP*GP*G)- CHAIN: A DNA ABASIC SITE, DNA DAMAGE, BASE EXCISION REPAIR, APE1, DNA
2hss	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	13MER DUPLEX DNA CONTAING AN ABASIC SITE WITH BETA ANOMER, A STRUCTURE 5'-D(*CP*CP*CP*GP*GP*TP*AP*CP*TP*TP*TP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*GP*(AAB)P*AP*CP*CP*GP*GP*G)- CHAIN: A DNA ABASIC SITE, DNA DAMAGE, BASE EXCISION REPAIR, APE1, DNA
2m3y	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	DNA CONTAINING A CLUSTER OF 8-OXO-GUANINE AND ABASIC SITE LE ANOMER DNA (5'-D(*CP*GP*CP*TP*CP*(AAB)P*CP*AP*CP*GP*C)-3 CHAIN: A, DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3 CHAIN: B DNA DNA LESION CLUSTER, 8-OXO-GUANINE, ABASIC SITE, DNA
2m44	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	DNA CONTAINING A CLUSTER OF 8-OXO-GUANINE AND ABASIC SITE LE ANOMER (6AP, 8OG14) DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3 CHAIN: B, DNA (5'-D(*CP*GP*CP*TP*CP*(AAB)P*CP*AP*CP*GP*C)-3 CHAIN: A DNA DNA LESION CLUSTER, 8-OXO-GUANINE, ABASIC SITE, DNA
2o7x	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	DUPLEX DNA CONTAINING AN ABASIC SITE WITH AN OPPOSITE G (BET IN 5'-G_AC-3' (10 STRUCTURE ENSEMBLE AND AVERAGED STRUCTURE 5'-D(*CP*CP*CP*GP*GP*TP*GP*CP*TP*TP*TP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*GP*(AAB)P*AP*CP*CP*GP*GP*G)- CHAIN: A DNA DNA DAMAGE, APE1, ABASIC, AMBER, MOLECULAR DYNAMICS, DNA
2o7z	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	DUPLEX DNA CONTAINING AN ABASIC SITE WITH AN OPPOSITE T (BET IN 5'-G_AC-3' (10 STRUCTURE ENSEMBLE AND AVERAGED STRUCTURE 5'-D(*CP*CP*AP*AP*AP*GP*(AAB)P*AP*CP*CP*GP*GP*G)- CHAIN: A, 5'-D(*CP*CP*CP*GP*GP*TP*TP*CP*TP*TP*TP*GP*G)-3' DNA DNA DAMAGE, APE1, ABASIC, AMBER, MOLECULAR DYNAMICS, DNA
2o82	nuc      NMR    	2'-DEOXY-RIBOFURANOSE-5'-MONOPHOSPHATE C5 H11 O7 P	DUPLEX DNA CONTAINING AN ABASIC SITE WITH AN OPPOSITE DC (BE IN 5'-G_AC-3' (10 STRUCTURE ENSEMBLE AND AVERAGED STRUCTURE 5'-D(*CP*CP*CP*GP*GP*TP*CP*CP*TP*TP*TP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*GP*(AAB)P*AP*CP*CP*GP*GP*G)- CHAIN: A DNA DNA DAMAGE, APE1, ABASIC, AMBER, MOLECULAR DYNAMICS, DNA

AAR    ARGININEAMIDE

Code	Class Resolution	Description
1db6	nuc      NMR    	ARGININEAMIDE C6 H16 N5 O 1+	SOLUTION STRUCTURE OF THE DNA APTAMER 5'- CGACCAACGTGTCGCCTGGTCG-3' COMPLEXED WITH ARGININAMIDE DNA DNA APTAMER, ARGININE, ARGININAMIDE, SINGLE-STRAND, HAIRPIN, NMR, SELEX, DNA

AB6    (2R)-4-AMINO-N-((1R,2S,3R,4R,5S)-5-AMINO-4-[(2-AMINO- 2-DEOXY-ALPHA-D-GLUCOPYRANOSYL)OXY]-2-{2-[(3- AMINOPROPYL)AMINO]ETHOXY}-3-HYDROXYCYCLOHEXYL)-2- HYDROXYBUTANAMIDE

Code	Class Resolution	Description
2f4u	nuc      2.60	(2R)-4-AMINO-N-((1R,2S,3R,4R,5S)-5-AMINO-4-[(2-AMINO- 2-DEOXY-ALPHA-D-GLUCOPYRANOSYL)OXY]-2-{2-[(3- AMINOPROPYL)AMINO]ETHOXY}-3-HYDROXYCYCLOHEXYL)-2- HYDROXYBUTANAMIDE C21 H44 N6 O9	ASITE RNA + DESIGNER ANTIBIOTIC 5'- R(*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP *GP*C)-3' RNA ASITE RNA, DESIGNER ANTIBIOTIC

AB9    (2R)-4-AMINO-N-{(1R,2S,3R,4R,5S)-5-AMINO-2-{2-[(2- AMINOETHYL)AMINO]ETHOXY}-4-[(2,6-DIAMINO-2,6-DIDEOXY- ALPHA-D-GLUCOPYRANOSYL)OXY]-3-HYDROXYCYCLOHEXYL}-2- HYDROXYBUTANAMIDE

Code	Class Resolution	Description
2f4t	nuc      3.00	(2R)-4-AMINO-N-{(1R,2S,3R,4R,5S)-5-AMINO-2-{2-[(2- AMINOETHYL)AMINO]ETHOXY}-4-[(2,6-DIAMINO-2,6-DIDEOXY- ALPHA-D-GLUCOPYRANOSYL)OXY]-3-HYDROXYCYCLOHEXYL}-2- HYDROXYBUTANAMIDE C20 H43 N7 O8	ASITE RNA + DESIGNER ANTIBIOTIC 5'- R(*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP *GP*C)-3', 5'- R(*UP*UP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP *UP*CP*GP*C)-3' RNA ASITE RNA, DESIGNER ANTIBIOTIC

ABR    (R)-(N-PHENYL-2-HYDROXY-ETHYL)-2'-DEOXY-ADENOSINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
1k5e	nuc      NMR    	(R)-(N-PHENYL-2-HYDROXY-ETHYL)-2'-DEOXY-ADENOSINE-5'- MONOPHOSPHATE C18 H22 N5 O7 P	SOLUTION STRUCTURE OF R-STYRENE ADDUCT IN THE RAS61 SEQUENCE 5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP*G)-3', 5'-D(*CP*GP*GP*AP*CP*(ABR)P*AP*GP*AP*AP*G)-3' DNA STYRENE, DNA ADDUCT, SOLUTION STRUCTURE OF DNA

ABS    (S)-(N-PHENYL-2-HYDROXY-ETHYL)-2'-DEOXY-ADENOSINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
1k5f	nuc      NMR    	(S)-(N-PHENYL-2-HYDROXY-ETHYL)-2'-DEOXY-ADENOSINE-5'- MONOPHOSPHATE C18 H22 N5 O7 P	SOLUTION STRUCTURE OF THE S-STYRENE ADDUCT IN THE RAS61 SEQUENCE 5'-D(*CP*GP*GP*AP*CP*(ABS)P*AP*GP*AP*AP*G)-3', 5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP*G)-3' DNA STYRENE, DNA ADDUCT, SOLUTION STRUCTURE OF DNA

ACA    6-AMINOHEXANOIC ACID

Code	Class Resolution	Description
4erj	nuc      3.00	6-AMINOHEXANOIC ACID C6 H13 N O2	CRYSTAL STRUCTURE OF THE LYSINE RIBOSWITCH BOUND TO A 6-AMIN ACID LYSINE RIBOSWITCH RNA: LYSINE RIBOSWITCH APTAMER DOMAIN TRANSCRIPTION RIBOSWITCH APTAMER DOMAIN, REGULATORY MRNA, TRANSLATION, TRANSCRIPTION

ACT    ACETATE ION

Code	Class Resolution	Description
258d	nuc      1.58	ACETATE ION 2(C2 H3 O2 1-)	FACTORS AFFECTING SEQUENCE SELECTIVITY ON NOGALAMYCIN INTERCALATION: THE CRYSTAL STRUCTURE OF D(TGTACA)- NOGALAMYCIN DNA (5'-D(*TP*GP*TP*AP*CP*A)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
2b57	nuc      2.15	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH C74U MUTANT BOUND TO 2,6-DIAMINOPURINE 65-MER: G-BOX RNA RNA RNA-LIGAND COMPLEX, DOUBLE HELIX, BASE TRIPLES, BASE QUADRUPLES, MRNA, PURINE
2ees	nuc      1.75	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH A21U, U75A MUTANT BOUND TO HYPOXANTHINE GUANINE RIBOSWITCH RNA MRNA, RIBOSWITCH, GUANINE, HYPOXANTHINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION
2eet	nuc      1.95	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH A21G, U75C MUTANT BOUND TO HYPOXANTHINE GUANINE RIBOSWITCH RNA MRNA, RIBOSWITCH, HYPOXANTHINE, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION, BASE TRIPLE
2eeu	nuc      1.95	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH U22A, A52U MUTANT BOUND TO HYPOXANTHINE GUANINE RIBOSWITCH RNA MRNA, RIBOSWITCH, GUANINE, HYPOXANTHINE, RNA-LIGAND COMPLEX, THREE-WAY JUNCTION, DOUBLE HELIX
2eev	nuc      1.95	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH U22C, A52G MUTANT BOUND TO HYPOXANTHINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, HYPOXANTHINE, GUANINE, THREE-WAY JUNCTION, RNA-LIGAND COMPLEX, DOUBLE HELIX, BASE TRIPLE
2eew	nuc      2.25	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH U47C MUTANT BOUND TO HYPOXANTHINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, RNA-LIGAND COMPLEX, THREE-WAY JUNCTION, HYPOXANTHINE, GUANINE, BASE TRIPLE
2g9c	nuc      1.70	ACETATE ION C2 H3 O2 1-	MODIFIED PYRIMIDINES SPECIFICALLY BIND THE PURINE RIBOSWITCH GUANINE RIBOSWITCH RNA MRNA, RIBOSWITCH, TRIAMINOPYRIMIDINE, RNA-LIGAND COMPLEX
2xnw	nuc      1.50	ACETATE ION C2 H3 O2 1-	XPT-PBUX C74U RIBOSWITCH FROM B. SUBTILIS BOUND TO A TRIAZOLO-TRIAZOLE-DIAMINE LIGAND IDENTIFIED BY VIRTUAL SCRE GUANINE RIBOSWITCH: APTAMER DOMAIN, RESIDUES 15-81 RNA RNA
2xnz	nuc      1.59	ACETATE ION C2 H3 O2 1-	XPT-PBUX C74U RIBOSWITCH FROM B. SUBTILIS BOUND TO ACETOGUAN IDENTIFIED BY VIRTUAL SCREENING GUANINE RIBOSWITCH: APTAMER DOMAIN, RESIDUES 15-81 RNA RNA, APTAMER, RNA-LIGAND COMPLEX, MRNA
2xo0	nuc      1.70	ACETATE ION 2(C2 H3 O2 1-)	XPT-PBUX C74U RIBOSWITCH FROM B. SUBTILIS BOUND TO 24-DIAMINO-1,3,5-TRIAZINE IDENTIFIED BY VIRTUAL SCREENING GUANINE RIBOSWITCH: APTAMER DOMAIN, RESIDUES 15-81 RNA RNA
2xo1	nuc      1.60	ACETATE ION C2 H3 O2 1-	XPT-PBUX C74U RIBOSWITCH FROM B. SUBTILIS BOUND TO N6-METHYL GUANINE RIBOSWITCH: APTAMER DOMAIN, RESIDUES 15-81 RNA RNA
3ds7	nuc      1.85	ACETATE ION 2(C2 H3 O2 1-)	STRUCTURE OF AN RNA-2'-DEOXYGUANOSINE COMPLEX 67-MER RNA RNA, RNA-LIGAND COMPLEX, RIBOSWITCH
3fo4	nuc      1.90	ACETATE ION C2 H3 O2 1-	CRYSTAL STRUCTURE OF GUANINE RIBOSWITCH C74U MUTANT BOUND TO 6-CHLOROGUANINE GUANINE RIBOSWITCH C74U MUTANT RNA MRNA, RIBOSWITCH, 6-CHLOROGUANINE, ADENINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION
3fo6	nuc      1.90	ACETATE ION C2 H3 O2 1-	CRYSTAL STRUCTURE OF GUANINE RIBOSWITCH BOUND TO 6-O- METHYLGUANINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, 6-O-METHYLGUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION
3g4m	nuc      2.40	ACETATE ION C2 H3 O2 1-	CRYSTAL STRUCTURE OF GUANINE RIBOSWITCH BOUND TO 2- AMINOPURINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, 2-AMINOPURINE, GUANINE, THREE-WAY JUNCTION, RNA-LIGAND COMPLEX, DOUBLE HELIX, BASE-TRIPLE.
3gao	nuc      1.90	ACETATE ION C2 H3 O2 1-	CRYSTAL STRUCTURE OF THE GUANINE RIBOSWITCH BOUND TO XANTHINE. GUANINE RIBOSWITCH RNA RIBOSWITCH, GUANINE, XANTHINE, MRNA, RNA_LIGAND COMPLEX, THREE-WAY JUNCTION
3ger	nuc      1.70	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH BOUND TO 6-CHLOROGUANINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION, BASE TRIPLE
3ges	nuc      2.15	ACETATE ION C2 H3 O2 1-	CRYSTAL STRUCTURE OF THE GUANINE RIBOSWITCH C74U MUTANT BOUND TO 6-O-METHYLGUANINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION, BASE TRIPLE
3gog	nuc      2.10	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH A21G,U75C MUTANT BOUND TO 6-CHLOROGUANINE GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, THREE-WAY JUNCTION, BASE TRIPLE
3got	nuc      1.95	ACETATE ION C2 H3 O2 1-	GUANINE RIBOSWITCH C74U MUTANT BOUND TO 2-FLUOROADENINE. GUANINE RIBOSWITCH RNA RIBOSWITCH, MRNA, GUANINE, RNA-LIGAND COMPLEX, DOUBLE HELIX, BASE TRIPLE, THREE-WAY JUNCTION
3rg5	nuc      2.00	ACETATE ION 2(C2 H3 O2 1-)	CRYSTAL STRUCTURE OF MOUSE TRNA(SEC) TRNA(SEC) RNA METAL BINDING BY RNA, RNA HYDRATION, STRUCTURAL FLEXIBILITY, TRNA FOLD, TRANSLATION, SERRS, SECS, PSTK, RNA
3sj2	nuc      1.36	ACETATE ION 2(C2 H3 O2 1-)	A CRYSTAL STRUCTURE OF A MODEL OF THE REPEATING R(CGG) TRANS FOUND IN FRAGILE X SYNDROME RNA (5'- R(*UP*UP*GP*GP*GP*CP*CP*GP*GP*CP*GP*GP*CP*GP*GP*GP*UP*CP*C) CHAIN: A, RNA (5'- R(P*GP*GP*GP*CP*CP*GP*GP*CP*GP*GP*CP*GP*GP*GP*UP*CP*C)-3') RNA TRINUCLEOTIDE DISORDERS, FRAGILE X-SYNDROME, RNA
4fe5	nuc      1.32	ACETATE ION 2(C2 H3 O2 1-)	CRYSTAL STRUCTURE OF THE XPT-PBUX GUANINE RIBOSWITCH APTAMER COMPLEX WITH HYPOXANTHINE XPT-PBUX GUANINE RIBOSWITCH APTAMER DOMAIN RNA THREE-WAY JUNCTION WITH DISTAL TERTIARY INTERACTION, GENE RE ELEMENT, HYPOXANTHINE, RNA
4fej	nuc      1.50	ACETATE ION 2(C2 H3 O2 1-)	CRYSTAL STRUCTURE OF THE A24U MUTANT XPT-PBUX GUANINE RIBOSW APTAMER DOMAIN IN COMPLEX WITH HYPOXANTHINE A24U MUTANT OF THE B. SUBTILIS XPT-PBUX GUANINE R APTAMER DOMAIN RNA THREE-WAY JUNCTION WITH DISTAL TERTIARY INTERACTION, GENETIC REGULATORY ELEMENT, HYPOXANTHINE, RNA
4fel	nuc      1.60	ACETATE ION C2 H3 O2 1-	CRYSTAL STRUCTURE OF THE U25A/A46G MUTANT OF THE XPT-PBUX GU RIBOSWITCH APTAMER DOMAIN IN COMPLEX WITH HYPOXANTHINE U25A/A46G MUTANT OF THE B. SUBTILIS XPT-PBUX GUAN RIBOSWITCH APTAMER DOMAIN RNA THREE-WAY JUNCTION WITH DISTAL TERTIARY INTERACTION, GENETIC REGULATORY ELEMENT, HYPOXANTHINE, RNA
4fen	nuc      1.35	ACETATE ION C2 H3 O2 1-	CRYSTAL STRUCTURE OF THE A24U/U25A/A46G MUTANT XPT-PBUX GUAN RIBOSWITCH APTAMER DOMAIN IN COMPLEX WITH HYPOXANTHINE A24U/U25A/A46G MUTANT OF THE B. SUBTILIS XPT-PBUX RIBOSWITCH APTAMER DOMAIN RNA THREE-WAY JUNCTION WITH DISTAL TERTIARY INTERACTION, GENETIC REGULATORY ELEMENT, RNA
4phy	nuc      3.10	ACETATE ION 2(C2 H3 O2 1-)	FUNCTIONAL CONSERVATION DESPITE STRUCTURAL DIVERGENCE IN LIG RESPONSIVE RNA SWITCHES RNA (26-MER), RNA (5'- R(*GP*CP*AP*GP*GP*AP*AP*CP*CP*GP*AP*GP*AP*GP*GP*CP*AP*CP*GP CHAIN: B RNA VIRAL GENOME, INTERNAL RIBOSOME ENTRY SITE, TRANSLATION, RNA

ADE    ADENINE

Code	Class Resolution	Description
1y26	nuc      2.10	ADENINE C5 H5 N5	A-RIBOSWITCH-ADENINE COMPLEX VIBRIO VULNIFICUS A-RIBOSWITCH: SEQUENCE DATABASE RESIDUES 202511-202580 RNA A-RIBOSWITCH ADENINE RECOGNITION, RNA
4lw0	nuc      1.89	ADENINE C5 H5 N5	STRUCTURE OF THE THF RIBOSWITCH BOUND TO ADENINE THF RIBOSWITCH RNA APTAMERS, NUCLEOTIDE, BACILLUS SUBTILIS, BACTERIAL PROTEINS, SEQUENCE, BINDING SITES, CALORIMETRY, FOLIC ACID, GENE EXPR REGULATION, BACTERIAL, GUANINE, LEUCOVORIN, LIGANDS, MAGNES MOLECULAR SEQUENCE DATA, NUCLEIC ACID CONFORMATION, POINT M PROTEIN BINDING, PROTEIN STRUCTURE, SECONDARY, RNA, RIBOSWI ADENOSYLMETHIONINE, STREPTOCOCCUS MUTANS, TERMINATOR REGION GENETIC, TETRAHYDROFOLATES, THERMODYNAMICS, TRANSCRIPTION, JUNCTION, PSEUDOKNOT, REGULATION, NCRNA, ADENINE BINDING, M
4tzx	nuc      2.01	ADENINE C5 H5 N5	VIBRIO VULNIFICUS ADENINE RIBOSWITCH VARIANT, GROWN IN MG2+ VIBRIO VULNIFICUS ADENINE RIBOSWITCH RNA RIBOSWITCH, ADENINE, RNA, GENE REGULATION
4tzy	nuc      2.57	ADENINE C5 H5 N5	VIBRIO VULNIFICUS ADENINE RIBOSWITCH VARIANT, GROWN IN BOTH MG2+ VIBRIO VULNIFICUS ADENINE RIBOSWITCH RNA RNA, RIBOSWITCH, GENE REGULATION, ADENINE
4xnr	nuc      2.21	ADENINE C5 H5 N5	VIBRIO VULNIFICUS ADENINE RIBOSWITCH APTAMER DOMAIN, SYNTHES POSITION-SELECTIVE LABELING OF RNA (PLOR), IN COMPLEX WITH VIBRIO VULNIFICUS ADENINE RIBOSWITCH RNA RNA, RIBOSWITCH
5swd	nuc      2.50	ADENINE C5 H5 N5	STRUCTURE OF THE ADENINE RIBOSWITCH APTAMER DOMAIN IN AN INT BOUND STATE VIBRIO VULNIFICUS STRAIN 93U204 CHROMOSOME II, AD RIBOSWITCH APTAMER DOMAIN RNA ADENINE RIBOSWITCH, PURINE RIBOSWITCH, LIGAND MIXING, INTERM STATE, RNA, GENE REGULATION, X-RAY FREE ELECTRON LASER
5swe	nuc      3.00	ADENINE C5 H5 N5	LIGAND-BOUND STRUCTURE OF ADENINE RIBOSWITCH APTAMER DOMAIN IN CRYSTAL FROM ITS LIGAND-FREE STATE USING LIGAND MIXING S FEMTOSECOND CRYSTALLOGRAPHY VIBRIO VULNIFICUS STRAIN 93U204 CHROMOSOME II, AD RIBOSWITCH APTAMER DOMAIN RNA ADENINE RIBOSWITCH, PURINE RIBOSWITCH, LIGAND MIXING, RNA, G REGULATION, X-RAY FREE ELECTRON LASER

ADG    O-3-AMINO-3-DEOXY-ALPHA-D-GLUCOPYRANOSE

Code	Class Resolution	Description
1auf	nuc      model  	O-3-AMINO-3-DEOXY-ALPHA-D-GLUCOPYRANOSE C6 H14 N O5 1+	THEORETICAL MODEL OF THE REV BINDING ELEMENT (RBE, 30 RIBONUCLEOTIDE FRAGMENT) OF HUMAN IMMUNODEFICIENCY VIRUS-1 COMPLEXED WITH TOBRAMYCIN REV BINDING ELEMENT: 30 RIBONUCLEOTIDE FRAGMENT RIBONUCLEIC ACID RNA/AMINOGLYCOSIDE COMPLEX, MRNA TRANSPORT, INHIBITION OF VIRAL REPLICATION, RIBONUCLEIC ACID

ADR    2,6-DIAMINO-2,3,6-TRIDEOXY-ALPHA-D-RIBO-HEXOPYRANOSYL

Code	Class Resolution	Description
1auf	nuc      model  	2,6-DIAMINO-2,3,6-TRIDEOXY-ALPHA-D-RIBO-HEXOPYRANOSYL C6 H14 N2 O2	THEORETICAL MODEL OF THE REV BINDING ELEMENT (RBE, 30 RIBONUCLEOTIDE FRAGMENT) OF HUMAN IMMUNODEFICIENCY VIRUS-1 COMPLEXED WITH TOBRAMYCIN REV BINDING ELEMENT: 30 RIBONUCLEOTIDE FRAGMENT RIBONUCLEIC ACID RNA/AMINOGLYCOSIDE COMPLEX, MRNA TRANSPORT, INHIBITION OF VIRAL REPLICATION, RIBONUCLEIC ACID

ADS    ADENOSINE-5'-(DITHIO)PHOSPHATE

Code	Class Resolution	Description
4rbz	nuc      1.18	ADENOSINE-5'-(DITHIO)PHOSPHATE C10 H14 N5 O5 P S2	X-RAY STRUCTURE OF RNA CONTAINING ADENOSINE PHOSPHORODITHIOA 5'-R(*CP*GP*CP*GP*(A2M)P*(ADS)P*UP*UP*AP*GP*CP*G) CHAIN: A RNA PHOSPHORODITHIOATE RNA, ADENOSINE PHOSPHORODITHIOATE, PHOSPHOROTHIOATE, ADENOSINE ANALOGUE, HYDROPHOBIC, BACKBONE

AF    2-AMINOFLUORENE

Code	Class Resolution	Description
1ax6	nuc      NMR    	2-AMINOFLUORENE C13 H11 N	SOLUTION STRUCTURE OF THE [AF]-C8-DG ADDUCT OPPOSITE A-2 DELETION SITE IN THE NARI HOT SPOT SEQUENCE CONTEXT; NMR, 6 STRUCTURES DNA DUPLEX D(CTCGGC-[AF]G-CCATC)D(GATGGCCGAG), DNA DUPLEX D(CTCGGC-[AF]G-CCATC)D(GATGGCCGAG) DNA DNA DUPLEX, AMINOFLUORENE ADDUCT, CARCINOGEN ADDUCT, HOT SPOT SEQUENCE
1ax7	nuc      NMR    	2-AMINOFLUORENE C13 H11 N	SOLUTION STRUCTURE OF THE [AF]-C8-DG ADDUCT POSITIONED AT A TEMPLATE-PRIMER JUNCTION, NMR, 6 STRUCTURES DNA DUPLEX D(AAC-[AF]G-CTACCATCC)D(GGATGGTAG), DNA DUPLEX D(AAC-[AF]G-CTACCATCC)D(GGATGGTAG) DNA DNA DUPLEX, AMINOFLUORENE ADDUCT, CARCINOGEN ADDUCT, TEMPLATE-PRIMER JUNCTION
1c0y	nuc      NMR    	2-AMINOFLUORENE C13 H11 N	SOLUTION STRUCTURE OF THE [AF]-C8-DG ADDUCT POSITIONED OPPOSITE DA AT A TEMPLATE-PRIMER JUNCTION DNA (5'- D(*AP*AP*CP*GP*CP*TP*AP*CP*CP*AP*TP*CP*C)-3'), DNA (5'-D(*GP*GP*AP*TP*GP*GP*TP*AP*GP*C)-3') DNA DNA DUPLEX, AMINOFLUORENE ADDUCT, CARCINOGEN ADDUCT, TEMPLATE-PRIMER JUNCTION

AF2    2'-DEOXY-2'-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2kwg	nuc      NMR    	2'-DEOXY-2'-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 8(C10 H13 F N5 O6 P)	SOLUTION STRUCTURE OF A FULLY MODIFIED 2'-F/2'-OME SIRNA CON 5'-R(P*(A2M)P*(UFT)P*(OMG)P*(AF2)P*(A2M)P*(GF2)P* P*(AF2)P*(OMU)P*(GF2)P*(OMU)P*(AF2)P*(OMU)P*(UFT)P*(OMU)P*( P*(OMC)P*(CFZ)P*(OMC)P*(UFT)P*(OMU))-3', 5'-R(*(GF2)P*(OMG)P*(GF2)P*(OMU)P*(AF2)P*(A2M)P*( P*(OMU)P*(AF2)P*(OMC)P*(AF2)P*(OMU)P*(UFT)P*(OMC)P*(UFT)P*( P*(CFZ)P*(A2M)P*(UFT)P*(OMU)P*(UFT))-3' RNA SIRNA, 2'-FLUORO, 2'-O-METHYL, RNA
2m84	nuc      NMR    	2'-DEOXY-2'-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 4(C10 H13 F N5 O6 P)	STRUCTURE OF 2'F-RNA/2'F-ANA CHIMERIC DUPLEX 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA 2'F-RNA/2'F-ANA CHIMERIC DUPLEX, A-FORM, 12-MER, DICKERSON D DODECAMER, MODIFIED NUCLEOTIDES, DNA, RNA
2m8a	nuc      NMR    	2'-DEOXY-2'-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 4(C10 H13 F N5 O6 P)	2'F-ANA/2'F-RNA ALTERNATED SEQUENCES 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA A-FORM, 12-MER, DICKERSON DREW DODECAMER, MODIFIED NUCLEOTID RNA
3p4a	nuc      1.20	2'-DEOXY-2'-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 12(C10 H13 F N5 O6 P)	2'FLUORO MODIFIED RNA OCTAMER FA2U2 2'FLUORO MODIFIED RNA 8-MER RNA RNA, 2'-FLUORO-RNA, O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYGUANOSINE, 2'-FLUORO 2'- DEOXYADENOSINE, 2'-FLUORO 2'-DEOXYURIDINE, SIRNA
3p4b	nuc      1.45	2'-DEOXY-2'-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 6(C10 H13 F N5 O6 P)	ALTERNATINGLY MODIFIED 2'FLUORO RNA OCTAMER F/RA2U2-P3 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ)P*G)-3' RNA RNA, 2'-FLUORO-RNA, O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYADENOSINE, 2'-FLUORO 2'- DEOXYURIDINE, SIRNA
3p4c	nuc      1.15	2'-DEOXY-2'-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H13 F N5 O6 P)	ALTERNATINGLY MODIFIED 2'FLUORO RNA OCTAMER F/RA2U2-R32 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ)P*G)-3' RNA RNA, 2'-FLUORO-RNA O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYADENOSINE, 2'-FLUORO 2'- DEOXYURIDINE, SIRNA
5do5	nuc      1.20	2'-DEOXY-2'-FLUOROADENOSINE 5'-(DIHYDROGEN PHOSPHATE) C10 H13 F N5 O6 P	CRYSTAL STRUCTURE OF 2'-FLUORO-RNA BEARING A PHOSPHORODITHIO RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*(AF2)P*(2SG)P* CHAIN: A RNA RNA, 2'-FLUORO-RNA, PHOSPHORODITHIOATE RNA, PS2-RNA

AF4    2,4-BIS{[4-(N-ISOPORPYL)DIAMINOMETHYL]PHENYL}FURAN

Code	Class Resolution	Description
2gxh	nuc      model  	2,4-BIS{[4-(N-ISOPORPYL)DIAMINOMETHYL]PHENYL}FURAN C24 H32 N4 O	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 2,4-BIS{[4-(N-ISOPROPYL)DIAMINOMETHYL]PHENYL}FURAN DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, DNA-DRUG, FURAN DERIVATIVE

AFF    2-ACETYLAMINOFLUORENE-3-YL

Code	Class Resolution	Description
2ge2	nuc      NMR    	2-ACETYLAMINOFLUORENE-3-YL C15 H13 N O	SOLUTION STRUCTURE OF THE DUPLEX DNA CONTAINING THE 3- (DEOXYGUANOSIN-N2-YL)-2-ACETOAMINOFLUORENE 5'-D(*CP*GP*TP*AP*CP*GP*CP*AP*TP*GP*C)-3', 5'-D(*GP*CP*AP*TP*GP*CP*GP*TP*AP*CP*G)-3' DNA DNA, ACETYLAMINOFLUOREN (AAF)

AFN    8,9-DIHYDRO-9-HYDROXY-AFLATOXIN B1

Code	Class Resolution	Description
1n1n	nuc      NMR    	8,9-DIHYDRO-9-HYDROXY-AFLATOXIN B1 C17 H14 O7	STRUCTURE OF MISPAIRING OF THE DEOXYCYTOSINE WITH DEOXYADENOSINE 5' TO THE 8,9-DIHYDRO-8-(N7-GUANYL)-9- HYDROXY-AFLATOXIN B1 ADDUCT 5'-D(*AP*CP*AP*TP*CP*GP*AP*TP*CP*T)-3', 5'-D(*AP*GP*AP*TP*CP*AP*AP*TP*GP*T)-3' DNA AFLATOXIN B1 ADDUCT 5' TO AC MISMATCH, MAJOR CONFORMATION, DNA

AFZ    2,4-BIS(4-AMIDINOPHENYL)FURAN

Code	Class Resolution	Description
2gxd	nuc      model  	2,4-BIS(4-AMIDINOPHENYL)FURAN C18 H16 N4 O	MODEL STRUCTURE OF DNA DODECAMER D(CGCGAATTCGCG)2 BOUND TO 2,4-BIS(4-AMIDINO)FURAN. DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3' MODEL BUILT, MINOR GROOVE BINDING, FURAN DERIVATIVE

AG    SILVER ION

Code	Class Resolution	Description
2ke8	nuc      NMR    	SILVER ION 3(AG 1+)	NMR SOLUTION STRUCTURE OF METAL-MODIFIED DNA DNA (5'-D(*TP*TP*AP*AP*TP*TP*TP*(D33)P*(D33)P*(D3 P*AP*AP*AP*TP*TP*AP*A)-3') DNA DNA, ARTIFICIAL NUCLEOBASE, IMIDAZOLE NUCLEOSIDE, AG+
2m54	nuc      NMR    	SILVER ION 3(AG 1+)	REFINED NMR SOLUTION STRUCTURE OF METAL-MODIFIED DNA DNA (5'-D(*TP*TP*AP*AP*TP*TP*TP*(D33)P*(D33)P*(D3 P*AP*AP*AP*TP*TP*AP*A)-3') DNA DNA, ARTIFICIAL NUCLEOBASE, IMIDAZOLE NUCLEOSIDE
2rvp	nuc      NMR    	SILVER ION AG 1+	SOLUTION STRUCTURE OF DNA CONTAINING METALLO-BASE-PAIR DNA (5'-D(*TP*AP*AP*TP*TP*AP*AP*CP*TP*AP*TP*AP*TP 3'), DNA (5'-D(*TP*AP*AP*TP*AP*TP*AP*CP*TP*TP*AP*AP*TP 3') DNA DNA, METALLO-DNA, METALLO-BASE-PAIR, C-AG(I)-C BASE-PAIR
5ay2	nuc      1.30	SILVER ION 4(AG 1+)	CRYSTAL STRUCTURE OF RNA DUPLEX CONTAINING C-AG(I)-C BASE PA RNA (5'-R(*GP*GP*AP*CP*UP*(CBR)P*GP*AP*CP*UP*CP*C CHAIN: A, B, C, D RNA RNA, METALLO BASE PAIR, AG(I)

AG2    AGMATINE

Code	Class Resolution	Description
5nex	nuc      1.72	AGMATINE C5 H14 N4	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH AGMATINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, RNA,

AGU    AMINOGUANIDINE

Code	Class Resolution	Description
5neq	nuc      1.69	AMINOGUANIDINE C H6 N4	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH AMINOGUANIDINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, AMINOGUANIDINE, RNA

AIK    N-[3-(DIMETHYLAMINO)PROPYL]-2-({[4-({[4-(FORMYLAMINO)- 1-METHYL-1H-PYRROL-2-YL]CARBONYL}AMINO)-1-METHYL-1H- PYRROL-2-YL]CARBONYL}AMINO)-5-ISOPROPYL-1,3-THIAZOLE- 4-CARBOXAMIDE

Code	Class Resolution	Description
1rmx	nuc      NMR    	N-[3-(DIMETHYLAMINO)PROPYL]-2-({[4-({[4-(FORMYLAMINO)- 1-METHYL-1H-PYRROL-2-YL]CARBONYL}AMINO)-1-METHYL-1H- PYRROL-2-YL]CARBONYL}AMINO)-5-ISOPROPYL-1,3-THIAZOLE- 4-CARBOXAMIDE 2(C25 H34 N8 O4 S)	A SHORT LEXITROPSIN THAT RECOGNIZES THE DNA MINOR GROOVE AT 5'-ACTAGT-3': UNDERSTANDING THE ROLE OF ISOPROPYL-THIAZOLE 5'-D(*CP*GP*AP*CP*TP*AP*GP*TP*CP*G)-3' DNA MINOR-GROOVE-DNA COMPLEX, SIDE-BY-SIDE BINDING, DNA RECOGNITION

AKN    (2S)-N-[(1R,2S,3S,4R,5S)-4-[(2R,3R,4S,5S,6R)-6- (AMINOMETHYL)-3,4,5-TRIS(OXIDANYL)OXAN-2-YL]OXY-5- AZANYL-2-[(2S,3R,4S,5S,6R)-4-AZANYL-6-(HYDROXYMETHYL)- 3,5-BIS(OXIDANYL)OXAN-2-YL]OXY-3-OXIDANYL-CYCLOHEXYL]- 4-AZANYL-2-OXIDANYL-BUTANAMIDE

Code	Class Resolution	Description
4p20	nuc      2.70	(2S)-N-[(1R,2S,3S,4R,5S)-4-[(2R,3R,4S,5S,6R)-6- (AMINOMETHYL)-3,4,5-TRIS(OXIDANYL)OXAN-2-YL]OXY-5- AZANYL-2-[(2S,3R,4S,5S,6R)-4-AZANYL-6-(HYDROXYMETHYL)- 3,5-BIS(OXIDANYL)OXAN-2-YL]OXY-3-OXIDANYL-CYCLOHEXYL]- 4-AZANYL-2-OXIDANYL-BUTANAMIDE 2(C22 H43 N5 O13)	CRYSTAL STRUCTURES OF THE BACTERIAL RIBOSOMAL DECODING SITE WITH AMIKACIN 5'-R(*UP*UP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*U *GP*UP*CP*GP*C)-3' RNA/ANTIBIOTIC AMINOGLYCOSIDE, HABA GROUP, RIBOSOMAL DECODING SITE, X-RAY A RNA, AMIKACIN

AM2    APRAMYCIN

Code	Class Resolution	Description
1yrj	nuc      2.70	APRAMYCIN 2(C21 H41 N5 O11)	CRYSTAL STRUCTURE OF APRAMYCIN BOUND TO A RIBOSOMAL RNA A SI OLIGONUCLEOTIDE BACTERIAL 16 S RIBOSOMAL RNA A SITE OLIGONUCLEOTI CHAIN: A, B RNA RNA COMPLEX, APRAMYCIN-RNA COMPLEX, MOLECULAR RECOGNITION, R
2g5k	nuc      2.80	APRAMYCIN 2(C21 H41 N5 O11)	CRYSTAL STRUCTURE OF THE HOMO SAPIENS CYTOPLASMIC RIBOSOMAL DECODING SITE COMPLEXED WITH APRAMYCIN 5'- R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*CP*GP*GP*AP*AP*AP*AP*GP *UP*CP*GP*C)-3' RNA AMINOGLYCOSIDE, ANTIBIOTICS, APRAMYCIN, RIBOSOME, DECODING SITE, HOMO SAPIENS, CYTOPLASM, RNA
2m4q	nuc      NMR    	APRAMYCIN C21 H41 N5 O11	NMR STRUCTURE OF E. COLI RIBOSOMELA DECODING SITE WITH APRAM RNA (27-MER) RNA/ANTIBIOTIC RNA, ANTIBIOTIC, DECODING SITE, AMINOGLYCOSIDE, APRAMYCIN, R ANTIBIOTIC COMPLEX
2oe5	nuc      1.51	APRAMYCIN C21 H41 N5 O11	1.5 A X-RAY CRYSTAL STRUCTURE OF APRAMYCIN COMPLEX WITH RNA GGCGUCGCUAGUACCG/GGUACUAAAAGUCGCCC CONTAINING THE HUMAN RIB DECODING A SITE: RNA CONSTRUCT WITH 3'-OVERHANG RNA (5'-R(*GP*GP*CP*GP*UP*CP*GP*CP*UP*AP*GP*UP*AP 3'), RNA (5'- R(*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP*GP*UP*CP*GP*CP*CP*C)-3') RNA AMINOGLYCOSIDE ANTIBIOTICS, APRAMYCIN, RIBOSOMAL DECODING SI SITE, HOMO SAPIENS, RNA DUPLEX, RNA
2oe8	nuc      1.80	APRAMYCIN C21 H41 N5 O11	1.8 A X-RAY CRYSTAL STRUCTURE OF APRAMYCIN COMPLEX WITH RNA GGGCGUCGCUAGUACC/CGGUACUAAAAGUCGCC CONTAINING THE HUMAN RIB DECODING A SITE: RNA CONSTRUCT WITH 5'-OVERHANG RNA (5'- R(*CP*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP*GP*UP*CP*GP*CP*C)-3'), RNA (5'-R(*GP*GP*GP*CP*GP*UP*CP*GP*CP*UP*AP*GP*UP 3') RNA AMINOGLYCOSIDE ANTIBIOTICS, APRAMYCIN, RIBOSOMAL DECODING SI SITE, HOMO SAPIENS, RNA DUPLEX, RNA
4k31	nuc      1.42	APRAMYCIN 4(C21 H41 N5 O11)	CRYSTAL STRUCTURE OF APRAMYCIN BOUND TO THE LEISHMANIAL RRNA RNA (5'- R(*UP*UP*GP*CP*GP*UP*CP*GP*UP*UP*CP*CP*GP*GP*AP*AP*AP*AP*GP C)-3') RNA/ANTIBIOTIC RRNA DUPLEX, RIBOSOMAL A-SITE, AMINOGLYCOSIDE, RIBOSOME, RNA ANTIBIOTIC COMPLEX

AMP    ADENOSINE MONOPHOSPHATE

Code	Class Resolution	Description
1am0	nuc      NMR    	ADENOSINE MONOPHOSPHATE C10 H14 N5 O7 P	AMP RNA APTAMER COMPLEX, NMR, 8 STRUCTURES RNA APTAMER RNA COMPLEX (RIBONUCLEIC ACID/AMP), RNA APTAMER, GNRA MOTIF, G(DOT)G MISMATCH, G(DOT)A MISMATCH, RIBONUCLEIC ACID
1aw4	nuc      NMR    	ADENOSINE MONOPHOSPHATE 2(C10 H14 N5 O7 P)	STRUCTURAL BASIS OF DNA FOLDING AND RECOGNITION IN AMP-DNA APTAMER COMPLEX, NMR, 7 STRUCTURES ATP-BINDING DNA APTAMER DNA ADAPTIVE BINDING, AMP BINDING, DNA APTAMER, DNA BINDING, DNA RECOGNITION, AMP-DNA APTAMER COMPLEX
1raw	nuc      NMR    	ADENOSINE MONOPHOSPHATE C10 H14 N5 O7 P	ATP BINDING RNA APTAMER IN COMPLEX WITH AMP, NMR, 10 STRUCTURES RNA APTAMER: ATP-BINDING, RESIDUES 1 - 36 RNA RIBONUCLEIC ACID, UUCG TETRALOOP, RNA

AMZ    AMINOIMIDAZOLE 4-CARBOXAMIDE RIBONUCLEOTIDE

Code	Class Resolution	Description
4xw7	nuc      2.50	AMINOIMIDAZOLE 4-CARBOXAMIDE RIBONUCLEOTIDE C9 H15 N4 O8 P	CRYSTAL STRUCTURE OF THE ZMP RIBOSWITCH AT 2.50 ANGSTROM PFL RNA RNA RNA, RIBOSWITCH, ZMP, AICAR
4xwf	nuc      1.80	AMINOIMIDAZOLE 4-CARBOXAMIDE RIBONUCLEOTIDE C9 H15 N4 O8 P	CRYSTAL STRUCTURE OF THE ZMP RIBOSWITCH AT 1.80 ANGSTROM PFL RNA RNA RNA, RIBOSWITCH, ZMP, AICAR
4znp	nuc      2.94	AMINOIMIDAZOLE 4-CARBOXAMIDE RIBONUCLEOTIDE 2(C9 H15 N4 O8 P)	THE STRUCTURE OF A PFI RIBOSWITCH BOUND TO ZMP PFI RIBOSWITCH RNA ZMP, RIBOSWITCH, RNA, ONE CARBON MECHANISM, AICAR, ZTP, COMP
5btp	nuc      2.82	AMINOIMIDAZOLE 4-CARBOXAMIDE RIBONUCLEOTIDE 2(C9 H15 N4 O8 P)	FUSOBACTERIUM ULCERANS ZTP RIBOSWITCH BOUND TO ZMP RNA (62-MER) RNA RNA

AN9    1,5-BIS[3-(DIETHYLAMINO)PROPIONAMIDO]ANTHRACENE-9,10- DIONE

Code	Class Resolution	Description
1xcu	nuc      2.00	1,5-BIS[3-(DIETHYLAMINO)PROPIONAMIDO]ANTHRACENE-9,10- DIONE 2(C28 H36 N4 O4)	OLIGONUCLEOTID/DRUG COMPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, ANTHRAQUINONE, CO2+

ANT    ANTHRAMYCIN

Code	Class Resolution	Description
274d	nuc      2.30	ANTHRAMYCIN C16 H17 N3 O4	CRYSTAL STRUCTURE OF A COVALENT DNA-DRUG ADDUCT: ANTHRAMYCIN BOUND TO C-C-A-A-C-G-T-T-G-G, AND A MOLECULAR EXPLANATION OF SPECIFICITY DNA (5'-D(*CP*CP*AP*AP*CP*GP*TP*TP*(DRUG)GP*G)- 3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED

AP    N-1-AMINOPYRENE

Code	Class Resolution	Description
1axu	nuc      NMR    	N-1-AMINOPYRENE C16 H11 N	SOLUTION NMR STRUCTURE OF THE [AP]DG ADDUCT OPPOSITE DA IN A DNA DUPLEX, NMR, 9 STRUCTURES DNA DUPLEX D(CCATC-[AP]G-CTACC)D(GGTAGAGATGG), DNA DUPLEX D(CCATC-[AP]G-CTACC)D(GGTAGAGATGG) DNA DNA DUPLEX, AMINOPYRENE ADDUCT, CARCINOGEN ADDUCT

AP7    N1-PROTONATED ADENOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2rrc	nuc      NMR    	N1-PROTONATED ADENOSINE-5'-MONOPHOSPHATE C10 H15 N5 O7 P 1+	SOLUTION STRUCTURE OF RNA APTAMER AGAINST AML1 RUNT DOMAIN 5'-R(P*GP*GP*AP*CP*CP*CP*(AP7) P*CP*CP*AP*CP*GP*GP*CP*GP*AP*GP*GP*UP*CP*CP*A)-3' RNA RNA APTAMER, AML1/RUNX1, MOLECULAR MIMICRY, RNA
5lwj	nuc      NMR    	N1-PROTONATED ADENOSINE-5'-MONOPHOSPHATE C10 H15 N5 O7 P 1+	SOLUTION NMR STRUCTURE OF THE GTP BINDING CLASS II RNA APTAM COMPLEX CONTAINING A PROTONATED ADENINE NUCLEOTIDE WITH A H SHIFTED PKA. GTP CLASS II RNA (34-MER) RNA RNA STRUCTURE, APTAMER, PROTONATED ADENINE, GTP, RNA

APN    2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-ADENINE

Code	Class Resolution	Description
176d	nuc      NMR    	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-ADENINE 2(C11 H16 N7 O3 1+)	NMR SOLUTION STRUCTURE OF A PEPTIDE NUCLEIC ACID COMPLEXED W DNA (5'-D(*GPN*APN*APN*CPN*TPN*CPN)-3'), RNA (5'-R(P*GP*AP*GP*UP*UP*C)-3') PEPTIDE NUCLEIC ACID/RNA RNA, PNA, DOUBLE HELIX, PEPTIDE NUCLEIC ACID-RNA COMPLEX
1nr8	nuc      1.66	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-ADENINE 2(C11 H16 N7 O3 1+)	THE CRYSTAL STRUCTURE OF A D-LYSINE-BASED CHIRAL PNA-DNA DUP 5'-D(P*AP*GP*TP*GP*AP*TP*CP*TP*AP*C)-3', H-((GPN)*(TPN)*(APN)*(GPN)*(A66)*(T66)*(C66)*(APN *(TPN))-NH2 DNA/PEPTIDE NUCLEIC ACID CHIRAL PEPTIDE NUCLEIC ACID, DOUBLE STRANDED HELIX, P-FORM, PEPTIDE NUCLEIC ACID COMPLEX
1pdt	nuc      NMR    	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-ADENINE C11 H16 N7 O3 1+	PD235, PNA-DNA DUPLEX, NMR, 8 STRUCTURES DNA (5'-D(*GP*AP*CP*AP*TP*AP*GP*C)-3', PEPTIDE NUCLEIC ACID (COOH-P(*G*C*T*A*T*G*T*C)-NH CHAIN: B PEPTIDE NUCLEIC ACID/DNA COMPLEX (PEPTIDE NUCLEIC ACID-DNA), NUCLEIC ACID COMPLEX, DU HYBRID, PEPTIDE NUCLEIC ACID-DNA COMPLEX
5emf	nuc      1.14	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-ADENINE 2(C11 H16 N7 O3 1+)	CRYSTAL STRUCTURE OF RNA R(GCUGCUGC) WITH ANTISENSE PNA P(GC RNA (5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'), ANTISENSE PNA P(GCAGCAGC) RNA CUG REPEATS, RNA/PNA DUPLEX, ANTISENSE PNA, MYOTONIC DYSTROP 1, RNA

AQC    9,10-DIOXO-9,10-DIHYDROANTHRACENE-2-CARBOXAMIDE

Code	Class Resolution	Description
2kk5	nuc      NMR    	9,10-DIOXO-9,10-DIHYDROANTHRACENE-2-CARBOXAMIDE 2(C15 H9 N O3)	HIGH FIDELITY BASE PAIRING AT THE 3'-TERMINUS 5'-D(*AP*CP*GP*CP*GP*(2AU))-3' DNA ANTHRAQUINONE-LINKED DNA

AQS    N,N-BIS(3-AMINOPROPYL)-2-ANTHRAQUINONESULFONAMIDE

Code	Class Resolution	Description
386d	nuc      1.80	N,N-BIS(3-AMINOPROPYL)-2-ANTHRAQUINONESULFONAMIDE C20 H25 N3 O4 S 2+	THREE-DIMENSIONAL STRUCTURE AND REACTIVITY OF A PHOTOCHEMICAL CLEAVAGE AGENT BOUND TO DNA DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

AR1    (2-{[4-({4-[(4-FORMYLAMINO-1-METHYL-1H-IMIDAZOLE-2- CARBONYL)-AMINO]-1-METHYL-1H-IMIDAZOLE-2-CARBONYL}- AMINO)-1-METHYL-1H-IMIDAZOLE-2-CARBONYL]-AMINO}- ETHYL)-DIMETHYL-AMMONIUM

Code	Class Resolution	Description
1b0s	nuc      NMR    	(2-{[4-({4-[(4-FORMYLAMINO-1-METHYL-1H-IMIDAZOLE-2- CARBONYL)-AMINO]-1-METHYL-1H-IMIDAZOLE-2-CARBONYL}- AMINO)-1-METHYL-1H-IMIDAZOLE-2-CARBONYL]-AMINO}- ETHYL)-DIMETHYL-AMMONIUM 2(C20 H28 N11 O4 1+)	BINDING OF AR-1-144, A TRI-IMIDAZOLE DNA MINOR GROOVE BINDER, TO CCGG SEQUENCE ANALYZED BY NMR SPECTROSCOPY DNA (5'-D(*GP*AP*AP*CP*CP*GP*GP*TP*TP*C)-3') DNA ANTICANCER DRUG, DRUG DESIGN, DNA STRUCTURE, SEQUENCE SPECIFIC RECOGNITION
1cyz	nuc      NMR    	(2-{[4-({4-[(4-FORMYLAMINO-1-METHYL-1H-IMIDAZOLE-2- CARBONYL)-AMINO]-1-METHYL-1H-IMIDAZOLE-2-CARBONYL}- AMINO)-1-METHYL-1H-IMIDAZOLE-2-CARBONYL]-AMINO}- ETHYL)-DIMETHYL-AMMONIUM 2(C20 H28 N11 O4 1+)	NMR STRUCTURE OF THE GAACTGGTTC/TRI-IMIDAZOLE POLYAMIDE COMPLEX 5'-D(*GP*AP*AP*CP*TP*GP*GP*TP*TP*C)-3' DNA T:G RECOGNIZED BY IM/IM PAIR IN THE DNA MINOR GROOVE

ARF    FORMAMIDE

Code	Class Resolution	Description
4nfp	nuc      1.85	FORMAMIDE 3(C H3 N O)	CRYSTAL STRUCTURE ANALYSIS OF THE 16MER GCAGNCUUAAGUCUGC CON AZA-7-DEAZA-7-ETHYNYL ADENOSINE GCAG(A7E)CUUAAGUCUGC RNA RNA 16MER OLIGO, 8-AZA-7-DEAZA-7-ETHYNYLADENOSINE, POSITION

ARG    ARGININE

Code	Class Resolution	Description
1aju	nuc      NMR    	ARGININE C6 H15 N4 O2 1+	HIV-2 TAR-ARGININAMIDE COMPLEX, NMR, 20 STRUCTURES TAR RNA RNA COMPLEX (RIBONUCLEIC ACID/LIGAND), NMR, TRANSCRIPTIONAL ACTIVATION, PROTEIN-RNA INTERACTIONS
1akx	nuc      NMR    	ARGININE C6 H15 N4 O2 1+	HIV-2 TRANS ACTIVATING REGION RNA COMPLEX WITH ARGININAMIDE, NMR, MINIMIZED AVERAGE STRUCTURE TAR RNA RNA TRANSCRIPTIONAL ACTIVATION, NMR, COMPLEX (RNA/LIGAND), PROTEIN-RNA INTERACTIONS
1arj	nuc      NMR    	ARGININE C6 H15 N4 O2 1+	ARG-BOUND TAR RNA, NMR TAR RNA RNA NMR PEPTIDE-BOUND STRUCTURE, NUCLEIC ACIDS, COMPLEX (RNA/PEPTIDE)
1koc	nuc      NMR    	ARGININE C6 H15 N4 O2 1+	RNA APTAMER COMPLEXED WITH ARGININE, NMR RNA (5'-R(P*AP*GP*AP*AP*GP*GP*AP*GP*CP*GP*U)-3'), RNA (5'- R(P*AP*CP*AP*GP*GP*UP*AP*GP*GP*UP*CP*GP*CP*U)-3') RNA COMPLEX (RNA APTAMER/PEPTIDE), IN VITRO SELECTED RNA, RNA APTAMER
2kx8	nuc      NMR    	ARGININE C6 H15 N4 O2 1+	NMR STRUCTURE OF STEM-LOOP 4 FROM THE HUMAN 7SK SNRNA IN COM ARGININE 7SK RNA SNRNA, RNA
2l8h	nuc      NMR    	ARGININE C6 H15 N4 O2 1+	CHEMICAL PROBE BOUND TO HIV TAR RNA HIV TAR RNA RNA RNA
5kvj	nuc      2.26	ARGININE C6 H15 N4 O2 1+	CRYSTAL STRUCTURE OF THE 16-MER DOUBLESTRANDED RNA. NORTHEAS STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET RNA1 RNA (5'- R(P*CP*GP*CP*CP*UP*GP*UP*AP*GP*AP*GP*GP*AP*UP*GP*G)-3'), RNA (5'- R(P*CP*CP*AP*UP*CP*CP*UP*CP*UP*AP*CP*AP*GP*GP*CP*G)-3') RNA DOUBLE STRANDED RNA, DSRNA, NORTHEAST STRUCTURAL GENOMICS CO NESG, PSI-BIOLOGY, RNA

ARI    [O4]-ACETOXY-2,3-DIDEOXYFUCOSE

Code	Class Resolution	Description
1d83	nuc      NMR    	[O4]-ACETOXY-2,3-DIDEOXYFUCOSE 2(C8 H14 O4)	STRUCTURE REFINEMENT OF THE CHROMOMYCIN DIMER/DNA OLIGOMER COMPLEX IN SOLUTION DNA (5'-D(*AP*AP*GP*GP*CP*CP*TP*T)-3') DNA DNA, NMR, DOUBLE HELIX, CHROMOMYCIN
1vaq	nuc      2.00	[O4]-ACETOXY-2,3-DIDEOXYFUCOSE 4(C8 H14 O4)	CRYSTAL STRUCTURE OF THE MG2+-(CHROMOMYCIN A3)2-D(TTGGCCAA) 2 COMPLEX REVEALS GGCC BINDING SPECIFICITY OF THE DRUG DIMER CHELATED BY METAL ION 5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3' DNA CHROMOMYCIN A3, X-RAY DIFFRACTION, MAD, DNA DUPLEX, GGCC SITE, DNA KINK, CD SPECTRA
5erz	nuc      1.75	[O4]-ACETOXY-2,3-DIDEOXYFUCOSE 2(C8 H14 O4)	CRYSTAL STRUCTURE OF THE [NI2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX
5es0	nuc      2.10	[O4]-ACETOXY-2,3-DIDEOXYFUCOSE 2(C8 H14 O4)	CRYSTAL STRUCTURE OF THE [CO2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX

ARM    DEOXY-METHYL-ARGININE

Code	Class Resolution	Description
1old	nuc      NMR    	DEOXY-METHYL-ARGININE C7 H16 N4 O	NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES DNA (GATCGAAACGTAGCGCCTTCGATC) DNA DEOXYRIBONUCLEIC ACID, DNA
2arg	nuc      NMR    	DEOXY-METHYL-ARGININE C7 H16 N4 O	FORMATION OF AN AMINO ACID BINDING POCKET THROUGH ADAPTIVE ZIPPERING-UP OF A LARGE DNA HAIRPIN LOOP, NMR, 9 STRUCTURES DNA APTAMER [5'-D (*TP*GP*AP*CP*CP*AP*GP*GP*GP*CP*AP*AP*AP*CP*GP*GP*TP*AP* GP*GP*TP*GP*AP*GP*TP*GP*GP*TP*CP*A)-3'] DNA ADAPTIVE DNA STRUCTURAL TRANSITIONS, L-ARGININAMIDE BINDING POCKET, MOLECULAR RECOGNITION OF AN AMINO ACID, MINOR GROOVE RECOGNITION, BASE ENCAPSULATION WITHIN MINOR GROOVE, DNA APTAMER, DEOXYRIBONUCLEIC ACID

AS    2-DEOXY-ADENOSINE -5'-THIO-MONOPHOSPHATE

Code	Class Resolution	Description
1d14	nuc      1.50	2-DEOXY-ADENOSINE -5'-THIO-MONOPHOSPHATE C10 H14 N5 O5 P S	STRUCTURE OF 11-DEOXYDAUNOMYCIN BOUND TO DNA CONTAINING A PHOSPHOROTHIOATE DNA (5'-D(*CP*GP*TP*(AS)P*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
1d21	nuc      1.70	2-DEOXY-ADENOSINE -5'-THIO-MONOPHOSPHATE 2(C10 H14 N5 O5 P S)	BINDING OF THE ANTITUMOR DRUG NOGALAMYCIN AND ITS DERIVATIVE STRUCTURAL COMPARISON DNA (5'-D(*(5CM)P*GP*TP*(AS)P*(5CM)P*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIE
1d22	nuc      1.80	2-DEOXY-ADENOSINE -5'-THIO-MONOPHOSPHATE 2(C10 H14 N5 O5 P S)	BINDING OF THE ANTITUMOR DRUG NOGALAMYCIN AND ITS DERIVATIVES TO DNA: STRUCTURAL COMPARISON DNA (5'-D(*(5CM)P*GP*TP*(AS)P*(5CM)P*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
8psh	nuc      NMR    	2-DEOXY-ADENOSINE -5'-THIO-MONOPHOSPHATE C10 H14 N5 O5 P S	HIGH RESOLUTION NMR STRUCTURE OF THE STEREOREGULAR (ALL-RP)- PHOSPHOROTHIOATE-DNA/RNA HYBRID D (G*PS*C*PS*G*PS*T*PS*C*PS*A*PS*G*PS*G)R(CCUGACGC), MINIMIZED AVERAGE STRUCTURE RNA (5'-R(*CP*CP*UP*GP*AP*CP*GP*C)-3'), DNA (5'-D(*DGP*(SC)P*(GS)P*(PST)P*(SC)P*(AS) P*(GS)P*(GS))-3') DNA-RNA HYBRID OLIGONUCLEOTIDE, DNA-RNA HYBRID, PHOSPHOROTHIOATE, THIONUCLEOTIDE, ANTISENSE

AT7    2'-DEOXY-2'-TRIAZA-1,2-DIEN-2-IUM-1-YL-ADENINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
3s8u	nuc      1.20	2'-DEOXY-2'-TRIAZA-1,2-DIEN-2-IUM-1-YL-ADENINE-5'- MONOPHOSPHATE C10 H14 N8 O6 P 1+	CRYSTAL STRUCTURE OF A 2-AZIDO-ADENINE-MODIFIED RNA ECOLI 23 S RRNA SARCIN RICIN LOOP RNA HAIRPIN RNA, RNA LABELLING,2'-AZIDO-ADENINE, RNA

ATD    THYMIDINE-3'-PHOSPHATE

Code	Class Resolution	Description
1bx5	nuc      NMR    	THYMIDINE-3'-PHOSPHATE 2(C10 H15 N2 O8 P)	NMR SOLUTION STRUCTURE OF [D(GCGAAT-3'-3'-ALPHAT-5'-5'-CGC) 2] DNA (5'-D(*GP*CP*GP*AP*AP*TP*(ATD)P*CP*GP*C)-3') DNA ALPHA ANOMERIC, POLARITY REVERSALS, DNA

ATL    [(1S,3R,4S,7R)-7-HYDROXY-3-(THYMIN-1-YL)-2,5- DIOXABICYCLO[2.2.1]HEPT-1-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
1gv6	nuc      NMR    	[(1S,3R,4S,7R)-7-HYDROXY-3-(THYMIN-1-YL)-2,5- DIOXABICYCLO[2.2.1]HEPT-1-YL]METHYL DIHYDROGEN PHOSPHATE 4(C11 H15 N2 O9 P)	SOLUTION STRUCTURE OF ALFA-L-LNA:DNA DUPLEX 5- D(*CP*(ATL)P*GP*CP*(ATL)P*(ATL)P*CP*(ATL)P* GP*C) -3, 5- D(*GP*CP*AP*GP*AP*AP*GP*CP*AP*G) -3 LOCKED NUCLEIC ACID LOCKED NUCLEIC ACID, LNA, DNA, NMR
1okf	nuc      NMR    	[(1S,3R,4S,7R)-7-HYDROXY-3-(THYMIN-1-YL)-2,5- DIOXABICYCLO[2.2.1]HEPT-1-YL]METHYL DIHYDROGEN PHOSPHATE 3(C11 H15 N2 O9 P)	NMR STRUCTURE OF AN ALPHA-L-LNA:RNA HYBRID 5'-R(*GP*CP*AP*UP*AP*UP*CP*AP*GP)-3', 5'-D(*CP*ATLP*GP*AP*ATLP*AP*ATLP*GP*CP)-3' DNA-RNA HYBRID DNA-RNA HYBRID, DNA/RNA HYBRID, ALPHA-L-LNA, LNA, RNA, NMR, RNASE H, LOCKED NUCLEIC ACID

ATP    ADENOSINE-5'-TRIPHOSPHATE

Code	Class Resolution	Description
5ktj	nuc      2.97	ADENOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O13 P3)	CRYSTAL STRUCTURE OF PISTOL, A CLASS OF SELF-CLEAVING RIBOZY RNA (5'-R(*UP*CP*UP*GP*CP*UP*CP*UP*CP*GP*UP*CP*CP 3'), PISTOL (50-MER) RNA RIBOZYME, SELF-CLEAVAGE, INTERNAL TRANSESTERIFICATION, RNA

AU    GOLD ION

Code	Class Resolution	Description
5lys	nuc      2.32	GOLD ION 2(AU 1+)	THE CRYSTAL STRUCTURE OF 7SK 5'-HAIRPIN - GOLD DERIVATIVE RNA (57-MER) RNA NON-CODING RNA MAJOR GROOVE BASE TRIPLE TRANSCRIPTION, RNA

AU3    GOLD 3+ ION

Code	Class Resolution	Description
2oij	nuc      2.31	GOLD 3+ ION 2(AU 3+)	HIV-1 SUBTYPE B DIS RNA EXTENDED DUPLEX AUCL3 SOAKED 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*GP*CP*GP*C *GP*CP*AP*AP*G)-3' RNA HIV-1, METAL IONS, RNA, BULGES

AUZ    BIS(M2-OXO)-BIS(2-METHYL-2,2'-BIPYRIDINE)-DI-GOLD(III)

Code	Class Resolution	Description
5mvb	nuc      NMR    	BIS(M2-OXO)-BIS(2-METHYL-2,2'-BIPYRIDINE)-DI-GOLD(III) C24 H24 AU2 N4 O2 4+	SOLUTION STRUCTURE OF A HUMAN G-QUADRUPLEX HYBRID-2 FORM IN WITH A GOLD-LIGAND DNA (26-MER) DNA G-QUADRUPLEX HYBRID, 2 AUOXO6, DNA

AVC    ADENOSINE-5'-MONOPHOSPHATE-2',3'-VANADATE

Code	Class Resolution	Description
2p7e	nuc      2.05	ADENOSINE-5'-MONOPHOSPHATE-2',3'-VANADATE C10 H13 N5 O9 P V	VANADATE AT THE ACTIVE SITE OF A SMALL RIBOZYME SUGGESTS A ROLE FOR WATER IN TRANSITION-STATE STABILIZATION 3' SUBSTRATE STRAND, OCTAMERIC FRAGMENT, RIBOZYME STRAND I, RIBOZYME STRAND II, 5' SUBSTRATE STRAND, PENTAMERIC FRAGMENT, RIBOZYME STRAND III RNA HAIRPIN RIBOZYME; VANADATE; REACTION INTERMEDIATE; TRANSITION-STATE STABILIZATION; ACTIVE SITE WATERS; INDUCED FIT, RNA

AZW    4-{(E)-[4-(HYDROXYMETHYL)PHENYL]DIAZENYL}BENZYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
2n9q	nuc      NMR    	4-{(E)-[4-(HYDROXYMETHYL)PHENYL]DIAZENYL}BENZYL DIHYDROGEN PHOSPHATE 4(C14 H15 N2 O5 P)	PHOTOSWITCHABLE G-QUADRUPLEX DNA (5'-D(*GP*GP*(AZW)P*GP*G)-3') DNA QUADRUPLEX, PHOTOSWITCH, DNA

B12    COBALAMIN

Code	Class Resolution	Description
1ddy	nuc      3.00	COBALAMIN 4(C62 H89 CO N13 O14 P 2+)	MOLECULAR RECOGNITION BY THE VITAMIN B12 RNA APTAMER VITAMIN B12 BINDING RNA RNA RNA, TRIPLEX, VITAMIN B12, APTAMER

B1Z    ADENOSYLCOBALAMIN

Code	Class Resolution	Description
4gma	nuc      3.94	ADENOSYLCOBALAMIN C72 H101 CO N18 O17 P	CRYSTAL STRUCTURE OF THE ADENOSYLCOBALAMIN RIBOSWITCH ADENOSYLCOBALAMIN RIBOSWITCH RNA ADENOSYLCOBALAMIN, RIBOSWITCH, ADOCBL, RNA
4gxy	nuc      3.05	ADENOSYLCOBALAMIN 2(C72 H101 CO N18 O17 P)	RNA STRUCTURE ADENOSYLCOBALAMIN RIBOSWITCH RNA RNA, RIBOSWITCH, ADENOSYLCOBALAMIN

B7C    3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-7,8-DIHYDROPYRIDO[2,3-D]PYRIMIDIN- 2(3H)-ONE

Code	Class Resolution	Description
3gjh	nuc      2.90	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-7,8-DIHYDROPYRIDO[2,3-D]PYRIMIDIN- 2(3H)-ONE 2(C12 H16 N3 O7 P)	CRYSTAL STRUCTURE OF A DNA DUPLEX CONTAINING 7,8- DIHYDROPYRIDOL[2,3-D]PYRIMIDIN-2-ONE 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(B7C)P*GP*CP*G)-3' DNA DNA DUPLEX, BICYCLIC CYTOSINE, 7, 8-DIHYDROPYRIDOL[2, 3- D]PYRIMIDIN-2-ONE, DNA
3gjj	nuc      2.90	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-7,8-DIHYDROPYRIDO[2,3-D]PYRIMIDIN- 2(3H)-ONE 2(C12 H16 N3 O7 P)	CRYSTAL STRUCTURE OF A DNA DUPLEX CONTAINING 7,8- DIHYDROPYRIDOL[2,3-D]PYRIMIDIN-2-ONE 5'-D(*CP*GP*CP*GP*AP*AP*TP*(B7C)P*CP*GP*CP*G)-3' DNA DNA, DUPLEX, BICYCLIC CYTOSINE, 7, 8-DIHYDROPYRIDOL[2, 3- D]PYRIMIDIN-2-ONE
3gjk	nuc      2.20	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-7,8-DIHYDROPYRIDO[2,3-D]PYRIMIDIN- 2(3H)-ONE C12 H16 N3 O7 P	CRYSTAL STRUCTURE OF A DNA DUPLEX CONTAINING 7,8- DIHYDROPYRIDOL[2,3-D]PYRIMIDIN-2-ONE 5'-D(*CP*GP*CP*GP*AP*A)-3', 5'-D(P*TP*TP*(B7C)P*GP*CP*G)-3' DNA DNA, DUPLEX, BICYCLIC CYTOSINE, 7, 8-DIHYDROPYRIDOL[2, 3- D]PYRIMIDIN-2-ONE
3gjl	nuc      1.92	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-7,8-DIHYDROPYRIDO[2,3-D]PYRIMIDIN- 2(3H)-ONE C12 H16 N3 O7 P	CRYSTAL STRUCTURE OF A DNA DUPLEX CONTAINING 7,8- DIHYDROPYRIDOL[2,3-D]PYRIMIDIN-2-ONE 5'-D(*CP*GP*CP*GP*AP*A)-3', 5'-D(P*TP*TP*(B7C)P*GP*CP*G)-3' DNA DNA, DUPLEX, BICYCLIC CYTOSINE, 7, 8-DIHYDROPYRIDOL[2, 3- D]PYRIMIDIN-2-ONE
3n4n	nuc      1.92	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-7,8-DIHYDROPYRIDO[2,3-D]PYRIMIDIN- 2(3H)-ONE C12 H16 N3 O7 P	INSIGHTS INTO THE STABILIZING CONTRIBUTIONS OF A BICYCLIC CY ANALOGUE: CRYSTAL STRUCTURES OF DNA DUPLEXES CONTAINING 7,8 DIHYDROPYRIDO[2,3-D]PYRIMIDIN-2-ONE 5'-D(*CP*GP*CP*GP*AP*A)-3', 5'-D(P*TP*TP*(B7C)P*GP*CP*G)-3' DNA BICYCLIC CYTOSINE, DNA
3n4o	nuc      2.90	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-7,8-DIHYDROPYRIDO[2,3-D]PYRIMIDIN- 2(3H)-ONE 2(C12 H16 N3 O7 P)	INSIGHTS INTO THE STABILIZING CONTRIBUTIONS OF A BICYCLIC CY ANALOGUE: CRYSTAL STRUCTURES OF DNA DUPLEXES CONTAINING 7,8 DIHYDROPYRIDO[2,3-D]PYRIMIDIN-2-ONE 5'-D(*CP*GP*CP*GP*AP*AP*TP*(B7C)P*CP*GP*CP*G)-3' DNA BICYCLIC CYTOSINE, DNA

B9A    MACROCYCLIC-BIS-9-AMINO-ACRIDINE

Code	Class Resolution	Description
1fd5	nuc      1.10	MACROCYCLIC-BIS-9-AMINO-ACRIDINE C46 H58 N8 O2 S2	BINDING OF A MACROCYCLIC BISACRIDINE AND AMETANTRONE TO CGTACG INVOLVES SIMILAR UNUSUAL INTERCALATION PLATFORMS (BISACRIDINE COMPLEX) DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA HIGH RESOLUTION CRYSTAL STRUCTURE, INTERCALATION PLATFORM, MAD, ANTICANCER DRUG, DRUG-DNA COMPLEX, METAL IONS, TERTIARY BASE PAIRS

BA    BARIUM ION

Code	Class Resolution	Description
1i0f	nuc      1.60	BARIUM ION BA 2+	1.6 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-AMINOOXYETHYL THYMINE IN PLACE OF T6, BA-FORM 5'-D(*GP*CP*GP*TP*AP*(127)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
1ihh	nuc      2.40	BARIUM ION BA 2+	2.4 ANGSTROM CRYSTAL STRUCTURE OF AN OXALIPLATIN 1,2-D(GPG) INTRASTRAND CROSS-LINK IN A DNA DODECAMER DUPLEX 5'-D(*GP*GP*AP*GP*AP*CP*CP*AP*GP*AP*GP*G)-3', 5'-D(*CP*CP*TP*CP*TP*GP*GP*TP*CP*TP*CP*C)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, OXALIPLATIN, MODIFIED, DEOXYNUCLEIC ACID
1j6s	nuc      1.40	BARIUM ION 8(BA 2+)	CRYSTAL STRUCTURE OF AN RNA TETRAPLEX (UGAGGU)4 WITH A- TETRADS, G-TETRADS, U-TETRADS AND G-U OCTADS 5'-R(*(BRUP*GP*AP*GP*GP*U)-3' RNA RNA, TETRAPLEX, G-U OCTADS, A-TETRADS, U-TETRADS, G-TETRADS
1kd4	nuc      1.85	BARIUM ION 2(BA 2+)	THE CRYSTAL STRUCTURE OF R(GGUCACAGCCC)2, BARIUM FORM 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3' RNA RNA DUPLEX, METAL BINDING
1nta	nuc      2.90	BARIUM ION 3(BA 2+)	2.9 A CRYSTAL STRUCTURE OF STREPTOMYCIN RNA-APTAMER 5'-R(*CP*GP*GP*CP*AP*CP*CP*AP*CP*GP*GP*UP*CP*GP*G -3', 5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*GP*GP*AP*C *UP*GP*CP*C)-3' RNA STREPTOMYCIN RNA-APTAMER, BARIUM FORM, RNA
1qyk	nuc      1.40	BARIUM ION 2(BA 2+)	GCATGCT + BARIUM 5'-D(*GP*CP*AP*TP*GP*CP*T)-3' DNA QUADRUPLEX DNA, DNA
1u9s	nuc      2.90	BARIUM ION 21(BA 2+)	CRYSTAL STRUCTURE OF THE SPECIFICITY DOMAIN OF RIBONUCLEASE P OF THE A-TYPE RIBONUCLEASE P RNA RNASE P, RIBONUCLEASE P RNA, P RNA, SPECIFICITY DOMAIN, S- DOMAIN, RIBOZYME, TRNA, PRE-TRNA, THERMUS THERMOPHILUS
1xcs	nuc      1.40	BARIUM ION BA 2+	STRUCTURE OF OLIGONUCLEOTIDE/DRUG COMPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, DOUBLE HELIX, CO2+, DNA
1xcu	nuc      2.00	BARIUM ION BA 2+	OLIGONUCLEOTID/DRUG COMPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, ANTHRAQUINONE, CO2+
1y6s	nuc      2.90	BARIUM ION 6(BA 2+)	HIV-1 DIS(MAL) DUPLEX BA-SOAKED 5'- R(*CP*UP*UP*GP*CP*UP*GP*AP*GP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP *CP*AP*AP*G)-3' RNA HIV-1, RNA, METAL IONS
1y7f	nuc      1.60	BARIUM ION BA 2+	CRYSTAL STRUCTURE OF THE A-DNA GCGTAT*CGC WITH A 2'-O-[2- [HYDROXY(METHYLENEAMINO)OXY]ETHYL] THYMIDINE (T*) 5'-D(*GP*CP*GP*TP*AP*(2NT)P*AP*CP*GP*C)-3') DNA A-DNA, MODIFIED
220d	nuc      2.00	BARIUM ION BA 2+	INFLUENCE OF COUNTER-IONS ON THE CRYSTAL STRUCTURES OF DNA DECAMERS: BINDING OF [CO(NH3)6]3+ AND BA2+ TO A-DNA DNA (5'-D(*AP*CP*CP*CP*GP*CP*GP*GP*GP*T)-3') DNA A-DNA, DOUBLE HELIX
284d	nuc      1.10	BARIUM ION 11(BA 2+)	THE BI-LOOP, A NEW GENERAL FOUR-STRANDED DNA MOTIF DNA (5'-CD(*P*AP*TP*TP*CP*AP*TP*TP*C)-3') DNA CYCLIC B-DNA, QUADRUPLE HELIX, BI-LOOP
2dqo	nuc      2.30	BARIUM ION 2(BA 2+)	CRYSTAL STRUCTURE OF D(CXCTXCTTC):R(GAAGAAGAG) WHERE X IS 5- (N-AMINOHEXYL)CARBAMOYL-2'-O-METHYLURIDINE RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3'), DNA (5'-D(*DCP*(OMU)P*DCP*DTP*(OMU) P*DCP*DTP*DTP*DC)-3') DNA-RNA HYBRID MODIFIED NUCLEOTIDE, 5-(N-AMINOHEXYL)CARBAMOYL-2'-O- METHYLURIDINE, A-FORM RNA:DNA HYBRID DUPLEX, DNA-RNA HYBRID
2gpx	nuc      1.60	BARIUM ION BA 2+	2'-ME-SE AND BR DERIVITATION OF A-DNA OCTAMER G(UMS)G(BRU) ACAC 5'-D(*GP*(UMS)P*GP*(BRU)P*AP*CP*AP*C)-3' DNA 2'-METHYLSELENO-URIDINE, SE-DNA, SE-BR-DNA, SELENIUM DERIVATIZATION
2hol	nuc      2.90	BARIUM ION 9(BA 2+)	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO THIAMINE PYROPHOSPHATE, BARIUM IONS THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH
2ydh	nuc      2.90	BARIUM ION 5(BA 2+)	CRYSTAL STRUCTURE OF THE SAM-I RIBOSWITCH A94G U34 G18U G19U VARIANT IN COMPLEX WITH SAM SAM-I RIBOSWITCH RNA RNA, K-TURN
3f2w	nuc      3.45	BARIUM ION 16(BA 2+)	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, BA2+ S FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, BARIUM, RNA
3fqb	nuc      1.67	BARIUM ION BA 2+	BARIUM INTERACTIONS WITH Z-DNA 5'-D(*CP*GP*CP*GP*TP*G)-3', 5'-D(*CP*AP*CP*GP*CP*G)-3' DNA Z-DNA DOUBLE HELIX
3goj	nuc      2.60	BARIUM ION 4(BA 2+)	BARIUM BOUND TO THE HOLLIDAY SEQUENCE D(CCGGCGCCGG)4 5'-D(*CP*CP*GP*GP*CP*GP*CP*CP*GP*G)-3' DNA HOLLIDAY JUNCTION STRUCTURE, DNA
3gom	nuc      2.30	BARIUM ION 5(BA 2+)	BARIUM BOUND TO THE HOLLIDAY JUNCTION SEQUENCE D(TCGGCGCCGA) 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3' DNA HOLLIDAY JUNCTION STRUCTURE, DNA
3iqn	nuc      2.70	BARIUM ION 5(BA 2+)	FREE-STATE STRUCTURAL TRANSITIONS OF THE SAM-I RIBOSWITCH SAM-I RIBOSWITCH RNA RIBOSWITCH, SAM, KINK-TURN, PSUEDOKNOT, RNA
3iqp	nuc      2.90	BARIUM ION 10(BA 2+)	SAM-I RIBOSWITCH FROM T. TENCONGENSIS VARIANT A94G APO FORM SAM-I RIBOSWITCH RNA RIBOSWITCH, SAM, KINK-TURN, PSUEDOKNOT, RNA
3iqr	nuc      2.55	BARIUM ION 9(BA 2+)	SAM-I RIBOSWITCH FROM T. TENCONGENSIS VARIANT A94G BOUND WIT SAM-I RIBOSWITCH RNA RIBOSWITCH, SAM, KINK-TURN, PSUEDOKNOT, RNA
3oxj	nuc      3.20	BARIUM ION 24(BA 2+)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, SOAKED IN BA2+ DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3p4b	nuc      1.45	BARIUM ION 2(BA 2+)	ALTERNATINGLY MODIFIED 2'FLUORO RNA OCTAMER F/RA2U2-P3 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ)P*G)-3' RNA RNA, 2'-FLUORO-RNA, O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYADENOSINE, 2'-FLUORO 2'- DEOXYURIDINE, SIRNA
3qf8	nuc      1.73	BARIUM ION BA 2+	X-RAY CRYSTAL STRUCTURE OF THE RUTHENIUM COMPLEX [RU(TAP)2(D BOUND TO D(TCGGCGCCGA) AT MEDIUM RESOLUTION 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3' DNA B-DNA, INTERCALATION, KINK, FLIPPED OUT BASE, DNA
3qrn	nuc      1.10	BARIUM ION BA 2+	X-RAY CRYSTAL STRUCTURE OF THE RUTHENIUM COMPLEX [RU(TAP)2(D BOUND TO D(TCGGCGCCGA)AT HIGH RESOLUTION 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3' DNA INTERCALATION, SEMI-INTERCALATION, B-DNA, DNA
3u38	nuc      2.13	BARIUM ION BA 2+	INTERCALATION OF LAMBDA-[RU(PHEN)2(DPPZ)]2+ INTO D(CCGGTACCG 5'-D(*CP*CP*GP*GP*TP*AP*CP*CP*GP*G)-3' DNA B-DNA, RUTHENIUM, DNA
3uyb	nuc      1.50	BARIUM ION BA 2+	X-RAY CRYSTAL STRUCTURE OF THE RUTHENIUM COMPLEX [RU(TAP)2(D BOUND TO D(TCGGTACCGA) 5'-D(*TP*CP*GP*GP*TP*AP*CP*CP*GP*A)-3' DNA DNA-RUTHENIUM COMPLEX, SEMIINTERCALATION, INTERCALATION, MIN INTERACTION, DNA
439d	nuc      1.60	BARIUM ION BA 2+	5'-R(*CP*UP*GP*GP*GP*CP*GP*G)-3', 5'- R(*CP*CP*GP*CP*CP*UP*GP*G)-3' RNA (5'-R(*CP*CP*GP*CP*CP*UP*GP*G)-3'), RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*G)-3') RNA FRAGMENT OF 5S RRNA, A-RNA
4aob	nuc      2.95	BARIUM ION 15(BA 2+)	SAM-I RIBOSWITCH CONTAINING THE T. SOLENOPSAE KT-23 IN COMPL S-ADENOSYL METHIONINE SAM-I RIBOSWITCH TRANSLATION TRANSLATION, K-TURN, RNA
4b5r	nuc      2.95	BARIUM ION 12(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI K-T-7 SAM-I RIBOSWITCH: APTAMER DOMAIN, RESIDUES 1-94 RNA RNA, RIBOSWITCH, K-TURN
4e1u	nuc      0.92	BARIUM ION 2(BA 2+)	[RU(BPY)2 DPPZ]2+ BOUND TO DNA 5'-D(*CP*GP*GP*AP*AP*AP*TP*TP*AP*CP*CP*G)-3' DNA MISMATCH, SMALL MOLECULE, DNA
4e2r	nuc      1.67	BARIUM ION BA 2+	INTERACTIONS OF BA2+ WITH A NON-SELF-COMPLEMENTARY Z-TYPE DN DNA (5'-D(*CP*AP*CP*GP*CP*G)-3'), DNA (5'-D(*CP*GP*CP*GP*TP*G)-3') DNA Z-TYPE DNA DOUBLE HELICES, BARIUM IONS, DNA
4e4o	nuc      1.72	BARIUM ION BA 2+	INTERACTIONS OF BA2+ WITH A NON-SELF-COMPLEMENTARY Z-TYPE DN DNA (5'-D(*CP*AP*CP*GP*CP*G)-3'), DNA (5'-D(*CP*GP*CP*GP*TP*G)-3') DNA Z-TYPE DNA DOUBLE HELICES, BARIUM IONS, DNA
4e60	nuc      1.86	BARIUM ION BA 2+	INTERACTIONS OF BA2+ WITH A NON-SELF-COMPLEMENTARY Z-TYPE DN DNA (5'-D(P*TP*G)-3'), DNA (5'-D(*CP*GP*CP*GP*TP*G)-3'), DNA (5'-D(*CP*AP*CP*GP*CP*G)-3') DNA Z-TYPE DNA DOUBLE HELICES, BARIUM IONS, DNA
4e7y	nuc      1.70	BARIUM ION BA 2+	LAMBDA-[RU(PHEN)2(DPPZ)]2+ BOUND TO CCGGATCCGG 5'-D(*CP*CP*GP*GP*AP*TP*CP*CP*GP*G)-3' DNA INTERCALATION, DNA, LAMBDA-[RU(PHEN)2(DPPZ)]2+
4e8s	nuc      1.24	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ{ME2}2)]2+ BOUND TO TCGGCGCCGA AT HIGH 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3' DNA INTERCALATION, PHOTOREACTIVE, DNA, RUTHENIUM COMPLEX
4e8v	nuc      4.00	BARIUM ION 42(BA 2+)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF K+ AND BA2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4e8x	nuc      2.18	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ-(ME)2)]2+ BOUND TO D(CCGGCGCCGG)2 5'-D(*CP*CP*GP*GP*CP*GP*CP*CP*GP*G)-3' DNA INTERCALATION, PHOTOREACTIVE, LAMBDA-[RU(TAP)2(DPPZ-(ME)2)]2
4e95	nuc      1.94	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ-(ME)2)]2+ BOUND TO CCGGATCCGG 5'-D(*CP*CP*GP*GP*AP*TP*CP*CP*GP*G)-3' DNA INTERCALATION, PHOTOREACTIVE, LAMBDA-[RU(TAP)2(DPPZ-(ME)2]2+
4frn	nuc      3.43	BARIUM ION 12(BA 2+)	CRYSTAL STRUCTURE OF THE COBALAMIN RIBOSWITCH REGULATORY ELE COBALAMIN RIBOSWITCH APTAMER DOMAIN RNA COBALAMIN, RIBOSWITCH, B12, RNA
4iii	nuc      1.02	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(11-CL-DPPZ)] WITH A DNA DECAMER AT ATOMIC R 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3' DNA DUPLEX, RUTHENIUM, DNA
4ltf	nuc      1.50	BARIUM ION BA 2+	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 97% RELATIVE HUMIDITY(1/7) DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4ltg	nuc      1.18	BARIUM ION BA 2+	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 74% RELATIVE HUMIDITY (2/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4lth	nuc      1.60	BARIUM ION BA 2+	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 97% RELATIVE HUMIDITY (3/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4lti	nuc      1.41	BARIUM ION BA 2+	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 74% RELATIVE HUMIDITY (4/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4ltj	nuc      1.80	BARIUM ION BA 2+	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 97% RELATIVE HUMIDITY (5/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4ltk	nuc      1.45	BARIUM ION BA 2+	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 74% RELATIVE HUMIDITY (6/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4ltl	nuc      2.07	BARIUM ION BA 2+	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 97% RELATIVE HUMIDITY (7/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4ly2	nuc      2.10	BARIUM ION BA 2+	X-RAY CRYSTAL STRUCTURE OF THE RUTHENIUM COMPLEX [RU(PHEN)2( BOUND TO D(TCGGTACCGA) DNA DNA INTERCALATION, SEMI-INTERCALATION, SYMMETRICAL INTERCALATION BINDING, LIGHT-SWITCH COMPOUNDS, DNA DAMAGE AGENT, GUANINE OXIDATION, DNA
4m3i	nuc      2.10	BARIUM ION BA 2+	X-RAY CRYSTAL STRUCTURE OF THE RUTHENIUM COMPLEX [RU(TAP)2(D {ME2})]2+ BOUND TO D(CCGGTACCGG) SYNTHETIC DNA CCGGTACCGG DNA INTERCALATION, SEMI-INTERCALATION, MINOR-GROOVE BINDER, LIGH BENDING, KINKING, DNA
4m3v	nuc      2.05	BARIUM ION BA 2+	X-RAY CRYSTAL STRUCTURE OF THE RUTHENIUM COMPLEX [RU(TAP)2(D {ME2})]2+ BOUND TO D(TCGGTACCGA) DNA DECAMER SEQUENCE DNA MINOR-GROOVE, SEMI-INTERCALATION, INTERCALATION, BENDING, KI SYMMETRICAL INTERCALATION, DNA LIGHT-SWITCH COMPOUND, DNA
4mj9	nuc      0.97	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ-10-ME)]2+ BOUND TO A SYNTHETIC DNA OLI DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA METHYL-SUBSTITUTED, INTERCALATION, RUTHENIUM, ASYMMETRIC SUBSTITUTION, DNA
4ms5	nuc      2.23	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ-11,12-(F)2)]2+ BOUND TO CCGGATCCGG DNA DNA INTERCALATION, SEMI-INTERCALATION, DNA, RUTHENIUM
4o5y	nuc      1.75	BARIUM ION BA 2+	O6-CARBOXYMETHYLGUANINE IN DNA FORMS A SEQUENCE CONTEXT DEPE WOBBLE BASE PAIR STRUCTURE WITH THYMINE DNA (5'-D(*CP*GP*CP*(C6G)P*AP*AP*TP*TP*TP*GP*CP*G CHAIN: A, B DNA DAMAGED DNA, O6-CARBOXYMETHYLGUANINE, DNA
4o5z	nuc      1.75	BARIUM ION BA 2+	O6-CARBOXYMETHYLGUANINE IN DNA FORMS A SEQUENCE CONTEXT DEPE WOBBLE BASE PAIR STRUCTURE WITH THYMINE DNA (5'-D(*CP*GP*CP*(C6G)P*AP*AP*TP*TP*TP*GP*CP*G CHAIN: A, B DNA DAMAGED DNA, O6-CARBOXYMETHYLGUANINE, DNA
4qio	nuc      0.95	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ)]2+ BOUND TO D(TCGGCGCCIA) AT HIGH RES 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*IP*A)-3' DNA INTERCALATION, RUTHENIUM COMPLEX, INOSINE, DNA
4r8j	nuc      1.21	BARIUM ION BA 2+	D(TCGGCGCCGA) WITH LAMBDA-[RU(TAP)2(DPPZ)]2+ SOAKED IN D2O DNA (5'-D(*(THM)P*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA DNA KINKING, INFRA-RED, RUTHENIUM, DNA
4re7	nuc      2.18	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ)]2+ BOUND TO D(TCIGCGCCGA) 5'-D(*TP*CP*IP*GP*CP*GP*CP*CP*GP*A)-3' DNA INOSINE, KINKING, RUTHENIUM, DNA
4ts0	nuc      2.80	BARIUM ION BA 2+	CRYSTAL STRUCTURE OF THE SPINACH RNA APTAMER IN COMPLEX WITH BARIUM IONS SPINACH RNA APTAMER, BIMOLECULAR CONSTRUCT, SPINACH RNA APTAMER, BIMOLECULAR CONSTRUCT RNA APTAMER, FLUORESCENCE, G-QUADRUPLEX, RNA
4u92	nuc      1.50	BARIUM ION 6(BA 2+)	CRYSTAL STRUCTURE OF A DNA/BA2+ G-QUADRUPLEX CONTAINING A WA MEDIATED C-TETRAD DNA (5'-D(*CP*CP*AP*KP*GP*CP*GP*TP*GP*G)-3') DNA DNA QUADRUPLEX BARIUM C-TETRAD, DNA
4x18	nuc      1.05	BARIUM ION BA 2+	[RU(TAP)2(DPPZ-11-ME)]2+ BOUND TO D(TCGGCGCCGA) DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA RUTHENIUM, DNA, SUBSTITUTION, DUPLEX
4x1a	nuc      0.89	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ-10,12-ME)]2+ BOUND TO D(TCGGCGCCGA) DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA RUTHENIUM, DNA, POLYPYRIDYL
4xk0	nuc      1.08	BARIUM ION 3(BA 2+)	CRYSTAL STRUCTURE OF A TETRAMOLECULAR RNA G-QUADRUPLEX IN PO RNA (5'-(*UP*GP*GP*GP*GP*U)-3') RNA RNA, RNA G-QUADRUPLEX, TETRAMOLECULAR G-QUADRUPLEX, INTERMOL QUADRUPLEX
4y1i	nuc      2.85	BARIUM ION 19(BA 2+)	LACTOCOCCUS LACTIS YYBP-YKOY MN RIBOSWITCH BOUND TO MN2+ LACTOCOCCUS LACTIS YYBP-YKOY RIBOSWITCH RNA RIBOSWITCH, MANGANESE-BINDING, RNA
4ymc	nuc      1.88	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ)]2+ BOUND TO D(CCGGATCCGG)2 DNA (5'-D(*CP*CP*GP*GP*AP*TP*CP*CP*GP*G)-3') DNA RUTHENIUM, COMPLEX, DNA, INTERCALATION
5ebi	nuc      1.09	BARIUM ION 16(BA 2+)	CRYSTAL STRUCTURE OF A DNA-RNA CHIMERA IN COMPLEX WITH BA2+ CASE OF UNUSUAL MULTI-DOMAIN TWINNING DNA/RNA (5'-D(*C)-R(P*G)-D(P*C)-R(P*G)-D(P*C)-R(P CHAIN: A, B, C, D, E, F, G, H DNA/RNA CHIMERA DNA-RNA CHIMERA COMPLEX; Z-DNA; Z-RNA; SELF-COMPLEMENTARY DU LEFT-HANDED Z-TYPE DUPLEX; MULTI-DOMAIN TWINNING; DETECTION PSEUDOSYMMETRY, DNA-RNA CHIMERA COMPLEX
5et2	nuc      1.39	BARIUM ION BA 2+	LAMBDA-RU(TAP)2(DPPZ)]2+ BOUND TO D(TTGGCGCCAA) DNA (5'-D(*(THM)P*TP*GP*GP*CP*GP*CP*CP*AP*A)-3') DNA RUTHENIUM INTERCALATION DNA PHOTOACTIVE, DNA
5et9	nuc      1.83	BARIUM ION 2(BA 2+)	RACEMIC CRYSTAL STRUCTURES OF PRIBNOW BOX CONSENSUS PROMOTER (P21/N) PRIBNOW BOX NON-TEMPLATE STRAND, PRIBNOW BOX CONSENSUS SEQUENCE- TEMPLATE STRAND DNA RACEMIC DNA CRYSTALLOGRAPHY, PRIBNOW BOX, BACTERIAL PROMOTER DNA
5ew7	nuc      1.75	BARIUM ION BA 2+	CRYSTAL STRUCTURE OF C9ORF72 ANTISENSE CCCCGG REPEAT RNA ASS WITH LOU GEHRIG'S DISEASE AND FRONTOTEMPORAL DEMENTIA, CRYS WITH BA2+ RNA (5'- R(*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP*GP*GP*CP 3') RNA REPEAT EXPANSION DISORDER, GENETIC DISEASE, RNA
5fjc	nuc      1.71	BARIUM ION 21(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT C- SAM-I RIBOSWITCH: SAM BINDING DOMAIN RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fk1	nuc      2.50	BARIUM ION 12(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN SAM-I RIBOSWITCH: SAM BINDING DOMAIN, RESIDUES 1-94 RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fk2	nuc      2.60	BARIUM ION 11(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN SAM-I RIBOSWITCH: SAM BINDING DOMAIN, RESIDUES 1-94 RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fk3	nuc      2.50	BARIUM ION 15(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN SAM-I RIBOSWITCH: SAM BINDING DOMAIN, RESIDUES 1-94 RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fk4	nuc      2.43	BARIUM ION 17(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN SAM-I RIBOSWITCH: SAM BINDING DOMAIN, RESIDUES 1-93 RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fk5	nuc      3.32	BARIUM ION 12(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN SAM-I RIBOSWITCH: SAM BINDING DOMAIN, RESIDUES 1-93 RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fk6	nuc      2.50	BARIUM ION 12(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS CA SAM-I RIBOSWITCH: SAM BINDING DOMAIN RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fkd	nuc      3.00	BARIUM ION 13(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS UA SAM-I RIBOSWITCH: SAM BINDING DOMAIN, RESIDUES 1-94 RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fke	nuc      2.80	BARIUM ION 16(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS GU SAM-I RIBOSWITCH: SAM BINDING DOMAIN, RESIDUES 1-94 RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fkf	nuc      2.80	BARIUM ION 12(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN IS UC SAM-I RIBOSWITCH: SAM BINDING DOMAIN RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fkg	nuc      2.95	BARIUM ION 13(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN SAM-I RIBOSWITCH: SAM BINDING DOMAIN (1-94) RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5fkh	nuc      2.65	BARIUM ION 12(BA 2+)	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT 3BN SAM-I RIBOSWITCH: SAM BINDING DOMAIN RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5ip8	nuc      1.76	BARIUM ION 2(BA 2+)	LAMBDA-RU(TAP)2DPPZ BOUND TO D(CCGGCTCCGG) DNA (5'-D(*CP*CP*GP*GP*AP*GP*CP*CP*GP*G)-3'), DNA (5'-D(*CP*CP*GP*GP*CP*TP*CP*CP*GP*G)-3') DNA SEQUENCE SPECIFIC, DNA, RUTHENIUM, PHOTOOXIDISING
5iwj	nuc      1.88	BARIUM ION BA 2+	LAMBDA-[RU(TAP)2(DPPZ)]2+ BOUND TO D(CCGGGCCCGG DNA (5'-D(*CP*CP*GP*GP*GP*CP*CP*CP*GP*G)-3') DNA RUTHENIUM, PHOTOOXIDISING, DNA, INTERCALATION
5jeu	nuc      0.97	BARIUM ION BA 2+	DEL-[RU(PHEN)2(DPPZ)]2+ BOUND TO D(TCGGCGCCGA) WITH BA2+ DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA DNA, RUTHENIUM, LIGHT-SWITCH, SEMI-INTERCALATION
5lfs	nuc      1.85	BARIUM ION BA 2+	LAMBDA-[RU(BPY)2(DPPZ)]2+ BOUND TO BROMINATED DNA DNA (5'-D(*(CBR)P*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*G)-3') DNA DNA, RUTHENIUM, INTERCALATION, LIGHT-SWITCH
5lfw	nuc      1.28	BARIUM ION BA 2+	LAMBDA-[RU(PHEN)2(DPPZ)]2+ BOUND TO A SHORT SUBSTITUTED DNA DNA (5'-D(*(CBR)P*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*G)-3') DNA DNA, RUTHENIUM, INTERCALATION, LIGHT-SWITCH
5lfx	nuc      1.56	BARIUM ION BA 2+	LAMBDA-[RU(PHEN)2(DPPZ-11,12-ME)]2+ BOUND TO A SHORT SUBSTIT SEQUENCE DNA (5'-D(*(CBR)P*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*G)-3') DNA DNA, RUTHENIUM, LIGHT-SWITCH, INTERCALATION
5wss	nuc      1.45	BARIUM ION BA 2+	CRYSTAL STRUCTURE OF T-HG-T PAIR CONTAINING DNA DUPLEX IN TH BA2+ DNA (5'-D(*GP*GP*TP*CP*GP*TP*CP*C)-3') DNA DNA DUPLEX, T-HG-T PAIR, DNA

BAP    1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE

Code	Class Resolution	Description
1axl	nuc      NMR    	1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE C20 H16 O3	SOLUTION CONFORMATION OF THE (-)-TRANS-ANTI-[BP]DG ADDUCT OPPOSITE A DELETION SITE IN DNA DUPLEX D(CCATC-[BP]G- CTACC)D(GGTAG--GATGG), NMR, 6 STRUCTURES DNA DUPLEX D(CCATC-[BP]G-CTACC)D(GGTAG--GATGG), DNA DUPLEX D(CCATC-[BP]G-CTACC)D(GGTAG--GATGG) DNA DEOXYRIBONUCLEIC ACID, DNA, BENZO[A]PYRENE, CARCINOGEN
1axo	nuc      NMR    	1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE C20 H16 O3	STRUCTURAL ALIGNMENT OF THE (+)-TRANS-ANTI-[BP]DG ADDUCT POSITIONED OPPOSITE DC AT A DNA TEMPLATE-PRIMER JUNCTION, NMR, 6 STRUCTURES DNA DUPLEX D(AAC-[BP]G-CTACCATCC)D(GGATGGTAGC), DNA DUPLEX D(AAC-[BP]G-CTACCATCC)D(GGATGGTAGC) DNA DEOXYRIBONUCLEIC ACID, DNA, BENZO[A]PYRENE, CARCINOGEN
1axv	nuc      NMR    	1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE C20 H16 O3	SOLUTION NMR STRUCTURE OF THE [BP]DA ADDUCT OPPOSITE DT IN A DNA DUPLEX, 6 STRUCTURES DNA DUPLEX D(CTCTC-[BP]A-CTTCC)D(GGAAGTGAGAG), DNA DUPLEX D(CTCTC-[BP]A-CTTCC)D(GGAAGTGAGAG) DNA DNA DUPLEX, BENZO[A]PYRENE ADDUCT, CARCINOGEN ADDUCT
1bps	nuc      NMR    	1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE C20 H16 O3	MINOR CONFORMER OF A BENZO[A]PYRENE DIOL EPOXIDE ADDUCT OF DA IN DUPLEX DNA DNA (5'-D(*GP*GP*TP*CP*(BAP)AP*CP*GP*AP*G)-3'), DNA (5'-D(*CP*TP*CP*GP*GP*GP*AP*CP*C)-3') DNA DEOXYRIBONUCLEIC ACID, BENZO[A]PYRENE DIOL EPOXIDE ADDUCT, DUPLEX DNA
1dxa	nuc      NMR    	1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE C20 H16 O3	BENZO[A]PYRENE DIOL EPOXIDE ADDUCT OF DA IN DUPLEX DNA DNA (5'-D(*CP*TP*CP*GP*GP*GP*AP*CP*C)-3'), DNA (5'-D(*GP*GP*TP*CP*AP*CP*GP*AP*G)-3') DNA NMR, DOUBLE HELIX, BENZO[A]PYRENE DIOL EPOXIDE ADDUCT, DUPLEX DNA, NON-WATSON-CRICK BASE PAIR
1fyy	nuc      NMR    	1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE C20 H16 O3	HPRT GENE MUTATION HOTSPOT WITH A BPDE2(10R) ADDUCT 5'-D(*TP*GP*CP*CP*CP*TP*TP*GP*AP*CP*TP*A)-3', HPRT DNA WITH BENZO[A]PYRENE-ADDUCTED DA7 DNA DNA LESIONS, BENZO[A]PYRENE, HPRT GENE, DIOL EPOXIDE ADDUCTS, SYN-ANTI INTERCONVERSION
1y9h	nuc      NMR    	1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE C20 H16 O3	METHYLATION OF CYTOSINE AT C5 IN A CPG SEQUENCE CONTEXT CAUSES A CONFORMATIONAL SWITCH OF A BENZO[A]PYRENE DIOL EPOXIDE-N2-GUANINE ADDUCT IN DNA FROM A MINOR GROOVE ALIGNMENT TO INTERCALATION WITH BASE DISPLACEMENT 5'-D(*GP*GP*TP*AP*GP*CP*GP*AP*TP*GP*G)-3', 5'-D(*CP*CP*AP*TP*(5CM)P*(BPG)P*CP*TP*AP*CP*C)- 3' DNA CONFORMATIONAL SWITCH, CYTOSINE METHYLATION, P53 MUTATION HOT SPOT, DNA ADDUCT, BENZO[A]PYRENE, BPDE

BBZ    2'-(4-DIMETHYLAMINOPHENYL)-5-(4-METHYL-1-PIPERAZINYL)- 2,5'-BI-BENZIMIDAZOLE

Code	Class Resolution	Description
1qv8	nuc      2.50	2'-(4-DIMETHYLAMINOPHENYL)-5-(4-METHYL-1-PIPERAZINYL)- 2,5'-BI-BENZIMIDAZOLE C27 H29 N7	B-DNA DODECAMER D(CGCGAATTCGCG)2 COMPLEXED WITH PROAMINE 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA B-DNA, MINOR GROOVE BINDER
447d	nuc      2.20	2'-(4-DIMETHYLAMINOPHENYL)-5-(4-METHYL-1-PIPERAZINYL)- 2,5'-BI-BENZIMIDAZOLE C27 H29 N7	5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA B-DNA, MINOR GROOVE BINDING

BC    BENZO[G]CHRYSENE

Code	Class Resolution	Description
1cr3	nuc      NMR    	BENZO[G]CHRYSENE C22 H18 O3	SOLUTION CONFORMATION OF THE (+)TRANS-ANTI-BENZO[G]CHRYSENE- DA ADDUCT OPPOSITE DT IN A DNA DUPLEX DNA (5'-D(*CP*TP*CP*TP*CP*AP*CP*TP*TP*CP*C)-3'), DNA (5'-D(*GP*GP*AP*AP*GP*TP*GP*AP*GP*AP*G)-3') DNA DNA DUPLEX, BENZO[G]CHRYSENE ADDUCT, CARCINOGEN ADDUCT

BDA    4-METHYLBENZYL-N-BIS[DAUNOMYCIN]

Code	Class Resolution	Description
1agl	nuc      2.20	4-METHYLBENZYL-N-BIS[DAUNOMYCIN] C62 H66 N2 O20 2+	STRUCTURE OF A DNA-BISDAUNOMYCIN COMPLEX DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1al9	nuc      NMR    	4-METHYLBENZYL-N-BIS[DAUNOMYCIN] C62 H66 N2 O20 2+	NMR STUDY OF DNA (5'-D(*AP*CP*GP*TP*AP*CP*GP*T)-3') SELF- COMPLEMENTARY DUPLEX COMPLEXED WITH A BIS-DAUNORUBICIN, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*AP*CP*GP*TP*AP*CP*GP*T)-3') DNA COMPLEX (DEOXYRIBONUCLEIC ACID/DRUG), BIS-INTERCALATOR, DAUNORUBICIN, DNA, DEOXYRIBONUCLEIC ACID

BDC    BIS-(9-OCTYLAMINO(2-DIMETHYLAMINOETHYL)ACRIDINE-4- CARBOXAMIDE

Code	Class Resolution	Description
1k2l	nuc      2.40	BIS-(9-OCTYLAMINO(2-DIMETHYLAMINOETHYL)ACRIDINE-4- CARBOXAMIDE C44 H54 N8 O2	STRUCTURAL CHARACTERIZATION OF BISINTERCALATION IN HIGHER- ORDER DNA AT A JUNCTION-LIKE QUADRUPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DNA STRAND EXCHANGE, QUADRUPLEX, BISINTERCALATION

BDG    O-2,6-DIAMINO-2,6-DIDEOXY-ALPHA-D-GLUCOPYRANOSE

Code	Class Resolution	Description
1at8	nuc      model  	O-2,6-DIAMINO-2,6-DIDEOXY-ALPHA-D-GLUCOPYRANOSE C6 H14 N2 O4	THEORETICAL MODEL OF THE REV BINDING ELEMENT (RBE, 30 RIBONUCLEOTIDE FRAGMENT) OF HUMAN IMMUNODEFICIENCY VIRUS-1 COMPLEXED WITH NEOMYCIN B REV BINDING ELEMENT: 30 RIBONUCLEOTIDE FRAGMENT RIBONUCLEIC ACID RNA/AMINOGLYCOSIDE COMPLEX, MRNA TRANSPORT, INHIBITION OF VIRAL REPLICATION, RIBONUCLEIC ACID
1nem	nuc      NMR    	O-2,6-DIAMINO-2,6-DIDEOXY-ALPHA-D-GLUCOPYRANOSE C6 H14 N2 O4	SACCHARIDE-RNA RECOGNITION IN THE NEOMYCIN B / RNA APTAMER COMPLEX 5'- R(*GP*GP*AP*CP*UP*GP*GP*GP*CP*GP*AP*GP*AP*AP*GP*UP*UP*UP*AP *GP*UP*CP*C)-3' RNA RNA APTAMER, AMINOGLYCOSIDE, ANTIBIOTIC
1o9m	nuc      2.40	O-2,6-DIAMINO-2,6-DIDEOXY-ALPHA-D- GLUCOPYRANOSE C6 H14 N2 O4	THE COMPLEX OF A NOVEL ANTIBIOTIC WITH THE AMINOACYL SITE OF THE BACTERIAL RIBOSOME REVEALED BY X-RAY CRYSTALLOGRAPHY. EUBACTERIAL A-SITE ANTIBIOTIC/RNA ANTIBIOTIC/RNA, RNA-ANTIBIOTIC INTERACTIONS, A-SITE
1qd3	nuc      NMR    	O-2,6-DIAMINO-2,6-DIDEOXY-ALPHA-D-GLUCOPYRANOSE C6 H14 N2 O4	HIV-1 TAR RNA/NEOMYCIN B COMPLEX HIV-1 TAR RNA: RESIDUES 17-45 RNA NMR, HIV-1, AMINOGLYCOSIDE-RNA-COMPLEX, MINOR GROOVE BINDING

BDR    BETA-D-RIBOFURANOSYL

Code	Class Resolution	Description
1at8	nuc      model  	BETA-D-RIBOFURANOSYL C5 H10 O5	THEORETICAL MODEL OF THE REV BINDING ELEMENT (RBE, 30 RIBONUCLEOTIDE FRAGMENT) OF HUMAN IMMUNODEFICIENCY VIRUS-1 COMPLEXED WITH NEOMYCIN B REV BINDING ELEMENT: 30 RIBONUCLEOTIDE FRAGMENT RIBONUCLEIC ACID RNA/AMINOGLYCOSIDE COMPLEX, MRNA TRANSPORT, INHIBITION OF VIRAL REPLICATION, RIBONUCLEIC ACID
1nem	nuc      NMR    	BETA-D-RIBOFURANOSYL C5 H10 O5	SACCHARIDE-RNA RECOGNITION IN THE NEOMYCIN B / RNA APTAMER COMPLEX 5'- R(*GP*GP*AP*CP*UP*GP*GP*GP*CP*GP*AP*GP*AP*AP*GP*UP*UP*UP*AP *GP*UP*CP*C)-3' RNA RNA APTAMER, AMINOGLYCOSIDE, ANTIBIOTIC
1pbr	nuc      NMR    	BETA-D-RIBOFURANOSYL C5 H10 O5	STRUCTURE OF 16S RIBOSOMAL RNA, NMR, MINIMIZED AVERAGE STRUC 16S RIBOSOMAL RNA RNA AMINOGLYCOSIDE, RIBOSOMAL RNA, RNA TRANSCRIPT, ANTIBIOTIC, RIBONUCLEIC ACID, RNA
1qxb	nuc      NMR    	BETA-D-RIBOFURANOSYL 2(C5 H10 O5)	NMR STRUCTURE DETERMINATION OF THE SELF COMPLEMENTARY DNA DODECAMER CGCGAATT*CGCG IN WHICH A RIBOSE IS INSERTED BETWEEN THE 3'-OH OF T8 AND THE 5'-PHOSPHATE GROUP OF C9 5'-D(CPGPCPGPAPAPTPTPCPGPCPG)-3' DNA DISACCHARIDE NUCLEOTIDE, BACKBONE MODIFICATION, B-HELIX, RIBOSE, DNA

BER    BERBERINE

Code	Class Resolution	Description
3np6	nuc      2.30	BERBERINE C20 H18 N O4 1+	THE CRYSTAL STRUCTURE OF BERBERINE BOUND TO DNA D(CGTACG) 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, DOUBLE HELIX, B-DNA, DNA
3r6r	nuc      2.40	BERBERINE 4(C20 H18 N O4 1+)	STRUCTURE OF THE COMPLEX OF AN INTRAMOLECULAR HUMAN TELOMERI BERBERINE FORMED IN K+ SOLUTION DNA (22-MER) DNA/ANTIBIOTIC DNA-DRUG COMPLEX, G-QUADRUPLEX, HUMAN TELOMERIC DNA, DNA, DN ANTIBIOTIC COMPLEX

BFA    9-BROMO-PHENAZINE-1-CARBOXYLIC ACID (2-DIMETHYLAMINO- ETHYL)-AMIDE

Code	Class Resolution	Description
1eg6	nuc      2.00	9-BROMO-PHENAZINE-1-CARBOXYLIC ACID (2-DIMETHYLAMINO- ETHYL)-AMIDE C17 H17 BR N4 O	CRYSTAL STRUCTURE ANALYSIS OF D(CG(5-BRU)ACG) COMPLEXES TO A PHENAZINE 5'-D(*CP*GP*(BRO)UP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, INTERCALATION, MAJOR GROOVE BINDING, DOUBLE HELIX

BFT    S-BENZOYLTHIAMINE O-MONOPHOSPHATE

Code	Class Resolution	Description
2hoo	nuc      3.00	S-BENZOYLTHIAMINE O-MONOPHOSPHATE C19 H25 N4 O6 P S	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO BENFOTIAMINE THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH; BENFOTIAMINE

BGC    BETA-D-GLUCOSE

Code	Class Resolution	Description
308d	nuc      1.50	BETA-D-GLUCOSE 2(C6 H12 O6)	BINDING OF DAUNOMYCIN TO B-D-GLUCOSYLATED DNA FOUND IN PROTOZOA TRYPANOSOMA BRUCEI STUDIED BY X-RAY CRYSTALLOGRAPH DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED

BGF    2,5-BIS(4-GUANYLPHENYL)FURAN

Code	Class Resolution	Description
227d	nuc      2.20	2,5-BIS(4-GUANYLPHENYL)FURAN C18 H18 N4 O 2+	A CRYSTALLOGRAPHIC AND SPECTROSCOPIC STUDY OF THE COMPLEX BETWEEN D(CGCGAATTCGCG)2 AND 2,5-BIS(4-GUANYLPHENYL)FURAN, AN ANALOGUE OF BERENIL. STRUCTURAL ORIGINS OF ENHANCED DNA- BINDING AFFINITY DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

BGM    8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1mdg	nuc      1.50	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C10 H13 BR N5 O7 P	AN ALTERNATING ANTIPARALLEL OCTAPLEX IN AN RNA CRYSTAL STRUC 5'-R(*UP*(BGM)GP*AP*GP*GP*U)-3' RNA TETRAPLEX, BASE TETRADS, BASE OCTADS, RNA
1n7a	nuc      1.20	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 8(C10 H13 BR N5 O7 P)	RIP-RADIATION-DAMAGE INDUCED PHASING RNA/DNA (5'-R(*U)-D(P*(BGM))-R(P*AP*GP*GP*U)-3') DNA, RNA DNA, RNA
1n7b	nuc      1.40	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 8(C10 H13 BR N5 O7 P)	RIP-RADIATION-DAMAGE INDUCED PHASING RNA/DNA (5'-R(*U)-D(P*(BGM))-R(P*AP*GP*GP*U)-3') DNA, RNA DNA, RNA
2awe	nuc      2.10	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 8(C10 H13 BR N5 O7 P)	BASE-TETRAD SWAPPING RESULTS IN DIMERIZATION OF RNA QUADRUPLEXES: IMPLICATIONS FOR FORMATION OF I-MOTIF RNA OCTAPLEX 5'-R(*UP*(BGM)P*GP*UP*GP*U)-3' RNA RNA, TETRAPLEX, OCTAPLEX
2e4i	nuc      NMR    	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 5(C10 H13 BR N5 O7 P)	HUMAN TELOMERIC DNA MIXED-PARALLEL/ANTIPARALLEL QUADRUPLEX UNDER PHYSIOLOGICAL IONIC CONDITIONS STABILIZED BY PROPER INCORPORATION OF 8-BROMOGUANOSINES DNA (5'-D(*DAP*(BGM)P*DGP*DGP*DTP*DTP*DAP*(BGM) P*DGP*DGP*DTP*DTP*DAP*(BGM)P*(BGM)P*DGP*DTP*DTP*DAP*(BGM) P*DGP*DG)-3') DNA TELOMERE, QUADRUPLEX, MIXED-PARALLEL/ANTIPARALLEL, NMR, DNA, STRUCTURE
2jsk	nuc      NMR    	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C10 H13 BR N5 O7 P	MONOMERIC HUMAN TELOMERE DNA TETRAPLEX WITH 3+1 STRAND FOLD TOPOLOGY, TWO EDGEWISE LOOPS AND DOUBLE-CHAIN REVERSAL LOOP, 16 G FORM 1, NMR, 10 STRUCTURES HUMAN TELOMERE DNA DNA G-TETRAD, 3+1 STRAND FOLDING, EDGEWISE, DOUBLE-CHAIN REVERSAL LOOPS, NMR, FORM 1 16BRG, 10 STRUCTURES, DNA
2jsq	nuc      NMR    	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C10 H13 BR N5 O7 P	MONOMERIC HUMAN TELOMERE DNA TETRAPLEX WITH 3+1 STRAND FOLD TOPOLOGY, TWO EDGEWISE LOOPS AND DOUBLE-CHAIN REVERSAL LOOP, FORM 2 15BRG, NMR, 10 STRUCTURES HUMAN TELOMERE DNA DNA G-TETRAD, 3+1 STRAND FOLDING, EDGEWISE, DOUBLE-CHAIN REVERSAL LOOPS, NMR, 10 STRUCTURES, 15BRG FORM 2, DNA
2kf7	nuc      NMR    	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C10 H13 BR N5 O7 P	STRUCTURE OF A TWO-G-TETRAD BASKET-TYPE INTRAMOLECULAR G- QUADRUPLEX FORMED BY HUMAN TELOMERIC REPEATS IN K+ SOLUTION (WITH G7-TO-BRG SUBSTITUTION) HUMAN TELOMERE DNA DNA ANTICANCER TARGETS, HUMAN TELOMERE, INTRAMOLECULAR G- QUADRUPLEXES, DNA
2mbj	nuc      NMR    	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C10 H13 BR N5 O7 P	STRUCTURE OF AN ANTIPARALLEL (2+2) G-QUADRUPLEX FORMED BY HU TELOMERIC REPEATS IN NA+ SOLUTION (WITH G22-TO-BRG SUBSTITU DNA_(27-MER) DNA ANTICANCER TARGETS, G-QUADRUPLEX, HUMAN TELOMERE, DNA
2n2d	nuc      NMR    	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE C10 H13 BR N5 O7 P	STRUCTURE OF DNA G-QUADRUPLEX ADOPTED BY ALS AND FTD RELATED REPEAT WITH G21 TO BR-G21 SUBSTITUTION DNA (5'- D(*GP*GP*GP*GP*CP*CP*GP*GP*GP*GP*CP*CP*GP*GP*GP*GP*CP*CP*GP P*G)-3') DNA DNA, G-QUADRUPLEX, ANTIPARALLEL
4xsn	nuc      1.45	8-BROMO-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C10 H13 BR N5 O7 P)	COPPER(II) BOUND TO THE Z-DNA FORM OF D(CGCGCG) DNA (5'-D(*CP*(BGM)P*CP*GP*CP*GP)-3') DNA Z-DNA, COPPER(II), DNA

BGR    [[(2R,3S,5R)-5-(2-AZANYL-6-OXO-1H-PURIN-9-YL)-3- HYDROXY-OXOLAN-2-YL]METHOXY-HYDROXY- PHOSPHORYL]BORANUIDE

Code	Class Resolution	Description
2lar	nuc      NMR    	[[(2R,3S,5R)-5-(2-AZANYL-6-OXO-1H-PURIN-9-YL)-3- HYDROXY-OXOLAN-2-YL]METHOXY-HYDROXY- PHOSPHORYL]BORANUIDE C10 H16 B N5 O6 P 1-	DNA / RNA HYBRID CONTAINING A CENTRAL STEREO SPECIFIC RP BOR PHOSPHATE LINKAGE DNA_(5'-D(*AP*TP*GP*GP*TP*BGR*CP*TP*C)-3')_, RNA_(5'-R(*GP*AP*GP*CP*AP*CP*CP*AP*U)-3')_ DNA/RNA NUCLEIC ACID HETERODUPLEX, RNASE H1 ACTIVITY, DNA-RNA COMPLE
2lb4	nuc      NMR    	[[(2R,3S,5R)-5-(2-AZANYL-6-OXO-1H-PURIN-9-YL)-3- HYDROXY-OXOLAN-2-YL]METHOXY-HYDROXY- PHOSPHORYL]BORANUIDE C10 H16 B N5 O6 P 1-	DNA / RNA HYBRID CONTAINING A CENTRAL STEREO SPECIFIC SP BOR PHOSPHATE LINKAGE RNA_(5'-R(*GP*AP*GP*CP*AP*CP*CP*AP*U)-3')_, DNA_(5'-D(*AP*TP*GP*GP*TP*BGR*CP*TP*C)-3')_ DNA/RNA NUCLEIC ACID HETERODUPLEX, RNASE H1 ACTIVITY, DNA-RNA COMPLE

BIZ    BIZELESIN

Code	Class Resolution	Description
226d	nuc      NMR    	BIZELESIN C43 H38 N8 O5	SOLUTION CONFORMATION OF A BIZELESIN A-TRACT DUPLEX ADDUCT, NMR, 1 STRUCTURE DNA (5'-D(*CP*GP*TP*TP*TP*TP*TP*AP*CP*G)-3'), DNA (5'-D(*CP*GP*TP*AP*AP*AP*AP*AP*CP*G)-3') DNA DNA, NMR, DNA-LIGAND, ADDUCT, BIZELESIN

BLB    BLEOMYCIN B2

Code	Class Resolution	Description
1g5l	nuc      NMR    	BLEOMYCIN B2 C55 H85 N20 O21 S2 1+	CO(III)-BLEOMYCIN-OOH BOUND TO AN OLIGONUCLEOTIDE CONTAINING A PHOSPHOGLYCOLATE LESION 5'-D(*CP*CP*CP*AP*GP*TP*AP*CP*TP*TP*TP*GP*G)-3', 5'-D(P*AP*CP*TP*GP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*G)-3' DNA DAMAGED DNA, DNA-DRUG COMPLEX, INTERCALATION
1gj2	nuc      NMR    	BLEOMYCIN B2 C55 H85 N20 O21 S2 1+	CO(III)-BLEOMYCIN-OOH BOUND TO AN OLIGONUCLEOTIDE CONTAINING A PHOSPHOGLYCOLATE LESION 5'-D(*CP*CP*CP*AP*GP*TP*AP*CP*TP*TP*TP*GP*G)-3', 5'-D(P*AP*CP*TP*GP*GP*G)-3', 5'-D(*CP*CP*AP*AP*AP*G)-3' DNA DAMAGED DNA, DNA-DRUG COMPLEX, INTERCALATION

BLM    BLEOMYCIN A2

Code	Class Resolution	Description
1mtg	nuc      NMR    	BLEOMYCIN A2 C55 H85 N17 O21 S3	NMR STRUCTURE OF HO2-CO(III)BLEOMYCIN A(2) BOUND TO D(GAGCTC 5'-D(*GP*AP*GP*CP*TP*C)-3' DNA DRUG-DNA COMPLEX, COBALT(III), DNA
1mxk	nuc      NMR    	BLEOMYCIN A2 C55 H85 N17 O21 S3	NMR STRUCTURE OF HO2-CO(III)BLEOMYCIN A(2) BOUND TO D(GGAAGCTTCC)(2) 5'-D(*GP*GP*AP*AP*GP*CP*TP*TP*CP*C)-3' DNA DRUG-DNA COMPLEX, COBALT(III)

BMO    N-ACRIDIN-9-YL-N'-[3-(ACRIDIN-9-YLAMINO) PROPYL]PROPANE-1,3-DIAMINE

Code	Class Resolution	Description
2gjb	nuc      2.20	N-ACRIDIN-9-YL-N'-[3-(ACRIDIN-9-YLAMINO) PROPYL]PROPANE-1,3-DIAMINE C32 H31 N5	CROSSLINKING OF DNA DUPLEXES: X-RAY CRYSTAL STRUCTURE OF AN UNSUBSTITUTED BISACRIDINE WITH THE OLIGONUCLEOTIDE D(CGTACG) 5'-D(*CP*GP*TP*AP*CP*GP*)-3' DNA DNA DUPLEX, BIS-INTERCALATOR

BNR    BIS-DAUNORUBICIN

Code	Class Resolution	Description
1amd	nuc      NMR    	BIS-DAUNORUBICIN C62 H66 N2 O20 2+	NMR STUDY OF DNA (5'-D(*TP*GP*TP*AP*CP*A)-3') SELF- COMPLEMENTARY DUPLEX COMPLEXED WITH A BIS-DAUNORUBICIN WP- 652, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*TP*GP*TP*AP*CP*A)-3') DNA COMPLEX (DEOXYRIBONUCLEIC ACID/DRUG), BIS-INTERCALATOR, DAUNORUBICIN, DNA, DEOXYRIBONUCLEIC ACID

BOE    2'-O-[2-(BENZYLOXY)ETHYL] THYMIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1ybc	nuc      1.80	2'-O-[2-(BENZYLOXY)ETHYL] THYMIDINE-5'-MONOPHOSPHATE 2(C19 H25 N2 O10 P)	CRYSTAL STRUCTURE OF THE A-DNA GCGTAT*CGC WITH A 2'-O-[2- (BENZYLOXY)ETHYL] THYMIDINE (T*) 5'-D(*GP*CP*GP*TP*AP*(BOE)P*AP*CP*GP*C)-3') DNA CRYSTAL STRUCTURE, A-DNA, O2'-MODIFICATION, DECAMER

BPA    7S,8R,9R-TRIHYDROXY-7,8,9,10-TETRAHYDRO BENZO[A]PYRENE

Code	Class Resolution	Description
1jdg	nuc      NMR    	7S,8R,9R-TRIHYDROXY-7,8,9,10-TETRAHYDRO BENZO[A]PYRENE C20 H16 O3	SOLUTION STRUCTURE OF A TRANS-OPENED (10S)-DA ADDUCT OF (+)- (7S,8R,9S,10R)-7,8-DIHYDROXY-9,10-EPOXY-7,8,9,10- TETRAHYDROBENZO[A]PYRENE IN A FULLY COMPLEMENTARY DNA DUPLEX 5'-D(*CP*CP*TP*CP*GP*TP*GP*AP*CP*CP*G)-3', 5'-D(*CP*GP*GP*TP*CP*(BPA)AP*CP*GP*AP*GP*G)-3' DNA SYN GLYCOSIDIC TORSION ANGLE, BENZO[A]PYRENE DIOL EPOXIDE, DA ADDUCT, DNA

BPF    N,N'-(FURAN-2,5-DIYLBIS{BENZENE-4,1-DIYL[(Z)- AMINOMETHYLYLIDENE]})DIETHANAMINIUM

Code	Class Resolution	Description
360d	nuc      1.85	N,N'-(FURAN-2,5-DIYLBIS{BENZENE-4,1-DIYL[(Z)- AMINOMETHYLYLIDENE]})DIETHANAMINIUM C22 H26 N4 O 2+	STRUCTURE OF 2,5-BIS{[4-(N-ETHYLAMIDINO)PHENYL]}FURAN COMPLE D(CPGPCPGPAPAPTPTPCPGPCPG)-3'. A MINOR GROOVE DRUG COMPLEX, PATTERNS OF GROOVE HYDRATION DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' CHAIN: A, B DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DNA

BPI    (1S)-1,2,3,4-TETRAHYDRO-BENZO[C]PHENANTHRENE-2,3,4- TRIOL

Code	Class Resolution	Description
1hwv	nuc      NMR    	(1S)-1,2,3,4-TETRAHYDRO-BENZO[C]PHENANTHRENE-2,3,4- TRIOL C18 H16 O3	MOLECULAR TOPOLOGY OF POLYCYCLIC AROMATIC CARCINOGENS DETERMINES DNA ADDUCT CONFORMATION: A LINK TO TUMORIGENIC ACTIVITY 5'-D(*CP*CP*AP*TP*CP*GP*CP*TP*AP*CP*C)-3', 5'-D(*GP*GP*TP*AP*GP*CP*GP*AP*TP*GP*G)-3' DNA CARCINOGEN-DNA ADDUCT, BENZO[C]PHENANTHRENE DNA ADDUCT

BPJ    (1R)-1,2,3,4-TETRAHYDRO-BENZO[C]PHENANTHRENE-2,3,4- TRIOL

Code	Class Resolution	Description
1hx4	nuc      NMR    	(1R)-1,2,3,4-TETRAHYDRO-BENZO[C]PHENANTHRENE-2,3,4- TRIOL C18 H16 O3	MOLECULAR TOPOLOGY OF POLYCYCLIC AROMATIC CARCINOGENS DETERMINES DNA ADDUCT CONFORMATION: A LINK TO TUMORIGENIC ACTIVITY 5'-D(*CP*CP*AP*TP*CP*GP*CP*TP*AP*CP*C)-3', 5'-D(*GP*GP*TP*AP*GP*CP*GP*AP*TP*GP*G)-3' DNA 1R-TRANS-ANTI-BPH-N2-G ADDUCT, CARCINOGEN-DNA ADDUCT, BENZO[C]PHENANTHRENE DNA ADDUCT
2rou	nuc      NMR    	(1R)-1,2,3,4-TETRAHYDRO-BENZO[C]PHENANTHRENE-2,3,4- TRIOL C18 H16 O3	STEREOSPECIFIC CONFORMATIONS OF N2-DG 1R-TRANS-ANTI- BENZO[C]PHENANTHRENE DNA ADDUCTS: 3'-INTERCALATION OF THE 1R ADDUCT AND 5'-MINOR GROOVE ORIENTATION OF THE 1S ADDUCT IN AN ITERATED (CG)3 REPEAT DNA (5'- D(*DCP*DAP*DTP*DGP*DCP*DCP*DGP*DCP*DGP*DCP*DGP*DAP*DT)-3'), DNA (5'- D(*DAP*DTP*DCP*DGP*DCP*DGP*DCP*DGP*DGP*DCP*DAP*DTP*DG)-3') DNA N2-DG 1R-TRANS-ANTI-BENZO[C]PHENANTHRENE, DNA

BPT    BIS(TRANS-PLATINUM ETHYLENEDIAMINE DIAMINE CHLORO) COMPLEX

Code	Class Resolution	Description
1au6	nuc      NMR    	BIS(TRANS-PLATINUM ETHYLENEDIAMINE DIAMINE CHLORO) COMPLEX C4 H24 CL2 N6 PT2	SOLUTION STRUCTURE OF DNA D(CATGCATG) INTERSTRAND- CROSSLINKED BY BISPLATIN COMPOUND (1,1/T,T), NMR, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*CP*AP*TP*GP*CP*AP*TP*G)-3') DNA BISPLATINUM COMPOUND (1,1/T,T), DNA, INTERSTRAND CROSSLINK, DUMBBELL STRUCTURE, DEOXYRIBONUCLEIC ACID

BR    BROMIDE ION

Code	Class Resolution	Description
1eg6	nuc      2.00	BROMIDE ION 2(BR 1-)	CRYSTAL STRUCTURE ANALYSIS OF D(CG(5-BRU)ACG) COMPLEXES TO A PHENAZINE 5'-D(*CP*GP*(BRO)UP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, INTERCALATION, MAJOR GROOVE BINDING, DOUBLE HELIX
1mhk	nuc      2.50	BROMIDE ION BR 1-	CRYSTAL STRUCTURE ANALYSIS OF A 26MER RNA MOLECULE, REPRESENTING A NEW RNA MOTIF, THE HOOK-TURN RNA 12-MER BCH12: FRAGMENT OF 5S RRNA LOOP E, RNA 14-MER BCH12: FRAGMENT OF 5S RRNA LOOP E RNA HELIX, 180 DEGREE TURN, RNA
367d	nuc      1.20	BROMIDE ION 2(BR 1-)	1.2 A STRUCTURE DETERMINATION OF THE D(CG(5-BRU)ACG)2/5- BROMO-9-AMINO-DACA COMPLEX 5'-D(*CP*GP*(BRU)P*AP*CP*G)-3' DNA DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
3ivn	nuc      2.80	BROMIDE ION 2(BR 1-)	STRUCTURE OF THE U65C MUTANT A-RIBOSWITCH APTAMER FROM THE B SUBTILIS PBUE OPERON A-RIBOSWITCH RNA APTAMER, RNA, A-RIBOSWITCH
3r1d	nuc      1.45	BROMIDE ION 2(BR 1-)	CRYSTAL STRUCTURE OF GC(8BRG)GCGGCGGC DUPLEX RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*GP*GP*C)-3 CHAIN: A, B, C, D, E RNA CGG REPEATS, FRAGILE X MENTAL RETARDATION, 8-BROMOGUANOSINE,
3r1e	nuc      0.97	BROMIDE ION 2(BR 1-)	CRYSTAL STRUCTURE OF GC(8BRG)GCGGC DUPLEX RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3') RNA CGG REPEATS, FRAGILE X MENTAL RETARDATION, 8-BROMOGUANOSINE,

BRA    9-[4-(N,N-DIMETHYLAMINO)PHENYLAMINO]-3,6-BIS(3- PYRROLIDINOPROPIONAMIDO) ACRIDINE

Code	Class Resolution	Description
3ce5	nuc      2.50	9-[4-(N,N-DIMETHYLAMINO)PHENYLAMINO]-3,6-BIS(3- PYRROLIDINOPROPIONAMIDO) ACRIDINE C35 H43 N7 O2	A BIMOLECULAR PARALLEL-STRANDED HUMAN TELOMERIC QUADRUPLEX IN COMPLEX WITH A 3,6,9-TRISUBSTITUTED ACRIDINE MOLECULE BRACO19 DNA (5'- D(*DTP*DAP*DGP*DGP*DGP*DTP*DTP*DAP*DGP*DGP*DGP*DT)-3') DNA BIMOLECULAR, PARALLEL, HUMAN, TELOMERE, QUADRUPLEX, COMPLEX, TRISUBSTITUTED, ACRIDINE, BRACO19, DNA

BRN    BERENIL

Code	Class Resolution	Description
1d63	nuc      2.00	BERENIL C14 H15 N7	CRYSTAL STRUCTURE OF A BERENIL-D(CGCAAATTTGCG) COMPLEX; AN EXAMPLE OF DRUG-DNA RECOGNITION BASED ON SEQUENCE- DEPENDENT STRUCTURAL FEATURES DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*G)- 3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
268d	nuc      2.02	BERENIL C14 H15 N7	STRUCTURAL STUDIES ON NUCLEIC ACIDS DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA B-DNA, DOUBLE HELIX, MODIFIED, COMPLEXED WITH DRUG, DNA
2dbe	nuc      2.50	BERENIL C14 H15 N7	CRYSTAL STRUCTURE OF A BERENIL-DODECANUCLEOTIDE COMPLEX: THE ROLE OF WATER IN SEQUENCE-SPECIFIC LIGAND BINDING DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
2gvr	nuc      1.65	BERENIL C14 H15 N7	CRYSTAL STRUCTURE OF THE BERENIL-D(CGCGAATTCGCG)2 COMPLEX AT 1.65 A RESOLUTION. 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA NUCLEIC ACIDS, DNA, DOUBLE HELIX, MINOR GROOVE, CRYSTAL STRUCTURE OF B-DNA, DNA MINOR GROOVE BINDER, DICKERSON AND DREW DODECAMER, D(CGCGAATTCGCG)2, A2T2, DNA MINOR GROOVE- LIGAND COMPLEX, DNA-DRUG COMPLEX, DNA HYDRATION, BERENIL AND DNA, BERENIL-DNA COMPLEX, MAGNESIUM-WATER COMPLEX, HYDRATED MAGNESIUM COMPLEX.

BRU    5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
115d	nuc      1.70	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O8 P)	ORDERED WATER STRUCTURE IN AN A-DNA OCTAMER AT 1.7 ANGSTROMS RESOLUTION DNA (5'-D(*GP*GP*(BRU)P*AP*(BRU)P*AP*CP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
165d	nuc      1.55	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	THE STRUCTURE OF A MISPAIRED RNA DOUBLE HELIX AT 1.6 ANGSTROMS RESOLUTION AND IMPLICATIONS FOR THE PREDICTION OF RNA SECONDARY STRUCTURE DNA/RNA (5'-R(*GP*CP*UP*UP*CP*GP*GP*CP*)- D(*(BRU))-3') DNA-RNA HYBRID A-DNA/RNA, DOUBLE HELIX, OVERHANGING BASES, MODIFIED, MISMATCHED, DNA-RNA HYBRID
1aio	nuc      2.60	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF A DOUBLE-STRANDED DNA CONTAINING THE MA OF THE ANTICANCER DRUG CISPLATIN DNA (5'-D(*GP*GP*AP*GP*AP*CP*CP*AP*GP*AP*GP*G)-3' CHAIN: B, D, DNA (5'-D(*CP*CP*(BRU)P*CP*TP*[PT(NH3)2(GP*GP) ]*TP*CP*TP*CP*C)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIE
1cs7	nuc      3.20	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O8 P)	SYNTHETIC DNA HAIRPIN WITH STILBENEDIETHER LINKER 5'-D(GP*(BRU)P*TP*TP*TP*GP*(S02) *CP*AP*AP*AP*AP*C)-3' DNA DNA HAIRPIN
1d3r	nuc      1.80	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF TRIPLEX DNA DNA (5'-D(*CP*GP*CP*GP*CP*GP*GP*AP*G)-3'), DNA (5'-D(*CP*(BRU)P*CP*CP*(BRU) P*CP*CP*GP*CP*GP*CP*G)-3') DNA TRIPLEX DNA AND ITS JUNCTION WITH A DUPLEX DNA
1d9r	nuc      1.50	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF DNA SHEARED TANDEM G-A BASE PAIRS 5'-D(*CP*CP*GP*AP*AP*(BRU)P*GP*AP*GP*G)-3' DNA TANDEM GA BASE PAIRS, GA MISMATCH, DEOXYRIBONUCLEIC ACID, DNA
1da1	nuc      2.25	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	STRUCTURAL CHARACTERISATION OF THE BROMOURACIL-GUANINE BASE PAIR MISMATCH IN A Z-DNA FRAGMENT DNA (5'-D(*(BRU)P*GP*CP*GP*CP*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED, MISMATCHED
1dcr	nuc      1.60	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF DNA SHEARED TANDEM G-A BASE PAIRS 5'-D(*CP*CP*GP*AP*AP*(BRU)P*GP*AP*GP*G)-3' DNA TANDEM GA BASE PAIRS, GA MISMATCH, DEOXYRIBONUCLEIC ACID, DNA
1fn1	nuc      1.60	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF 9-AMINO-(N-(2-DIMETHYLAMINO)BUTYL) ACRIDINE-4-CARBOXAMIDE BOUND TO D(CG(5BR)UACG)2 DNA (5'-D(P*GP*(BRO)UP*AP*CP*G)-3'), DNA (5'-D(*CP*GP*(BRO)UP*AP*CP*G)-3') DNA 9-AMINOACRIDINE-4-CARBOAMIDE, HEXANUCLEOTIDE, X-RAY CRYSTALLOGRAPHY, INTERCALATION, QUADRUPLEX, DNA
1gqu	nuc      2.50	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF AN ALTERNATING A-T OLIGONUCLEOTIDE FRAGMENT WITH HOOGSTEEN BASE PAIRING DNA (5'(*AP*TP*AP*UP*AP*T)-3') DNA DNA, DNA/RNA, NEW DNA STRUCTURE, HOOGSTEEN BASE PAIRING
1iha	nuc      1.60	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	STRUCTURE OF THE HYBRID RNA/DNA R-GCUUCGGC-D[BR]U IN PRESENCE OF RH(NH3)6+++ 5'-R(*GP*CP*UP*UP*CP*GP*GP*C)-D(P*(BRU))-3' DNA/RNA RNA/DNA HYBRID, BROMO URACIL, RHODIUM(III) HEXAMMINE, C-U G- U MISMATCH, DNA/RNA COMPLEX
1j6s	nuc      1.40	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF AN RNA TETRAPLEX (UGAGGU)4 WITH A- TETRADS, G-TETRADS, U-TETRADS AND G-U OCTADS 5'-R(*(BRUP*GP*AP*GP*GP*U)-3' RNA RNA, TETRAPLEX, G-U OCTADS, A-TETRADS, U-TETRADS, G-TETRADS
1jpq	nuc      1.60	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF THE OXYTRICHA TELOMERIC DNA AT 1.6A 5'-D(*GP*GP*GP*GP*(BRU)P*TP*TP*TP*GP*GP*GP*G)-3' DNA OXYTRICHA, G-QUARTETS, DNA
1k8p	nuc      2.40	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O8 P)	STRUCTURE OF THE HUMAN G-QUADRUPLEX REVEALS A NOVEL TOPOLOGY 5'-D(*(BRU)P*AP*GP*GP*GP*(BRU) P*TP*AP*GP*GP*GP*T)-3' DNA QUADRUPLEX DNA, DOUBLE CHAIN REVERSAL LOOP, DIMERIC QUADRUPLEX, HUMAN TELOMERE SEQUENCE, G(ANTI).G(ANTI) .G(ANTI).G(ANTI), PARALLEL STRANDED
1p1y	nuc      2.10	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	CRYSTAL STRUCTURE OF A CONTINUOUS THREE-DIMENSIONAL DNA LATT D(GGACAGATGGGAG) 5'-D(*GP*GP*AP*(CBR)P*AP*GP*AP*(BRU)P*GP*GP*GP*AP CHAIN: X DNA CONTINUOUS THREE-DIMENSIONAL DNA LATTICE, PARALLEL-STRANDED PAIRS, DNA
1p54	nuc      1.90	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	EFFECT OF SEQUENCE ON THE CONFORMATIONAL GEOMETRY OF DNA HOL JUNCTIONS 5'-D(*CP*CP*AP*GP*TP*AP*CP*(BRU)P*GP*G)-3' DNA DNA HOLLIDAY JUNCTION, FOUR-WAY JUNCTION, STACKED-X JUNCTION BROMINATED URACIL, DNA
1sm5	nuc      2.00	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 4(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF A DNA DECAMER CONTAINING A THYMINE- DIMER 5'-D(*CP*GP*AP*AP*TP*TP*AP*AP*GP*C)-3', 5'-D(*GP*CP*(BRU)P*TP*AP*AP*TP*(BRU)P*CP*G)-3' DNA UV-DAMAGED DNA, THYMINE DIMER, DNA DECAMER
2avj	nuc      2.39	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 6(C9 H12 BR N2 O8 P)	G4(BR)UTTG4 DIMERIC QUADRUPLEX 5'-D(*GP*GP*GP*GP*(BRU)P*TP*TP*GP*GP*GP*G)-3' DNA QUADRUPLEX, LOOP, DNA
2dlj	nuc      1.50	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	2'-ME-SE AND BR DERIVITATION OF A-DNA OCTAMER G(UMS)G(BRU) ACAC 5'-D(*GP*(UMS)P*GP*(BRU)P*AP*CP*AP*C)-3' DNA 2'-METHYLSELENO-URIDINE, SE-DNA, SE-BR-DNA, SELENIUM DERIVATIZATION
2gpx	nuc      1.60	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	2'-ME-SE AND BR DERIVITATION OF A-DNA OCTAMER G(UMS)G(BRU) ACAC 5'-D(*GP*(UMS)P*GP*(BRU)P*AP*CP*AP*C)-3' DNA 2'-METHYLSELENO-URIDINE, SE-DNA, SE-BR-DNA, SELENIUM DERIVATIZATION
2h05	nuc      1.80	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	BR DERIVITATION OF A-DNA OCTAMER GTG(UBR)ACAC 5'-D(*GP*TP*GP*(BRU)P*AP*CP*AP*C)-3' DNA BR-DNA, SE-DNA, SE-BR-DNA
2obz	nuc      1.10	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF THE THE BROMINATED Z-DNA DUPLEX D(CGCG[BRU]G) 5'-D(*CP*GP*CP*GP*(BRU)P*G)-3' DNA BROMINATED DNA Z-DNA
2orf	nuc      1.85	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	DIRECTING MACROMOLECULAR CONFORMATION THROUGH HALOGEN BONDS DNA (5'-D(*CP*CP*GP*AP*TP*AP*CP*CP*GP*G)-3'), DNA (5'-D(*CP*CP*GP*GP*TP*AP*(BRU)P*CP*GP*G)-3') DNA DNA HOLLIDAY JUNCTION, HALOGEN BOND
2org	nuc      2.00	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	DIRECTING MACROMOLECULAR CONFORMATION THROUGH HALOGEN BONDS DNA (5'-D(*CP*CP*GP*GP*TP*AP*(BRU)P*CP*GP*G)-3'), DNA (5'-D(*CP*CP*GP*AP*TP*AP*CP*CP*GP*G)-3') DNA DNA HOLLIDAY JUNCTION, HALOGEN BOND
344d	nuc      1.46	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	DETERMINATION BY MAD-DM OF THE STRUCTURE OF THE DNA DUPLEX D(ACGTACG(5-BRU))2 AT 1.46A AND 100K DNA (5'-D(*AP*CP*GP*TP*AP*CP*GP*(BRU))-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
366d	nuc      1.30	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	1.3 A STRUCTURE DETERMINATION OF THE D(CG(5-BRU)ACG)2/6- BROMO-9-AMINO-DACA COMPLEX DNA (5'-D(*CP*GP*(BRU)P*AP*CP*G)-3') DNA DNA, DRUG INTERCALATION, MAJOR GROOVE BINDING
3gdd	nuc      2.80	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	AN INVERTED ANTHRAQUINONE-DNA CRYSTAL STRUCTURE 5'-D(*(BRU)P*AP*GP*G)-3' DNA ANTHRAQUINONE, TELOMERE DNA SEQUENCE, DRUG-DNA COMPLEX, DNA
3qsc	nuc      2.40	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE C9 H12 BR N2 O8 P	THE FIRST CRYSTAL STRUCTURE OF A HUMAN TELOMERIC G-QUADRUPLE BOUND TO A METAL-CONTAINING LIGAND (A COPPER COMPLEX) 5'-D(*AP*GP*GP*GP*TP*(BRU)P*AP*GP*GP*GP*TP*T)-3' DNA PARALLEL, TELOMERE, QUADRUPLEX, DRUG, DNA, METAL COMPLEX, CO COMPLEX
3qxr	nuc      1.62	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF THE BROMINATED CKIT-1 PROTO-ONCOGENE PR QUADRUPLEX DNA 5'-D(*AP*GP*GP*GP*AP*GP*GP*GP*CP*GP*CP*(BRU) P*GP*GP*GP*AP*GP*GP*AP*GP*GP*G)-3' DNA DNA QUADRUPLEX, REGULATION, CKIT-1, DNA
4rip	nuc      2.10	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	BROMOURACIL SUBSTITUTED STRUCTURE OF INTERCALATION-LOCKED DN TETRAPLEX DNA (5'-D(*AP*CP*(BRU)P*CP*GP*GP*AP*(BRU)P*GP*AP* CHAIN: A DNA BROMOURACIL, HOMODUPLEX, INTERCALATION-LOCKED DNA TETRAPLEX,
4xno	nuc      1.99	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF 5'-CTTATPPPZZZATAAG DNA (5'-D(*CP*TP*(BRU)P*AP*TP*(1WA)P*(1WA)P*(1WA) P*(1W5)P*(1W5)P*AP*TP*AP*AP*G)-3') DNA A-FORM DNA, NON-NATURAL NUCLEOBASE PAIR, SYNTHETIC BIOLOGY,
5mvl	nuc      1.41	5-BROMO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE 2(C9 H12 BR N2 O8 P)	CRYSTAL STRUCTURE OF AN A-DNA DODECAMER CONTAINING 5-BROMOUR BROMINATED DNA DODECAMER DNA A-DNA, 5-BROMOURACIL, CPG, DNA

BTN    BIOTIN

Code	Class Resolution	Description
1f27	nuc      1.30	BIOTIN C10 H16 N2 O3 S	CRYSTAL STRUCTURE OF A BIOTIN-BINDING RNA PSEUDOKNOT RNA (5'-R(*AP*AP*AP*AP*AP*GP*UP*CP*CP*UP*C)-3'), RNA (5'- R(*AP*CP*CP*GP*UP*CP*AP*GP*AP*GP*GP*AP*CP*AP*CP*GP*GP*UP*U) -3') RNA RNA APTAMER, PSEUDOKNOT, BIOTIN-BINDING RNA

BZA    1R,2S,3R,4S-TETRAHYDRO-BENZO[A]ANTHRACENE-2,3,4-TRIOL

Code	Class Resolution	Description
1dl4	nuc      NMR    	1R,2S,3R,4S-TETRAHYDRO-BENZO[A]ANTHRACENE-2,3,4-TRIOL C18 H16 O3	THE SOLUTION STRUCTURE OF A BAY-REGION 1S-BENZ[A]ANTHRACENE OXIDE ADDUCT AT THE N6 POSITION OF ADENINE OF AN OLIGODEOXYNUCLEOTIDE CONTAINING THE HUMAN N-RAS CODON 61 SEQUENCE DNA (5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP*G)-3'), DNA (5'-D(*CP*GP*GP*AP*CP*(BZA)AP*AP*GP*AP*AP*G)- 3') DNA BENZ[A]ANTHRACENE-DNA DUPLEX
1i7v	nuc      NMR    	1R,2S,3R,4S-TETRAHYDRO-BENZO[A]ANTHRACENE-2,3,4-TRIOL C18 H16 O3	THE SOLUTION STRUCTURE OF A BAY REGION 1R-BENZ[A]ANTHRACENE OXIDE ADDUCT AT THE N6 POSITION OF ADENINE OF AN OLIGODEOXYNUCLEOTIDE CONTAINING THE HUMAN N-RAS CODON 61 SEQUENCE 5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP*G)-3', 5'-D(*CP*GP*GP*AP*CP*AP*(BZA)AP*GP*AP*AP*G)-3' DNA BENZ[A]ANTHRACENE-DNA DUPLEX
1qby	nuc      NMR    	1R,2S,3R,4S-TETRAHYDRO-BENZO[A]ANTHRACENE-2,3,4-TRIOL C18 H16 O3	THE SOLUTION STRUCTURE OF A BAY-REGION 1R-BENZ[A]ANTHRACENE OXIDE ADDUCT AT THE N6 POSITION OF ADENINE OF AN OLIGODEOXYNUCLEOTIDE CONTAINING THE HUMAN N-RAS CODON 61 SEQUENCE 5'-D(*CP*GP*GP*AP*CP*(BZA)AP*AP*GP*AP*AP*G)-3', 5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP* G)-3' DNA BENZ[A]ANTHRACENE-DNA DUPLEX, INTERCALATION

BZG    6-(BENZYLOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-9H-PURIN-2-AMINE

Code	Class Resolution	Description
4hqi	nuc      1.70	6-(BENZYLOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-9H-PURIN-2-AMINE 2(C17 H20 N5 O7 P)	STRUCTURE OF O6-BENZYL-2'-DEOXYGUANOSINE OPPOSITE PERIMIDINO SYNTHETIC NUCLEOSIDE IN DNA DUPLEX SHORT MODIFIED NUCLEIC ACIDS DNA B-FORM DNA, O6-BENZYL-2'-DEOXYGUANOSINE, DPER, PERIMIDINONE- NUCLEOSIDE, DICKERSON-DREW DODECAMER, DNA

BZR    1S,2R,3S,4R-TETRAHYDRO-BENZO[A]ANTHRACENE-2,3,4-TRIOL

Code	Class Resolution	Description
1mxj	nuc      NMR    	1S,2R,3S,4R-TETRAHYDRO-BENZO[A]ANTHRACENE-2,3,4-TRIOL C18 H16 O3	NMR SOLUTION STRUCTURE OF BENZ[A]ANTHRACENE-DG IN RAS CODON 12,2; GGCAGXTGGTG 5'-D(*CP*AP*CP*CP*AP*CP*CP*TP*GP*CP*C)-3', 5'-D(*GP*GP*CP*AP*GP*GP*TP*GP*GP*TP*G)-3' DNA DNA ADDUCT, B-LIKE DNA

C2E    9,9'-[(2R,3R,3AS,5S,7AR,9R,10R,10AS,12S,14AR)-3,5,10, 12-TETRAHYDROXY-5,12-DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3, 2-D:3',2'-J][1,3,7,9,2, 8]TETRAOXADIPHOSPHACYCLODODECINE-2,9-DIYL]BIS(2-AMINO- 1,9-DIHYDRO-6H-PURIN-6-ONE)

Code	Class Resolution	Description
3q3z	nuc      2.51	9,9'-[(2R,3R,3AS,5S,7AR,9R,10R,10AS,12S,14AR)-3,5,10, 12-TETRAHYDROXY-5,12-DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3, 2-D:3',2'-J][1,3,7,9,2, 8]TETRAOXADIPHOSPHACYCLODODECINE-2,9-DIYL]BIS(2-AMINO- 1,9-DIHYDRO-6H-PURIN-6-ONE) 4(C20 H24 N10 O14 P2)	STRUCTURE OF A C-DI-GMP-II RIBOSWITCH FROM C. ACETOBUTYLICUM C-DI-GMP C-DI-GMP-II RIBOSWITCH RNA RIBOSWITCH, C-DI-GMP, RNA
4yb0	nuc      2.12	9,9'-[(2R,3R,3AS,5S,7AR,9R,10R,10AS,12S,14AR)-3,5,10, 12-TETRAHYDROXY-5,12-DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3, 2-D:3',2'-J][1,3,7,9,2, 8]TETRAOXADIPHOSPHACYCLODODECINE-2,9-DIYL]BIS(2-AMINO- 1,9-DIHYDRO-6H-PURIN-6-ONE) 2(C20 H24 N10 O14 P2)	3',3'-CGAMP RIBOSWITCH BOUND WITH C-DI-GMP RNA (84-MER) RNA RIBOSWITCH, 3', 3'-CGAMP, SPINACH, RNA STRUCTURE, C-DI-GMP,

C2L    5-METHYL-3'-O-METHOXYETHYL CYTIDINE 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1xv6	nuc      NMR    	5-METHYL-3'-O-METHOXYETHYL CYTIDINE 5'-MONOPHOSPHATE 4(C13 H22 N3 O9 P)	THE SOLUTION STRUCTURE OF 2',5'-LINKED 3'-O-(2- METHOXYETHYL)-RNA HAIRPIN 5'-R(*(C2L)P*(G2L)P*(C2L)P*(G2L)P*(A2L)P*(A2L) P*(U2L)P*(U2L)P*(C2L)P*(G2L)P*(C2L)P*(G2L))-2' RNA HAIRPIN, (2',5')-RNA, 3'-O-(2-METHOXYETHYL) RIBOSE

C2S    CYTIDINE-5'-DITHIOPHOSPHORATE

Code	Class Resolution	Description
1k8l	nuc      NMR    	CYTIDINE-5'-DITHIOPHOSPHORATE 3(C9 H14 N3 O5 P S2)	XBY6: AN ANALOG OF CK14 CONTAINING 6 DITHIOPHOSPHATE GROUPS FIRST STRAND OF CK14 DNA DUPLEX: DITHIOATED AT T10, C11, SECOND STRAND OF CK14 DNA DUPLEX: DITHIOATED AT G17, C22, C24, G27 DNA XBY6, CK14, CK1, PHOSPHORODITHIOATE, NF-KB, DNA
1k8n	nuc      NMR    	CYTIDINE-5'-DITHIOPHOSPHORATE 2(C9 H14 N3 O5 P S2)	NMR STRUCTURE OF THE XBY2 DNA DUPLEX, AN ANALOG OF CK14 CONTAINING PHOSPHORODITHIOATE GROUPS AT C22 AND C24 FIRST STRAND OF CK14 DNA DUPLEX, SECOND STRAND OF CK14 DNA DUPLEX: DITHIOATED AT C22 AND C24 DNA PHOSPHORODITHIOATE, CK14, CK1, NF-KB, XBY6, XBY2, THIOPHOSPHATE, DNA

C34    N4-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
133d	nuc      1.80	N4-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O7 P)	THE CRYSTAL STRUCTURE OF N4-METHYLCYTOSINE.GUANOSIN BASE- PAIRS IN THE SYNTHETIC HEXANUCLEOTIDE D(CGCGM(4)CG) DNA (5'-D(*CP*GP*CP*GP*(C34)P*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
2oks	nuc      1.65	N4-METHYL-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C10 H16 N3 O7 P	X-RAY STRUCTURE OF A DNA REPAIR SUBSTRATE CONTAINING AN ALKY INTERSTRAND CROSSLINK AT 1.65 RESOLUTION 5'-D(*CP*CP*AP*AP*(C34)P*GP*TP*TP*GP*G)-3' DNA INTERSTRAND CROSSLINK, DNA, DNA DAMAGE

C38    5-IODO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1ana	nuc      2.00	5-IODO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 I N3 O7 P)	HELIX GEOMETRY AND HYDRATION IN AN A-DNA TETRAMER. IC-C-G-G DNA (5'-D(*(C38)P*CP*GP*G)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED, DNA
1ue2	nuc      1.40	5-IODO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 I N3 O7 P	CRYSTAL STRUCTURE OF D(GC38GAAAGCT) 5'-D(*GP*(C38)P*GP*AP*AP*AP*GP*CP*T)-3' DNA DNA, BASE-INTERCALATED DUPLEX, MINI-HAIRPIN STRUCTURE, SHEAR PAIR, ZIPPER-LIKE DUPLEX
1v3o	nuc      1.70	5-IODO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 I N3 O7 P)	CRYSTAL STRUCTURE OF D(GCGAGAGC): THE DNA QUADRUPLEX STRUCTU FROM THE OCTAPLEX 5'-D(*GP*(C38)P*GP*AP*GP*AP*GP*C)-3' DNA OCTAPLEX, QUADRUPLEX, G-DUET, BASE-INTERCALATED DUPLEX, BASE INTERCALATED MOTIF, SHEARED G:A PAIR, DNA, DEOXYRIBONUCLEIC RAY ANALYSIS
1v3p	nuc      2.30	5-IODO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 I N3 O7 P)	CRYSTAL STRUCTURE OF D(GCGAGAGC): THE DNA OCTAPLEX STRUCTURE WITH I-MOTIF OF G-QUARTET 5'-D(*GP*(C38)P*GP*AP*GP*AP*GP*C)-3' DNA OCTAPLEX, QUADRUPLEX, G-QUARTET, I-MOTIF, I-MOTIF OF G- QUARTET, BASE-INTERCALATED DUPLEX, BASE-INTERCALATED MOTIF, SHEARED G:A PAIR, DNA, DEOXYRIBONUCLEIC ACID, X-RAY ANALYSIS, CRYSTAL STRUCTURE
3i5l	nuc      1.18	5-IODO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 I N3 O7 P)	ALLOSTERIC MODULATION OF DNA BY SMALL MOLECULES 5'-D(*CP*CP*AP*GP*GP*(C38)P*CP*TP*GP*G)-3' DNA CYCLIC POLYAMIDE, DNA BINDER, MINOR GROOVE BINDER, PYIM POLYAMIDE
3omj	nuc      0.95	5-IODO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 I N3 O7 P)	STRUCTURAL BASIS FOR CYCLIC PY-IM POLYAMIDE ALLOSTERIC INHIB NUCLEAR RECEPTOR BINDING 5'-D(*CP*(C38)P*AP*GP*TP*AP*CP*TP*GP*G)-3' DNA CYCLIC PY-IM POLYAMIDE, DNA

C42    3'-AMINO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
363d	nuc      2.00	3'-AMINO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 24(C9 H15 N4 O6 P)	HIGH-RESOLUTION CRYSTAL STRUCTURE OF A FULLY MODIFIED N3'-> PHOSPHORAMIDATE DNA DODECAMER DUPLEX 5'-D(*(C42)P*(G38)P*(C42)P*(G38)P*(A43)P*(A43)P*( P*(NYM)P*(C42)P*(G38)P*(C42)P*DG)-3' DNA A-DNA, MODIFIED, DNA

C43    2'-O-METHYOXYETHYL-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
468d	nuc      1.80	2'-O-METHYOXYETHYL-CYTIDINE-5'-MONOPHOSPHATE 8(C12 H20 N3 O9 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA
469d	nuc      1.70	2'-O-METHYOXYETHYL-CYTIDINE-5'-MONOPHOSPHATE 8(C12 H20 N3 O9 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RNA
470d	nuc      1.95	2'-O-METHYOXYETHYL-CYTIDINE-5'-MONOPHOSPHATE 8(C12 H20 N3 O9 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA
471d	nuc      2.70	2'-O-METHYOXYETHYL-CYTIDINE-5'-MONOPHOSPHATE 8(C12 H20 N3 O9 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA

C45    N4-METHOXY-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1da2	nuc      1.70	N4-METHOXY-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	MOLECULAR AND CRYSTAL STRUCTURE OF D(CGCGMO4CG): N4- METHOXYCYTOSINE/GUANINE BASE-PAIRS IN Z-DNA DNA (5'-D(*CP*GP*CP*GP*(C45)P*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1i3t	nuc      1.60	N4-METHOXY-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	MOLECULAR AND CRYSTAL STRUCTURE OF D(CGCGAATT(MO4)CGCG): THE WATSON-CRICK TYPE AND WOBBLE N4- METHOXYCYTIDINE/GUANOSINE BASE PAIRS IN B-DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(C45)P*GP*CP*GP)- 3' DNA N4-METHOXYCYTOSINE, DAMAGED DNA, B-DNA, DOUBLE HELIX, DEOXYRIBONUCLEIC ACID
1i47	nuc      2.10	N4-METHOXY-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	MOLECULAR AND CRYSTAL STRUCTURE OF D(CGCGAATT(MO4)CGCG): THE WATSON-CRICK TYPE AND WOBBLE N4- METHOXYCYTIDINE/GUANOSINE BASE PAIRS IN B-DNA 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(C45)P*GP*CP*GP)- 3' DNA N4-METHOXYCYTOSINE, DAMAGED DNA, B-DNA, DOUBLE HELIX, DEOXYRIBONUCLEIC ACID
1j8l	nuc      1.60	N4-METHOXY-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C10 H16 N3 O8 P)	MOLECULAR AND CRYSTAL STRUCTURE OF D(CGCAAATTMO4CGCG): THE WATSON-CRICK TYPE N4-METHOXYCYTIDINE/ADENOSINE BASE PAIR IN B-DNA DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*(C45) P*GP*CP*G)-3') DNA N4-METHOXYCYTOSINE, DNA DAMAGE, B-DNA, DOUBLE HELIX, DEOXYRIBONUCLEIC ACID

C46    6H,8H-3,4-DIHYDROPYRIMIDO[4,5-C][1,2]OXAZIN-7- 0NE(CYTIDINE)-5'-MONOPHOSPHATE

Code	Class Resolution	Description
223d	nuc      1.70	6H,8H-3,4-DIHYDROPYRIMIDO[4,5-C][1,2]OXAZIN-7- 0NE(CYTIDINE)-5'-MONOPHOSPHATE 2(C11 H16 N3 O8 P)	DIRECT OBSERVATION OF TWO BASE-PAIRING MODES OF A CYTOSINE- THYMINE ANALOGUE WITH GUANINE IN A DNA Z-FORM DUPLEX: SIGNIFICANCE FOR BASE ANALOGUE MUTAGENESIS DNA (5'-D(*CP*GP*CP*GP*(C46)P*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
417d	nuc      1.50	6H,8H-3,4-DIHYDROPYRIMIDO[4,5-C][1,2]OXAZIN-7- 0NE(CYTIDINE)-5'-MONOPHOSPHATE 2(C11 H16 N3 O8 P)	A THYMINE-LIKE BASE ANALOGUE FORMS WOBBLE PAIRS WITH ADENINE DNA (5'-D(*CP*AP*CP*GP*(C46)P*G)-3') DNA P.A BASE-PAIRS, PYRIMIDINE ANALOGUE, Z-DNA

C4Q    4-(1,4,7,10-TETRAAZACYCLODODECAN-1-YLMETHYL)QUINOLINE

Code	Class Resolution	Description
2loa	nuc      NMR    	4-(1,4,7,10-TETRAAZACYCLODODECAN-1-YLMETHYL)QUINOLINE C18 H27 N5	STRUCTURAL BASIS FOR BIFUNCTIONAL ZN(II) MACROCYCLIC COMPLEX RECOGNITION OF THYMINE BULGES IN DNA DNA (5'-D(*GP*CP*CP*GP*CP*AP*GP*TP*GP*C)-3') DNA THYMINE BULGE, BIFUNCTIONAL ZN(II) MACROCYCLIC COMPLEX, DNA,

C4S    2'-DEOXY-4'-THIOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2rmq	nuc      NMR    	2'-DEOXY-4'-THIOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 8(C9 H14 N3 O6 P S)	SOLUTION STRUCTURE OF FULLY MODIFIED 4'-THIODNA WITH THE SEQUENCE OF D(CGCGAATTCGCG) DNA (5'-D(*(C4S)P*(S4G)P*(C4S)P*(S4G)P*(S4A) P*(S4A)P*(T49)P*(T49)P*(C4S)P*(S4G)P*(C4S)P*(S4G))-3') DNA 4'-THIODNA, A-FORM

C5L    2'-O-(2-METHOXYETHYL)-5-METHYLCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2m39	nuc      NMR    	2'-O-(2-METHOXYETHYL)-5-METHYLCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 8(C13 H22 N3 O9 P)	THE SOLUTION STRUCTURE OF 3',5'-LINKED 2'-O-(2-METHOXYETHYL) DUPLEX RNA (5'-R(*(C5L)P*(G48)P*(C5L)P*(G48)P*(A44)P*(A4 P*(T39)P*(C5L)P*(G48)P*(C5L)P*DG)-3') RNA DUPLEX, (3',5')-RNA, 2'-O-(2-METHOXYETHYL) RIBOSE, RNA

C5P    CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1me0	nuc      NMR    	CYTIDINE-5'-MONOPHOSPHATE C9 H14 N3 O8 P	CHIMERIC HAIRPIN WITH 2',5'-LINKED RNA LOOP AND DNA STEM DNA/RNA (5'-D(*GP*GP*AP*C)-R(P*(U25)P*(U25)P*(C25 D(P*GP*TP*CP*C)-3') DNA, RNA HAIRPIN, (2',5')-RNA, DNA, RNA
1me1	nuc      NMR    	CYTIDINE-5'-MONOPHOSPHATE C9 H14 N3 O8 P	CHIMERIC HAIRPIN WITH 2',5'-LINKED RNA LOOP AND RNA STEM 5'-R(*GP*GP*AP*CP*(U25)P*(U25)P*(C25)P*(5GP)P*GP* 3' RNA HAIRPIN, (2',5')-RNA, RNA

C66    2-AMINOETHYLLYSINE-CARBONYLMETHYLENE-CYTOSINE

Code	Class Resolution	Description
1nr8	nuc      1.66	2-AMINOETHYLLYSINE-CARBONYLMETHYLENE-CYTOSINE C14 H24 N6 O4	THE CRYSTAL STRUCTURE OF A D-LYSINE-BASED CHIRAL PNA-DNA DUP 5'-D(P*AP*GP*TP*GP*AP*TP*CP*TP*AP*C)-3', H-((GPN)*(TPN)*(APN)*(GPN)*(A66)*(T66)*(C66)*(APN *(TPN))-NH2 DNA/PEPTIDE NUCLEIC ACID CHIRAL PEPTIDE NUCLEIC ACID, DOUBLE STRANDED HELIX, P-FORM, PEPTIDE NUCLEIC ACID COMPLEX

C6G    6-(CARBOXYMETHOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D- ERYTHRO-PENTOFURANOSYL)-9H-PURIN-2-AMINE

Code	Class Resolution	Description
4ij0	nuc      1.54	6-(CARBOXYMETHOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D- ERYTHRO-PENTOFURANOSYL)-9H-PURIN-2-AMINE 2(C12 H16 N5 O9 P)	STRUCTURES OF DNA DUPLEXES CONTAINING O6-CARBOXYMETHYLGUANIN LESION ASSOCIATED WITH GASTROINTESTINAL CANCER, REVEAL A ME FOR INDUCING TRANSITION MUTATION DNA (5'-D(*CP*GP*CP*(C6G)P*AP*AP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA DAMAGED DNA, O6-CARBOXYMETHYLGUANINE, MUTAGENESIS, DNA
4itd	nuc      1.94	6-(CARBOXYMETHOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D- ERYTHRO-PENTOFURANOSYL)-9H-PURIN-2-AMINE 2(C12 H16 N5 O9 P)	STRUCTURES OF DNA DUPLEXES CONTAINING O6-CARBOXYMETHYLGUANIN LESION ASSOCIATED WITH GASTROINTESTINAL CANCER, REVEAL A ME FOR INDUCING TRANSITION MUTATION DNA (5'-D(*CP*GP*CP*GP*(C6G)P*AP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA DAMAGED DNA, O6-CARBOXYMETHYLGUANINE, MUTAGENESIS, DNA
4o5w	nuc      1.60	6-(CARBOXYMETHOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D- ERYTHRO-PENTOFURANOSYL)-9H-PURIN-2-AMINE 2(C12 H16 N5 O9 P)	O6-CARBOXYMETHYLGUANINE IN DNA FORMS A SEQUENCE CONTEXT DEPE WOBBLE BASE PAIR STRUCTURE WITH THYMINE DNA (5'-D(*CP*GP*CP*(C6G)P*AP*AP*TP*TP*TP*GP*CP*G CHAIN: A, B DNA DAMAGED DNA, O6-CARBOXYMETHYLGUANINE, DNA
4o5x	nuc      1.60	6-(CARBOXYMETHOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D- ERYTHRO-PENTOFURANOSYL)-9H-PURIN-2-AMINE 2(C12 H16 N5 O9 P)	O6-CARBOXYMETHYLGUANINE IN DNA FORMS A SEQUENCE CONTEXT DEPE WOBBLE BASE PAIR STRUCTURE WITH THYMINE. DNA (5'-D(*CP*GP*CP*(C6G)P*AP*AP*TP*TP*TP*GP*CP*G CHAIN: A, B DNA DAMAGED DNA, O6-CARBOXYMETHYLGUANINE, DNA
4o5y	nuc      1.75	6-(CARBOXYMETHOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D- ERYTHRO-PENTOFURANOSYL)-9H-PURIN-2-AMINE 2(C12 H16 N5 O9 P)	O6-CARBOXYMETHYLGUANINE IN DNA FORMS A SEQUENCE CONTEXT DEPE WOBBLE BASE PAIR STRUCTURE WITH THYMINE DNA (5'-D(*CP*GP*CP*(C6G)P*AP*AP*TP*TP*TP*GP*CP*G CHAIN: A, B DNA DAMAGED DNA, O6-CARBOXYMETHYLGUANINE, DNA
4o5z	nuc      1.75	6-(CARBOXYMETHOXY)-9-(2-DEOXY-5-O-PHOSPHONO-BETA-D- ERYTHRO-PENTOFURANOSYL)-9H-PURIN-2-AMINE 2(C12 H16 N5 O9 P)	O6-CARBOXYMETHYLGUANINE IN DNA FORMS A SEQUENCE CONTEXT DEPE WOBBLE BASE PAIR STRUCTURE WITH THYMINE DNA (5'-D(*CP*GP*CP*(C6G)P*AP*AP*TP*TP*TP*GP*CP*G CHAIN: A, B DNA DAMAGED DNA, O6-CARBOXYMETHYLGUANINE, DNA

C7P    CIS-DIAMMINE(PYRIDINE)CHLOROPLATINUM(II)

Code	Class Resolution	Description
3co3	nuc      2.16	CIS-DIAMMINE(PYRIDINE)CHLOROPLATINUM(II) C5 H11 CL N3 PT 2+	X-RAY CRYSTAL STRUCTURE OF A MONOFUNCTIONAL PLATINUM-DNA ADDUCT, CIS-{PT(NH3)2(PYRIDINE)}2+ BOUND TO DEOXYGUANOSINE IN A DODECAMER DUPLEX 5'- D(*DCP*DCP*DTP*DCP*DTP*DCP*DGP*DTP*DCP*DTP*DCP*DC)-3', 5'- D(*DGP*DGP*DAP*DGP*DAP*DCP*DGP*DAP*DGP*DAP*DGP*DG)-3' DNA PLATINUM-DNA DUPLEX, CISPLATIN, MONOFUNCTIONAL PT COMPOUND

CA    CALCIUM ION

Code	Class Resolution	Description
158d	nuc      1.90	CALCIUM ION 2(CA 2+)	CRYSTALLOGRAPHIC ANALYSIS OF C-C-A-A-G-C-T-T-G-G AND ITS IMPLICATIONS FOR BENDING IN B-DNA DNA (5'-D(*CP*CP*AP*AP*GP*CP*TP*TP*GP*G)-3') DNA B-DNA, DOUBLE HELIX
196d	nuc      1.70	CALCIUM ION 6(CA 2+)	CRYSTAL STRUCTURE OF C-T-C-T-C-G-A-G-A-G: IMPLICATIONS FOR THE STRUCTURE OF THE HOLLIDAY JUNCTION DNA (5'-D(*CP*TP*CP*TP*CP*GP*AP*GP*AP*G)-3') DNA B-DNA, DOUBLE HELIX
1cw9	nuc      1.55	CALCIUM ION CA 2+	DNA DECAMER WITH AN ENGINEERED CROSSLINK IN THE MINOR GROOVE 5'-D(*CP*CP*AP*GP*(G47)P*CP*CP*TP*GP*G)-3' DNA CROSSLINKED DOUBLE-HELICAL DNA, BASE-PAIR OPENING, PARTIAL B FLIPPING., DNA
1d56	nuc      1.70	CALCIUM ION CA 2+	ALTERNATIVE STRUCTURES FOR ALTERNATING POLY(DA-DT) TRACTS: THE STRUCTURE OF THE B-DNA DECAMER C-G-A-T-A-T-A-T-C-G DNA (5'-D(*CP*GP*AP*TP*AP*TP*AP*TP*CP*G)-3') DNA B-DNA, DOUBLE HELIX
1d61	nuc      1.30	CALCIUM ION CA 2+	THE STRUCTURE OF THE B-DNA DECAMER C-C-A-A-C-I-T-T-G-G: MONO FORM DNA (5'-D(*CP*CP*AP*AP*CP*IP*TP*TP*GP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED, DNA
1d8g	nuc      0.74	CALCIUM ION 4(CA 2+)	ULTRAHIGH RESOLUTION CRYSTAL STRUCTURE OF B-DNA DECAMER D(CC 5'-D(*CP*CP*AP*GP*TP*AP*CP*TP*GP*GP*)-3' DNA B-DNA, ALTERNATE CONFORMATION, ULTRAHIGH RESOLUTION, TRP REP POLYAMIDE, DNA
1dqf	nuc      2.20	CALCIUM ION 2(CA 2+)	CRYSTAL STRUCTURE OF HELIX II OF THE X. LAEVIS SOMATIC 5S RR CYTOSINE BULGE IN TWO CONFORMATIONS RNA (5'-R(*GP*CP*CP*AP*CP*CP*CP*UP*G)-3'): HELIX II OF 5S RRNA, RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)-3') RNA DOUBLE HELIX, CYTOSINE BULGE, RNA
1en8	nuc      0.98	CALCIUM ION 4(CA 2+)	1 A CRYSTAL STRUCTURES OF B-DNA REVEAL SEQUENCE-SPECIFIC BINDING AND GROOVE-SPECIFIC BENDING OF DNA BY MAGNESIUM AND CALCIUM DNA (5'-D(*CP*CP*AP*AP*CP*GP*TP*TP*GP*G)-3') DNA DIVALENT CATIONS, DNA SEQUENCE-SPECIFIC BINDING, SHELXDNA, B-DNA
1ene	nuc      0.98	CALCIUM ION 5(CA 2+)	1A CRYSTAL STRUCTURES OF B-DNA REVEAL SEQUENCE-SPECIFIC BINDING AND GROOVE-SPECIFIC BENDING OF DNA BY MAGNESIUM AND CALCIUM. DNA (5'-D(*CP*CP*AP*GP*CP*GP*CP*TP*GP*G)-3') DNA DIVALENT CATIONS, DNA SEQUENCE-SPECIFIC BINDING, SHELXDNA, B-DNA
1fhy	nuc      2.20	CALCIUM ION CA 2+	PSORALEN CROSS-LINKED D(CCGCTAGCGG) FORMS HOLLIDAY JUNCTION DNA (5'-D(*CP*CP*GP*CP*TP*AP*GP*CP*GP*G)-3') DNA PSORALEN, CROSS-LINKED DNA, HOLLIDAY JUNCTION, 4-WAY JUNCTION, DNA-DRUG COMPLEX
1g2j	nuc      1.97	CALCIUM ION 2(CA 2+)	RNA OCTAMER R(CCCP*GGGG) CONTAINING PHENYL RIBONUCLEOTIDE 5'-R(*CP*CP*CP*(PYY)P*GP*GP*GP*G)-3' RNA RNA DUPLEX, PHENYL-RIBONUCLEOTIDE
1g4q	nuc      1.15	CALCIUM ION 3(CA 2+)	RNA/DNA HYBRID DECAMER OF CAAAGAAAAG/CTTTTCTTTG 5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3': POLYPURINE TRACT OF HIV-1, 5'-D(*CP*TP*TP*TP*TP*CP*TP*TP*TP*G)-3' DNA-RNA HYBRID RNA/DNA HYBRID, POLYPURINE TRACT OF HIV-1, DIRECT METHODS, DNA/RNA COMPLEX, DNA-RNA HYBRID
1j8g	nuc      0.61	CALCIUM ION 3(CA 2+)	X-RAY ANALYSIS OF A RNA TETRAPLEX R(UGGGGU)4 AT ULTRA-HIGH R 5'-R(*UP*GP*GP*GP*GP*U)-3' RNA RNA TETRAPLEX, SR IONS, U TETRAD, OCTAPLEX, RNA
1j9h	nuc      1.40	CALCIUM ION 4(CA 2+)	CRYSTAL STRUCTURE OF AN RNA DUPLEX WITH URIDINE BULGES 5'-R(*GP*UP*GP*UP*CP*GP*(CBR)P*AP*C)-3' RNA URIDINE BULGE, RNA DUPLEX, A-FORM, KINK, METAL BINDING
1l4j	nuc      1.85	CALCIUM ION 4(CA 2+)	HOLLIDAY JUNCTION TCGGTACCGA WITH NA AND CA BINDING SITES. 5'-D(*TP*CP*GP*GP*TP*AP*CP*CP*GP*A)-3' DNA HOLLIDAY JUNCTION, DNA
1l6b	nuc      1.50	CALCIUM ION CA 2+	CRYSTAL STRUCTURE ANALYSIS OF THE ALL DNA HOLLIDAY JUNCTION STRUCTURE OF CCGGTACM5CGG 5'-D(*CP*CP*GP*GP*TP*AP*CP*(5CM)P*GP*G)-3' DNA HOLLIDAY JUNCTION, DNA FOUR-WAY JUNCTION, CYTOSINE METHYLATION
1lnt	nuc      1.70	CALCIUM ION 3(CA 2+)	CRYSTAL STRUCTURE OF THE HIGHLY CONSERVED RNA INTERNAL LOOP 5'-R(*GP*CP*GP*UP*CP*AP*GP*GP*UP*CP*(CBV)P*G)-3', 5'-R(*CP*GP*GP*AP*AP*GP*CP*AP*GP*(CBV)P*GP*C)-3' RNA SRP, INTERNAL LOOP, MISPAIR, RNA
1nqs	nuc      1.97	CALCIUM ION CA 2+	STRUCTURAL CHARACTERISATION OF THE HOLLIDAY JUNCTION FORMED BY THE SEQUENCE D(TCGGTACCGA) AT 1.97 A 5'-D(TPCPGPGPTPAPCPCPGPA)-3' DNA HOLLIDAY JUNCTION, CALCIUM ION, DNA
1nt8	nuc      2.00	CALCIUM ION 2(CA 2+)	STRUCTURAL CHARACTERISATION OF THE HOLLIDAY JUNCTION FORMED BY THE SEQUENCE CCGGTACCGG AT 2.00 A 5'-D(CPCPGPGPTPAPCPCPGPG)-3' DNA HOLLIDAY JUNCTION, CALCIUM ION, DNA
1nvn	nuc      1.80	CALCIUM ION 2(CA 2+)	STRUCTURAL CHARACTERISATION OF THE HOLLIDAY JUNCTION FORMED BY THE SEQUENCE CCGGTACCGG AT 1.8 A 5'-D(CPCPGPGPTPAPCPCPGPG)-3' DNA HOLLIDAY JUNCTION, CALCIUM ION, DNA
1p54	nuc      1.90	CALCIUM ION CA 2+	EFFECT OF SEQUENCE ON THE CONFORMATIONAL GEOMETRY OF DNA HOL JUNCTIONS 5'-D(*CP*CP*AP*GP*TP*AP*CP*(BRU)P*GP*G)-3' DNA DNA HOLLIDAY JUNCTION, FOUR-WAY JUNCTION, STACKED-X JUNCTION BROMINATED URACIL, DNA
1pjg	nuc      1.15	CALCIUM ION 4(CA 2+)	RNA/DNA HYBRID DECAMER OF CAAAGAAAAG/CTTTTCTTTG 5'-D(*CP*TP*TP*TP*TP*CP*TP*TP*TP*G)-3', 5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3': POLYPURINE TRACT OF HIV-1 DNA-RNA HYBRID RNA/DNA HYBRID; POLYPURINE TRACT OF HIV-1; MOLEUCLAR REPLACE SUGAR CONFORMATION, DNA-RNA COMPLEX, DNA-RNA HYBRID
1s1k	nuc      1.90	CALCIUM ION 2(CA 2+)	INFLUENCE OF GROOVE INTERACTIONS ON DNA HOLLIDAY JUNCTION FORMATION 5'-D(*CP*CP*(1AP)P*GP*TP*AP*CP*TP*GP*G)-3' DNA B-DNA, DOUBLE HELIX, 2, 6-DIAMINOPURINE, MINOR GROOVE INTERACTIONS
1sgs	nuc      1.60	CALCIUM ION 6(CA 2+)	CRYSTAL STRUCTURE OF A FREE KB DNA KB DNA DNA FREE KB DNA, CALCIUM BINDING, NF-KB BINDING, DNA
1sk5	nuc      0.89	CALCIUM ION 8(CA 2+)	THE ULTRA-HIGH RESOLUTION STRUCTURE OF D(CTTTTAAAAG)2: MODULATION OF BENDING BY T-A STEPS AND ITS ROLE IN DNA RECOGNITION 5'-D(*CP*TP*TP*TP*TP*AP*AP*AP*AP*G)-3' DNA DNA/DNA DOUBLE HELIX; POPYPURINE TRACT SEQUENCE OF HIV-1
1yy0	nuc      3.20	CALCIUM ION 2(CA 2+)	CRYSTAL STRUCTURE OF AN RNA DUPLEX CONTAINING A 2'-AMINE SUB AND A 2'-AMIDE PRODUCT PRODUCED BY IN-CRYSTAL ACYLATION AT MISMATCH 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP*AP*AP*UP*CP* 3', 5'-R(*GP*CP*AP*GP*AP*(M5M)P*UP*UP*AP*AP*AP*UP*CP* 3' RNA 2'-AMINE, RNA, DUPLEX, MISMATCH, 2-AMIDE, IN-CRYSTAL REACTIO
1yzd	nuc      2.35	CALCIUM ION CA 2+	CRYSTAL STRUCTURE OF AN RNA DUPLEX CONTAINING A SITE SPECIFI SUBSTITUTION AT A C-G WATSON-CRICK BASE PAIR RNA 5'-R(*GP*CP*AP*GP*AP*(A5M) P*UP*UP*AP*AP*GP*UP*CP*UP*GP*C)-3' RNA 2'-AMINE, RNA, DUPLEX
1z79	nuc      2.55	CALCIUM ION CA 2+	CRYSTAL STRUCTURE OF AN RNA DUPLEX CONTAINING SITE SPECIFIC SUBSTITUTION AT A C-A MISMATCH (AT PH 5) RNA 5'-R(*GP*CP*AP*GP*AP*(A5M) P*UP*UP*AP*AP*AP*UP*CP*UP*GP*C)-3' RNA 2'-AMINE, RNA, DUPLEX, MISMATCH
1zez	nuc      2.00	CALCIUM ION CA 2+	ACC HOLLIDAY JUNCTION 5'-D(*CP*CP*GP*GP*TP*AP*CP*CP*GP*G)-3' DNA CRYSTALLOGRAPHIC SCREEN, DNA STRUCTURE, HOLLIDAY JUNCTION, M STRUCTURE, DNA
1zf0	nuc      1.50	CALCIUM ION 4(CA 2+)	B-DNA 5'-D(*CP*CP*GP*TP*TP*AP*AP*CP*GP*G)-3' DNA CRYSTALLOGRAPHIC SCREEN, DNA STRUCTURE, HOLLIDAY JUNCTION, MOLECULAR STRUCTURE
1zf3	nuc      1.84	CALCIUM ION CA 2+	ATC FOUR-STRANDED DNA HOLLIDAY JUNCTION 5'-D(*CP*CP*GP*AP*TP*AP*TP*CP*GP*G)-3' DNA CRYSTALLOGRAPHIC SCREEN, DNA STRUCTURE, HOLLIDAY JUNCTION, M STRUCTURE, DNA
1zf6	nuc      1.50	CALCIUM ION 3(CA 2+)	TGG DUPLEX A-DNA 5'-D(*CP*CP*CP*CP*AP*TP*GP*GP*GP*G)-3' DNA CRYSTALLOGRAPHIC SCREEN, DNA STRUCTURE, HOLLIDAY JUNCTION, MOLECULAR STRUCTURE
1zf7	nuc      1.05	CALCIUM ION 3(CA 2+)	GAC DUPLEX B-DNA 5'-D(*CP*CP*GP*TP*CP*GP*AP*CP*GP*G)-3' DNA CRYSTALLOGRAPHIC SCREEN, DNA STRUCTURE, HOLLIDAY JUNCTION, MOLECULAR STRUCTURE
1zf8	nuc      1.48	CALCIUM ION CA 2+	GGT DUPLEX A-DNA 5'-D(*CP*CP*AP*CP*CP*GP*GP*TP*GP*G)-3' DNA CRYSTALLOGRAPHIC SCREEN, DNA STRUCTURE, HOLLIDAY JUNCTION, MOLECULAR STRUCTURE
1zfa	nuc      1.56	CALCIUM ION CA 2+	GGA DUPLEX A-DNA 5'-D(*CP*CP*TP*CP*CP*GP*GP*AP*GP*G)-3' DNA CRYSTALLOGRAPHIC SCREEN, DNA STRUCTURE, HOLLIDAY JUNCTION, MOLECULAR STRUCTURE
1zfb	nuc      1.65	CALCIUM ION 2(CA 2+)	GGC DUPLEX B-DNA 5'-D(*CP*CP*GP*CP*CP*GP*GP*CP*GP*G)-3' DNA CRYSTALLOGRAPHIC SCREEN, DNA STRUCTURE, HOLLIDAY JUNCTION, MOLECULAR STRUCTURE
244d	nuc      1.20	CALCIUM ION 9(CA 2+)	THE HIGH-RESOLUTION CRYSTAL STRUCTURE OF A PARALLEL- STRANDED GUANINE TETRAPLEX DNA (5'-D(*TP*GP*GP*GP*GP*T)-3') DNA UNUSUAL DNA, QUADRUPLE HELIX, PARALLEL-STRANDED TETRAPLEX
249d	nuc      2.25	CALCIUM ION CA 2+	STRUCTURAL COMPARISON BETWEEN THE D(CTAG) SEQUENCE IN OLIGONUCLEOTIDES AND TRP AND MET REPRESSOR-OPERATOR COMPLEXES DNA (5'-D(*CP*GP*CP*TP*CP*TP*AP*GP*AP*GP*CP*G)- 3') DNA B-DNA, DOUBLE HELIX
2b2b	nuc      1.50	CALCIUM ION 2(CA 2+)	STRUCTURAL DISTORTIONS IN PSORALEN CROSS-LINKED DNA 5'-D(*CP*CP*GP*CP*TP*AP*GP*CP*GP*G)-3' DNA RECOMBINATION, PSORALEN, NUCLEIC ACID STRUCTURE, DNA
2fza	nuc      3.60	CALCIUM ION 2(CA 2+)	CRYSTAL STRUCTURE OF D(GCGGGAGC): THE BASE-INTERCALATED DUPLEX 5'-D(*GP*(CBR)P*GP*GP*GP*AP*GP*C)-3' DNA BASE-INTERCALATED DUPLEX, BASE-INTERCALATED MOTIF, SHEARED G:A PAIR, DNA, DNA HEXAPLEX, DEOXYRIBONUCLEIC ACID
2gw0	nuc      1.55	CALCIUM ION 8(CA 2+)	A D(TGGGGT)- SODIUM AND CALCIUM COMPLEX. 5'-D(*TP*GP*GP*GP*GP*T)-3' DNA DNA, QUADRUPLEX, G-QUADRUPLEX, TETRAPLEX, G-TETRAPLEX, QUADRUPLE HELIX, PARALLEL-STRANDED, D(TGGGGT), HYDRATED CALCIUM ION, CALCIUM, CALCIUM ION, SODIUM, SODIUM ION.
2hok	nuc      3.20	CALCIUM ION 7(CA 2+)	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO THIAMINE PYROPHOSPHATE, CALCIUM IONS THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH
2hol	nuc      2.90	CALCIUM ION 4(CA 2+)	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO THIAMINE PYROPHOSPHATE, BARIUM IONS THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH
2hom	nuc      2.89	CALCIUM ION 2(CA 2+)	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO THIAMINE MONOPHOSPHATE THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH
2hoo	nuc      3.00	CALCIUM ION 7(CA 2+)	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO BENFOTIAMINE THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH; BENFOTIAMINE
2hop	nuc      3.30	CALCIUM ION CA 2+	CRYSTAL STRUCTURE OF AN E. COLI THI-BOX RIBOSWITCH BOUND TO PYRITHIAMINE THI-BOX RIBOSWITCH RNA RNA; RIBOSWITCH
2oks	nuc      1.65	CALCIUM ION 3(CA 2+)	X-RAY STRUCTURE OF A DNA REPAIR SUBSTRATE CONTAINING AN ALKY INTERSTRAND CROSSLINK AT 1.65 RESOLUTION 5'-D(*CP*CP*AP*AP*(C34)P*GP*TP*TP*GP*G)-3' DNA INTERSTRAND CROSSLINK, DNA, DNA DAMAGE
2zy6	nuc      1.75	CALCIUM ION 7(CA 2+)	CRYSTAL STRUCTURE OF A TRUNCATED TRNA, TPHE39A PHENYLALANYL TRANSFER RNA RNA TRUNCATED TRNA
333d	nuc      2.52	CALCIUM ION CA 2+	THE CRYSTAL STRUCTURE OF AN RNA OLIGOMER INCORPORATING TANDEM ADENOSINE-INOSINE MISMATCHES RNA (5'-R(*CP*GP*CP*AP*IP*GP*CP*G)-3') RNA A-RNA, DOUBLE HELIX, INTERNAL LOOP, MISMATCHED
334d	nuc      1.80	CALCIUM ION CA 2+	DEFINING GC-SPECIFICITY IN THE MINOR GROOVE: SIDE-BY-SIDE BINDING OF THE DI-IMIDAZOLE LEXITROPSIN TO C-A-T-G-G-C-C-A- T-G DNA (5'-D(*CP*AP*TP*GP*GP*CP*CP*AP*TP*G)-3') DNA B-DNA, DOUBLE HELIX
352d	nuc      0.95	CALCIUM ION 9(CA 2+)	THE CRYSTAL STRUCTURE OF A PARALLEL-STRANDED PARALLEL- STRANDED GUANINE TETRAPLEX AT 0.95 ANGSTROM RESOLUTION DNA (5'-D(*TP*GP*GP*GP*GP*T)-3') DNA U-DNA, QUADRUPLE HELIX, PARALLEL-STRANDED
397d	nuc      1.30	CALCIUM ION 4(CA 2+)	A 1.3 A RESOLUTION CRYSTAL STRUCTURE OF THE HIV-1 TRANS- ACTIVATION RESPONSE REGION RNA STEM REVEALS A METAL ION- DEPENDENT BULGE CONFORMATION RNA (5'-R(*GP*CP*UP*CP*UP*CP*UP*GP*GP*CP*CP*C)- 3'), RNA (5'- R(*GP*GP*CP*CP*AP*GP*AP*UP*CP*UP*GP*AP*GP*CP*G)-3') RNA DOUBLE HELIX, OVERHANGING BASES, RNA
3bse	nuc      1.60	CALCIUM ION 12(CA 2+)	CRYSTAL STRUCTURE ANALYSIS OF A 16-BASE-PAIR B-DNA DNA (5'- D(*DA*DCP*DAP*DCP*DTP*DAP*DCP*DAP*DAP*DTP*DGP*DTP*DTP*DGP*D CP*DAP*DAP*DT)-3'), DNA (5'- D(*DG*DTP*DAP*DTP*DTP*DGP*DCP*DAP*DAP*DCP*DAP*DTP*DTP*DGP*D TP*DAP*DGP*DT)-3') DNA DM DOMAIN, DNA STRUCTURE, DOUBLESEX, PROTEIN-DNA RECOGNITION, SEX DETERMINATION
3fu2	nuc      2.85	CALCIUM ION 9(CA 2+)	COCRYSTAL STRUCTURE OF A CLASS-I PREQ1 RIBOSWITCH PREQ1 RIBOSWITCH RNA RNA; APTAMER; RIBOSWITCH; QUEUOSINE; PREQ1
3gnk	nuc      2.10	CALCIUM ION 2(CA 2+)	CALCIUM BOUND TO THE HOLLIDAY JUNCTION SEQUENCE D(TCGGCGCCGA)4 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3' DNA HOLLIDAY JUNCTION CALCIUM ION CA2+, DNA
3i5e	nuc      0.98	CALCIUM ION 2(CA 2+)	ALLOSTERIC MODULATION OF DNA BY SMALL MOLECULES 5'-D(*CP*CP*AP*GP*GP*CP*CP*TP*GP*G)-3' DNA DOUBLE STRANDED DNA, POLYAMIDE, DOUBLE HELIX
3i5l	nuc      1.18	CALCIUM ION 5(CA 2+)	ALLOSTERIC MODULATION OF DNA BY SMALL MOLECULES 5'-D(*CP*CP*AP*GP*GP*(C38)P*CP*TP*GP*G)-3' DNA CYCLIC POLYAMIDE, DNA BINDER, MINOR GROOVE BINDER, PYIM POLYAMIDE
3k1v	nuc      2.20	CALCIUM ION 4(CA 2+)	COCRYSTAL STRUCTURE OF A MUTANT CLASS-I PREQ1 RIBOSWITCH PREQ1 RIBOSWITCH RNA RNA; APTAMER; RIBOSWITCH; QUEUOSINE; PREQ1
3np6	nuc      2.30	CALCIUM ION CA 2+	THE CRYSTAL STRUCTURE OF BERBERINE BOUND TO DNA D(CGTACG) 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, DOUBLE HELIX, B-DNA, DNA
3nx5	nuc      2.31	CALCIUM ION CA 2+	THE CRYSTAL STRUCTURE OF SANGUINARINE BOUND TO DNA D(CGTACG) 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, DOUBLE HELIX, DNA
3omj	nuc      0.95	CALCIUM ION 4(CA 2+)	STRUCTURAL BASIS FOR CYCLIC PY-IM POLYAMIDE ALLOSTERIC INHIB NUCLEAR RECEPTOR BINDING 5'-D(*CP*(C38)P*AP*GP*TP*AP*CP*TP*GP*G)-3' DNA CYCLIC PY-IM POLYAMIDE, DNA
3r1e	nuc      0.97	CALCIUM ION 2(CA 2+)	CRYSTAL STRUCTURE OF GC(8BRG)GCGGC DUPLEX RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3') RNA CGG REPEATS, FRAGILE X MENTAL RETARDATION, 8-BROMOGUANOSINE,
3t86	nuc      1.90	CALCIUM ION CA 2+	D(GCATGCT) + CALCIUM DNA (5'-D(*GP*CP*AP*TP*GP*CP*T)-3') DNA QUADRUPLEX, LOOP, DNA
3t8p	nuc      2.35	CALCIUM ION CA 2+	CRYSTAL STRUCTURE OF D(CGGGTACCCG)4 AS A FOUR-WAY HOLLIDAY J DNA (5'-D(*CP*GP*GP*GP*TP*AP*CP*CP*CP*G)-3') DNA DNA FOUR-WAY HOLLIDAY JUNCTION, RECOMBINATION, DNA
426d	nuc      3.00	CALCIUM ION CA 2+	THE STRUCTURE OF MOST STUDIED DNA FRAGMENT CHANGES UNDER THE INFLUENCE OF IONS: A NEW PACKING OF D(CGCGAATTCGCG) 5'-D(CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA DOUBLE HELIX, DNA
463d	nuc      1.45	CALCIUM ION 4(CA 2+)	CALCIUM FORM OF D(CGCGAATTCGCG)2 DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA CA2+ BINDING, DICKERSON-DREW DODECAMER, DNA
476d	nuc      1.30	CALCIUM ION 6(CA 2+)	CALCIUM FORM OF B-DNA UNDECAMER GCGAATTCGCG 5'-D(*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA B-DNA DODECAMER, CALCIUM FORM
477d	nuc      1.70	CALCIUM ION 4(CA 2+)	CALCIUM FORM OF THE B-DNA DODECAMER GGCGAATTCGCG 5'-D(*GP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA B-DNA DODECAMER, CALCIUM FORM, DNA
478d	nuc      2.20	CALCIUM ION 3(CA 2+)	CRYSTAL STRUCTURE OF THE B-DNA DODECAMER 5'-D(CGCGAA(TAF)TCG TAF IS 2'-DEOXY-2'-FLUORO-ARABINO-FURANOSYL THYMINE 5'-D(*CP*GP*CP*GP*AP*AP*(TAF)P*TP*CP*GP*CP*G)-3' DNA B-DNA DODECAMER DUPLEX, CALCIUM CRYSTAL FORM, DNA
4d9x	nuc      2.44	CALCIUM ION CA 2+	THE CRYSTAL STRUCTURE OF COPTISINE BOUND TO DNA D(CGTACG) DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA DRUG-DNA COMPLEX, DOUBLE HELIX, DNA
4d9y	nuc      2.10	CALCIUM ION CA 2+	THE CRYSTAL STRUCTURE OF CHELERYTHRINE BOUND TO DNA D(CGTACG DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA DRUG-DNA COMPLEX, DOUBLE HELIX, DNA
4e8k	nuc      3.03	CALCIUM ION 26(CA 2+)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF K+, CA2+ AND A NON-HYDROLYZED OLIGONUCLEOTIDE SUBSTRATE GROUP IIC INTRON: DOMAINS 1-5, 5'-R(*CP*G*AP*UP*UP*UP*AP*UP*UP*A)-3' RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, RNA
4e8t	nuc      3.34	CALCIUM ION 25(CA 2+)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF K+, CA2+ AND AN OLIGONUCLEOTIDE FRAGMENT SUBSTRATE (LOW DATASET) GROUP IIC INTRON: DOMAINS 1-5, 5'-R(*AP*UP*UP*UP*AP*UP*UP*A)-3' RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4faq	nuc      3.11	CALCIUM ION 24(CA 2+)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF K+, CA2+ AND 5'-EXON GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, SPLICEOSOME, RN
4fs6	nuc      1.30	CALCIUM ION 5(CA 2+)	CRYSTAL STRUCTURE OF THE Z-DNA HEXAMER CGCGCG AT 500 MM CACL DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, CA2+ BINDING, DNA
4meh	nuc      3.12	CALCIUM ION 9(CA 2+)	IN VITRO EVOLVED GLMS RIBOZYME TRIPLE MUTANT, CALCIUM ION CO GLMS TRIPLE MUTANT RIBOZYME, (122-MER) RIBOZYME RNA GLMS RIBOZYME FOLD, SELF-CLEAVAGE, TRANSESTERIFICATION, METALLORIBOZYME, RNA
4p43	nuc      2.00	CALCIUM ION 2(CA 2+)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408U-MUTANT RIBOSOMAL D SITE (C2 FORM 2) 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*UP*CP*GP*AP*C *GP*UP*CP*GP*C)-3' RNA RIBOSOME, ANTIBIOTIC-RESISTANCE, AMINOGLYCOSIDE, DECODING, R
4p97	nuc      1.86	CALCIUM ION 2(CA 2+)	FUNCTIONAL CONSERVATION DESPITE STRUCTURAL DIVERGENCE IN LIG RESPONSIVE RNA SWITCHES RNA (5'-R(*CP*GP*AP*GP*AP*GP*GP*AP*CP*GP*G)-3'), RNA (5'-R(*CP*GP*UP*CP*UP*AP*CP*CP*CP*AP*CP*CP*UP 3') RNA VIRAL GENOME, INTERNAL RIBOSOME ENTRY SITE, TRANSLATION, RNA
4r48	nuc      2.33	CALCIUM ION CA 2+	RACEMIC CRYSTAL STRUCTURE OF A CALCIUM-BOUND DNA FOUR-WAY JU 5'-D(*CP*CP*GP*GP*TP*AP*CP*CP*GP*G)-3' DNA RACEMIC DNA, RACEMATES, DNA
4r49	nuc      1.28	CALCIUM ION 7(CA 2+)	RACEMIC CRYSTAL STRUCTURE OF A CALCIUM-BOUND B-DNA DUPLEX 5'-D(*CP*CP*GP*GP*TP*AP*CP*CP*GP*G)-3' DNA RACEMIC DNA, RACEMATES, DNA
4rj1	nuc      0.92	CALCIUM ION 3(CA 2+)	STRUCTURAL VARIATIONS AND SOLVENT STRUCTURE OF UGGGGU QUADRU STABILIZED BY SR2+ IONS RNA (5'-R(*UP*GP*GP*GP*GP*U)-3') RNA RNA QUADRUPLEXES, PARALLEL-STRANDED, RNA
4rkv	nuc      0.88	CALCIUM ION 2(CA 2+)	STRUCTURAL VARIATIONS AND SOLVENT STRUCTURE OF UGGGGU QUADRU STABILIZED BY SR2+ IONS RNA (5'-R(*UP*GP*GP*GP*GP*U)-3') RNA RNA QUADRUPLEXES, PARALLEL-STRANDED, RNA
4rne	nuc      1.01	CALCIUM ION 8(CA 2+)	STRUCTURAL VARIATIONS AND SOLVENT STRUCTURE OF UGGGGU QUADRU STABILIZED BY SR2+ IONS RNA (5'-R(*UP*GP*GP*GP*GP*U)-3') RNA RNA QUADRUPLEXES, PARALLEL-STRANDED, RNA
4u3l	nuc      1.48	CALCIUM ION 3(CA 2+)	OCTAMERIC RNA DUPLEX CO-CRYSTALLIZED IN CALCIUM(II)CHLORIDE RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3') RNA RNA, DUPLEX, DI- AND TRIVALENT METAL IONS
4u78	nuc      1.50	CALCIUM ION 2(CA 2+)	OCTAMERIC RNA DUPLEX SOAKED IN COPPER(II)CHLORIDE RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3') RNA RNA, DUPLEX, DIVALENT METAL IONS
4xqz	nuc      2.15	CALCIUM ION 2(CA 2+)	CALCIUM(II) AND COPPER(II) BOUND TO THE Z-DNA FORM OF D(CGCG COMPLEXED BY CHLORIDE AND MES DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, COPPER(II), DNA
5dsa	nuc      1.69	CALCIUM ION 2(CA 2+)	CRYSTAL STRUCTURE OF HOLLIDAY JUNCTIONS STABILIZED BY 5-METH IN GCC JUNCTION CORE 5'-D(*CP*CP*GP*GP*CP*GP*5CMP*CP*GP*G)-3' DNA HOLLIDAY JUNCTION, 5-METHYLCYTOSINE, DNA
5dsb	nuc      1.50	CALCIUM ION CA 2+	CRYSTAL STRUCTURE OF HOLLIDAY JUNCTIONS STABILIZED BY 5- HYDROXYMETHYLCYTOSINE IN GCC JUNCTION CORE 5'-D(*CP*CP*GP*GP*CP*GP*5HCP*CP*GP*G)-3' DNA HOLLIDAY JUNCTION, 5-HYDROXYMETHYLCYTOSINE, DNA
5ezf	nuc      1.65	CALCIUM ION 2(CA 2+)	RACEMIC CRYSTAL STRUCTURES OF PRIBNOW BOX CONSENSUS PROMOTER (PBCA) PRIBNOW BOX TEMPLATE STRAND, COMPLEMENTARY STRAND DNA PRIBNOW BOX CONSENSUS SEQUENCE, -10 ELEMENT, TRANSCRIPTION INITIATION, B-DNA DOUBLE HELIX, DNA DOUBLE HELIX, DNA
5i4s	nuc      2.46	CALCIUM ION 8(CA 2+)	NON-NATURAL DNA PAIR Z (6-AMINO-5-NITRO-2[1H] PYRIDONE HETER GUANOSINE DNA (5'-D(P*GP*CP*GP*AP*AP*TP*TP*(D8Z)P*GP*CP*G)- CHAIN: A, B DNA NON-NATURAL NUCLEOTIDE BASE, SYNTHETIC BIOLOGY, 6-AMINO-5-NI PYRIDONE HETEROCYCLE), DNA
5ihd	nuc      1.57	CALCIUM ION 2(CA 2+)	CALCIUM(II) AND COPPER(II) BOUND TO THE Z-DNA FORM OF D(CGCG COMPLEXED BY L-LACTATE AND SUCCINATE DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, COPPER(II), DNA
5ktv	nuc      2.35	CALCIUM ION 9(CA 2+)	MIS-PAIRING OF UNNATURAL BASE Z-G DNA DUPLEX AT PH 8.5 DNA (5'-D(P*GP*CP*GP*AP*AP*TP*TP*(1W5)P*GP*CP*G)- CHAIN: A, B DNA UNNATURAL DNA BASES, SYNTHETIC BIOLOGY, DNA
5lj4	nuc      2.17	CALCIUM ION 4(CA 2+)	CRYSTAL STRUCTURE OF DNA DUPLEX CONTAINING ZP BASE PAIR ODN2 DNA SYNTHETIC NUCLEOTIDE, DNA

CAC    CACODYLATE ION

Code	Class Resolution	Description
1d61	nuc      1.30	CACODYLATE ION C2 H6 AS O2 1-	THE STRUCTURE OF THE B-DNA DECAMER C-C-A-A-C-I-T-T-G-G: MONO FORM DNA (5'-D(*CP*CP*AP*AP*CP*IP*TP*TP*GP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED, DNA
2a2t	nuc      3.10	CACODYLATE ION 6(C2 H6 AS O2 1-)	CRYSTAL STRUCTURE OF D(AAATATTT) 5'-D(*AP*AP*AP*TP*AP*TP*TP*T)-3' DNA AT, MN, CACODYLATE, HASO, DNA
2avj	nuc      2.39	CACODYLATE ION 2(C2 H6 AS O2 1-)	G4(BR)UTTG4 DIMERIC QUADRUPLEX 5'-D(*GP*GP*GP*GP*(BRU)P*TP*TP*GP*GP*GP*G)-3' DNA QUADRUPLEX, LOOP, DNA
2x2q	nuc      1.90	CACODYLATE ION C2 H6 AS O2 1-	CRYSTAL STRUCTURE OF AN 'ALL LOCKED' LNA DUPLEX AT 1.9 ANGST RESOLUTION LOCKED NUCLEIC ACID DERIVED FROM TRNA SER ACCEPTO MICROHELIX, LOCKED NUCLEIC ACID DERIVED FROM TRNA SER ACCEPTO MICROHELIX DNA DNA, MODIFIED NUCLEIC ACID, LOCKED NUCLEIC ACID, THERMOSTABI
3gsk	nuc      1.60	CACODYLATE ION C2 H6 AS O2 1-	A BULKY RHODIUM COMPLEX BOUND TO AN ADENOSINE-ADENOSINE DNA 5'-D(*CP*GP*GP*AP*AP*AP*TP*TP*AP*CP*CP*G)-3' DNA DNA MISMATCH, METALLOINTERCALATOR, DNA RECOGNITION, DNA
4xwf	nuc      1.80	CACODYLATE ION C2 H6 AS O2 1-	CRYSTAL STRUCTURE OF THE ZMP RIBOSWITCH AT 1.80 ANGSTROM PFL RNA RNA RNA, RIBOSWITCH, ZMP, AICAR
5kek	nuc      3.10	CACODYLATE ION 2(C2 H6 AS O2 1-)	STRUCTURE DETERMINATION OF A SELF-ASSEMBLING DNA CRYSTAL DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3'), DNA (5'- D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*TP*GP*AP*CP*GP*AP*CP*AP*CP*TP 3'), DNA (5'-D(P*CP*GP*TP*CP*A)-3'), DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*GP*T)-3') DNA STRUCTURAL DNA NANOECHNOLOGY, SELF-ASSEMBLED CRYSTALS, SELF- DNA
5keo	nuc      3.15	CACODYLATE ION 2(C2 H6 AS O2 1-)	STRUCTURE DETERMINATION OF A SELF-ASSEMBLING DNA CRYSTAL DNA (5'- D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*TP*GP*AP*CP*GP*AP*CP*AP*CP*TP 3'), DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3'), DNA (5'-D(P*CP*GP*TP*CP*A)-3'), DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*GP*T)-3') DNA STRUCTURAL DNA NANOECHNOLOGY, SELF-ASSEMBLED CRYSTALS, SELF- DNA

CAR    CYTOSINE ARABINOSE-5'-PHOSPHATE

Code	Class Resolution	Description
170d	nuc      NMR    	CYTOSINE ARABINOSE-5'-PHOSPHATE 2(C9 H14 N3 O8 P)	SOLUTION STRUCTURE OF A DNA DODECAMER CONTAINING THE ANTI- NEOPLASTIC AGENT ARABINOSYLCYTOSINE: COMBINED USE OF NMR, RESTRAINED MOLECULAR DYNAMICS AND FULL RELAXATION MATRIX REFINEMENT DNA/RNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*T)-R(P*CAR)- D(P*GP*CP*G)-3') DNA DNA
1ho6	nuc      NMR    	CYTOSINE ARABINOSE-5'-PHOSPHATE 2(C9 H14 N3 O8 P)	CHIMERIC ARABINONUCLEIC ACID (ANA) HAIRPIN WITH ANA/RNA HYBRID STEM DNA/RNA (5'-R(*GP*GP*AP*C)-D(P*TP*TP*CP*G)- (P*(GAO)P*(UAR)P*(CAR)P*(CAR)-3') DNA, RNA ARABINONUCLEIC ACID, RNA, HAIRPIN, DNA
2kp3	nuc      NMR    	CYTOSINE ARABINOSE-5'-PHOSPHATE C9 H14 N3 O8 P	STRUCTURE OF ANA-RNA HYBRID DUPLEX RNA (5'-R(*CP*CP*AP*UP*UP*AP*UP*AP*GP*C)-3'), RNA (5'-R(*(GAO)P*(CAR)P*(UAR)P*(A5O)P*(UAR)P*(A5 P*(UAR)P*(GAO)P*(GAO))-3') RNA ANA, ARABINONUCLEIC ACID, NUCLEIC ACID STRUCTURE, NMR/MD/TI, DUPLEX, RNA

CBR    5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
101d	nuc      2.25	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	REFINEMENT OF NETROPSIN BOUND TO DNA: BIAS AND FEEDBACK IN ELECTRON DENSITY MAP INTERPRETATION DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(CBR) P*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
154d	nuc      2.50	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	DNA DISTORTION IN BIS-INTERCALATED COMPLEXES DNA (5'-D(*(CBR)P*GP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
1dn4	nuc      1.60	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 6(C9 H13 BR N3 O7 P)	SOLVATION OF THE LEFT-HANDED HEXAMER D(5BRC-G-5BRC-G-5BRC- G) IN CRYSTALS GROWN AT TWO TEMPERATURES DNA (5'-D(*(CBR)P*GP*(CBR)P*GP*(CBR)P*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1dn5	nuc      1.40	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 6(C9 H13 BR N3 O7 P)	SOLVATION OF THE LEFT-HANDED HEXAMER D(5BRC-G-5BRC-G-5BRC- G) IN CRYSTALS GROWN AT TWO TEMPERATURES DNA (5'-D(*(CBR)P*GP*(CBR)P*GP*(CBR)P*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1em0	nuc      0.90	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C9 H13 BR N3 O7 P)	COMPLEX OF D(CCTAGG) WITH TETRA-[N-METHYL-PYRIDYL] PORPHYRIN DNA (5'-D(*(CBR)P*CP*TP*AP*GP*G)-3') DNA PORPHYRIN, RUFFLING, DNA DISTORTION, GROOVE BINDING
1f6j	nuc      2.25	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF THE E-DNA HEXAMER GGCGBR5CC DNA (5'-D(*GP*GP*CP*GP*(CBR)P*C)-3') DNA E-DNA, DOUBLE HELIX, METHYLATION
1fuf	nuc      1.70	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF A 14BP RNA OLIGONUCLEOTIDE CONTAINING DOUBLE UU BULGES: A NOVEL INTRAMOLECULAR U*(AU) BASE TRIPLE (5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*AP*(CBR) P*C)-3') RNA BULGE, BASE TRIPLE, RNA, CRYSTAL
1ih2	nuc      2.80	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF GGBR5CGBR5CC 5'-D(*GP*GP*(CBR)P*GP*(CBR)P*C)-3' DNA B TO A DNA TRANSITION, DNA TRANSITION, STRUCTURAL TRANSITION
1ih6	nuc      1.45	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 8(C9 H13 BR N3 O7 P)	MULTI-CONFORMATION CRYSTAL STRUCTURE OF GGBR5CGCC 5'-D(*GP*GP*(CBR)P*GP*CP*C)-3' DNA B TO A DNA TRANSITION, DNA TRANSITION, STRUCTURAL TRANSITION
1ik5	nuc      1.80	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF A 14MER RNA CONTAINING DOUBLE UU BULGES IN TWO CRYSTAL FORMS: A NOVEL U*(AU) INTRAMOLECULAR BASE TRIPLE 5'-R(*GP*GP*UP*AP*UP*UP*UP*UP*GP*GP*UP*AP*(CBR) P*C)-3', 5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*AP*(CBR) P*C)-3' RNA X-RAY STRUCTURE, RNA DUPLEX, UU-BULGES, BASE TRIPLE, KINK
1j9h	nuc      1.40	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF AN RNA DUPLEX WITH URIDINE BULGES 5'-R(*GP*UP*GP*UP*CP*GP*(CBR)P*AP*C)-3' RNA URIDINE BULGE, RNA DUPLEX, A-FORM, KINK, METAL BINDING
1p1y	nuc      2.10	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	CRYSTAL STRUCTURE OF A CONTINUOUS THREE-DIMENSIONAL DNA LATT D(GGACAGATGGGAG) 5'-D(*GP*GP*AP*(CBR)P*AP*GP*AP*(BRU)P*GP*GP*GP*AP CHAIN: X DNA CONTINUOUS THREE-DIMENSIONAL DNA LATTICE, PARALLEL-STRANDED PAIRS, DNA
1uhx	nuc      2.00	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	CRYSTAL STRUCTURE OF D(GCGAGAGC): THE BASE-INTERCALATED DUPL 5'-D(*GP*(CBR)P*GP*AP*GP*AP*GP*C)-3' DNA BASE-INTERCALATED DUPLEX, BASE-INTERCALATED MOTIF, SHEARED G DNA, DEOXYRIBONUCLEIC ACID
1uhy	nuc      1.70	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	CRYSTAL STRUCTURE OF D(GCGATAGC): THE BASE-INTERCALATED DUPL 5'-D(*GP*(CBR)P*GP*AP*TP*AP*GP*C)-3' DNA BASE-INTERCALATED DUPLEX, BASE-INTERCALATED MOTIF, SHEARED G DNA, DEOXYRIBONUCLEIC ACID
1v3n	nuc      1.80	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF D(GCGAGAGC): THE DNA QUADRUPLEX STRUCTURE SPLIT FROM THE OCTAPLEX 5'-D(*GP*(CBR)P*GP*AP*GP*AP*GP*C)-3' DNA OCTAPLEX, QUADRUPLEX, G-DUET, BASE-INTERCALATED DUPLEX, BASE-INTERCALATED MOTIF, SHEARED G:A PAIR, DNA, DEOXYRIBONUCLEIC ACID, X-RAY ANALYSIS, CRYSTAL STRUTURE
1vtf	nuc      2.00	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C9 H13 BR N3 O7 P)	STRUCTURE OF 5'-D(*(BRO)CP*GP*(BRO)CP*G)-3' IN COMPLEX WITH DNA (5'-D(*(BRO)CP*GP*(BRO)CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIE DEOXYRIBONUCLEIC ACID, DNA
238d	nuc      2.00	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	CRYSTAL STRUCTURE OF THE DNA DECAMER D(AGG(BR)CATGCCT): COMPARISON WITH D(AGGCATGCCT) AND IMPLICATIONS FOR COBALT HEXAMMINE BINDING TO DNA DNA (5'-D(*AP*GP*GP*(CBR)P*AP*TP*GP*CP*CP*T)-3') DNA A-DNA, DOUBLE HELIX, FLIPPED-OUT BASES, BASE TRIPLET
242d	nuc      1.65	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	MAD PHASING STRATEGIES EXPLORED WITH A BROMINATED OLIGONUCLEOTIDE CRYSTAL AT 1.65 A RESOLUTION. DNA (5'-D(*CP*GP*CP*GP*(CBR)P*G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
2fza	nuc      3.60	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF D(GCGGGAGC): THE BASE-INTERCALATED DUPLEX 5'-D(*GP*(CBR)P*GP*GP*GP*AP*GP*C)-3' DNA BASE-INTERCALATED DUPLEX, BASE-INTERCALATED MOTIF, SHEARED G:A PAIR, DNA, DNA HEXAPLEX, DEOXYRIBONUCLEIC ACID
2g91	nuc      1.50	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE ANALYSIS OF THE AN RNA NONAMER R(GGUGCGC) D(BRC)R(C) 5'-R(*GP*GP*UP*GP*CP*GP*CP*(CBR)P*C-3' RNA RNA DOUBLE HELIX
2got	nuc      2.60	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF D(GCGAACGC): TWO TYPES OF BULGE- CONTAINING DUPLEXES DNA (5'-D(*DGP*(CBR)P*DGP*DAP*DAP*DCP*DGP*DC)- 3') DNA INTRA-DUPLEX AND INTER-DUPLEX HAND-IN-POCKET MOTIFS, BULGE- CONTAINING DUPLEX, BASE-INTERCALATED DUPLEX, SINGLE STRANDED DNA, DNA, X-RAY STRUCTURE, CRYSTAL STRUCTURE
2gun	nuc      2.80	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	RNA-BINDING AFFINITIES AND CRYSTAL STRUCTURE OF OLIGONUCLEOTIDES CONTAINING FIVE-ATOM AMIDE-BASED BACKBONE STRUCTURES 5'-D(*TP*TP*CP*(T2T)P*(CBR)P*TP*TP*C)-3', 5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3' DNA/RNA DNA:RNA HYBRID, AMIDE BEARING DNA, THYMIDINE DIMERS, INTERNUCLEOSIDIC AMIDE LINKAGE, DNA, RNA, DNA/RNA COMPLEX
2pis	nuc      2.80	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 12(C9 H13 BR N3 O7 P)	EFFORTS TOWARD EXPANSION OF THE GENETIC ALPHABET: STRUCTURE AND REPLICATION OF UNNATURAL BASE PAIRS DNA (5'-D(*CP*GP*(CBR)P*GP*AP*AP*(FFD) P*TP*TP*CP*GP*CP*G)-3') DNA NUCLEIC ACID, DUPLEX, REPLICATION, UNNATURAL BASE, DNA
318d	nuc      2.00	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURES OF D(CCGGGCC(BR)5CGG)-HEXAGONAL FORM DNA (5'-D(*CP*CP*GP*GP*GP*CP*CP*(CBR)P*GP*G)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
319d	nuc      2.20	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURES OF D(CCGGG(BR)5CCCGG)-ORTHOGONAL FORM DNA (5'-D(*CP*CP*GP*GP*GP*(CBR)P*CP*CP*GP*G)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED
358d	nuc      2.50	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF THE 2:1 NETROPSIN-DNA DECAMER D(CBRCCCCIIIII) COMPLEX WITH END-TO-END BINDING DNA (5'-D(*CP*(CBR)P*CP*CP*CP*IP*IP*IP*IP*I)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
365d	nuc      2.00	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	STRUCTURAL BASIS FOR G C RECOGNITION IN THE DNA MINOR GROOVE DNA (5'-D(*CP*CP*AP*GP*GP*(CBR)P*CP*TP*GP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
376d	nuc      2.10	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	A ZIPPER-LIKE DNA DUPLEX D(GCGAAAGCT) DNA (5'-D(*GP*(CBR)P*GP*AP*AP*AP*GP*CP*T)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, OVERHANGING BASE, MODIFIED, MISMATCHED
380d	nuc      2.00	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	BINDING OF THE MODIFIED DAUNORUBICIN WP401 ADJACENT TO A T-G INDUCES THE REVERSE WATSON-CRICK CONFORMATION: CRYSTAL STRU THE WP401-TGGCCG AND WP401-CGG[BR5C]CG COMPLEXES DNA (5'-D(*CP*GP*(G49)P*(CBR)P*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, MODIFIED, DNA
3bna	nuc      3.00	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	REVERSIBLE BENDING AND HELIX GEOMETRY IN A B-DNA DODECAMER: CGCGAATTBRCGCG DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(CBR) P*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
421d	nuc      1.80	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	5'-D(*TP*TP*CP*TP*TP*(BRO)CP*TP*TP*C)-3', 5'- R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3' RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*TP*CP*TP*TP*(CBR)P*TP*TP*C)-3') DNA-RNA HYBRID DNA:RNA HYBRID DUPLEX, DNA-RNA COMPLEX, DNA-RNA HYBRID
458d	nuc      2.30	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	DNA MINOR-GROOVE RECOGNITION OF A TRIS-BENZIMIDAZOLE DRUG BY A NON-SELF-COMPLEMENTARY AT-RICH SEQUENCE DNA (5'-D(*CP*GP*(CBR) P*AP*TP*AP*TP*TP*TP*GP*CP*G)-3'), DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*AP*TP*GP*CP*G)- 3') DNA B-DNA, DEOXYRIBONUCLEIC ACID
459d	nuc      2.30	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE C9 H13 BR N3 O7 P	DNA MINOR-GROOVE RECOGNITION OF A TRIS-BENZIMIDAZOLE DRUG DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*AP*TP*GP*CP*G)- 3'), DNA (5'-D(*CP*GP*(CBR) P*AP*TP*AP*TP*TP*TP*GP*CP*G)-3') DNA MINOR GROOVE BINDING, B-DNA, COMPLEXED WITH TRIS- BENZIMIDAZOLE, DEOXYRIBONUCLEIC ACID
474d	nuc      2.40	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C9 H13 BR N3 O7 P)	A NOVEL END-TO-END BINDING OF TWO NETROPSINS TO THE DNA DECAMER D(CCCCCIIIII)2 DNA (5'-D(*CP*CP*CP*(CBR)P*CP*IP*IP*IP*IP*I)-3') DNA B-DNA/RNA, DOUBLE HELIX, DOUBLE DRUG IN MINOR GROOVE, COMPLEXED WITH DRUG, MODIFIED, MISMATCHED
4bna	nuc      2.30	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	REVERSIBLE BENDING AND HELIX GEOMETRY IN A B-DNA DODECAMER: CGCGAATTBRCGCG DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(CBR) P*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
4l26	nuc      1.40	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF DNA DUPLEX CONTAINING CONSECUTIVE T-T M (BR-DERIVATIVE) DNA (5'-D(*CP*GP*(CBR)P*GP*AP*TP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA T-T MISPAIR, A-T-T TRIPLET, NON-HELICAL DNA DUPLEX, DNA
5ay2	nuc      1.30	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 4(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF RNA DUPLEX CONTAINING C-AG(I)-C BASE PA RNA (5'-R(*GP*GP*AP*CP*UP*(CBR)P*GP*AP*CP*UP*CP*C CHAIN: A, B, C, D RNA RNA, METALLO BASE PAIR, AG(I)
5ay3	nuc      1.20	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF RNA DUPLEX CONTAINING C-C BASE PAIRS RNA (5'-R(*GP*GP*AP*CP*UP*(CBR)P*GP*A*CP*UP*CP*C) CHAIN: A, B RNA RNA, X-RAY ANALYSIS, METALLO BASE PAIR, AG(I)
5ay4	nuc      1.70	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	CRYSTAL STRUCTURE OF RNA DUPLEX CONTAINING C-C BASE PAIRS OB THE PRESENCE OF HG(II) RNA (5'-R(*GP*GP*AP*CP*UP*(CBR)P*GP*AP*CP*UP*CP*C CHAIN: A, B RNA RNA, X-RAY ANALYSIS, METALLO BASE PAIR, AG(I), HG(II)
6bna	nuc      2.21	5-BROMO-2'-DEOXY-CYTIDINE-5'-MONOPHOSPHATE 2(C9 H13 BR N3 O7 P)	BINDING OF AN ANTITUMOR DRUG TO DNA. NETROPSIN AND C-G-C-G- A-A-T-T-BRC-G-C-G DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(CBR) P*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED

CBV    5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
1lnt	nuc      1.70	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C9 H13 BR N3 O8 P)	CRYSTAL STRUCTURE OF THE HIGHLY CONSERVED RNA INTERNAL LOOP 5'-R(*GP*CP*GP*UP*CP*AP*GP*GP*UP*CP*(CBV)P*G)-3', 5'-R(*CP*GP*GP*AP*AP*GP*CP*AP*GP*(CBV)P*GP*C)-3' RNA SRP, INTERNAL LOOP, MISPAIR, RNA
1qbp	nuc      2.10	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 12(C9 H13 BR N3 O8 P)	CRYSTAL STRUCTURE OF A BROMINATED RNA HELIX WITH FOUR MISMATCHED BASE PAIRS 5'-R(*UP*GP*(CBV)P*(CBV) P*AP*GP*UP*UP*CP*GP*CP*UP*GP*GP*C)-3' RNA BROMINATED CYTOSINE, MISMATCHED BASE PAIRS, RNA
430d	nuc      2.10	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 BR N3 O8 P	STRUCTURE OF SARCIN/RICIN LOOP FROM RAT 28S RRNA SARCIN/RICIN LOOP FROM RAT 28S R-RNA RNA U-RNA, DOUBLE HELIX, HAIRPIN, BLUNT STEM, TETRALOOP MISMATCH TRIPLE, RIBONUCLEIC ACID, RNA
5d8t	nuc      1.20	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C9 H13 BR N3 O8 P)	RNA OCTAMER CONTAINING (S)-5' METHYL, 2'-F U. RNA OLIGONUCLEOTIDE CONTAINING (S)-C5'-ME-2'-FU RNA RNA, MODIFIED BASE
5ndh	nuc      1.81	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H13 BR N3 O8 P)	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P2 RNA (5'-R(*GP*(CBV) P*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*GP*C)-3') RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMER, RNA
5ndi	nuc      2.57	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H13 BR N3 O8 P)	THE STRUCTURE OF THE E.COLI GUANIDINE II RIBOSWITCH P1 STEM- RNA (5'- R(*UP*UP*UP*GP*CP*AP*GP*GP*AP*CP*GP*AP*CP*CP*UP*GP*(CBV)P*A 3') RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMER, RNA
5nef	nuc      1.91	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 BR N3 O8 P	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH GUANIDINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, RNA
5neo	nuc      1.69	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 BR N3 O8 P	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, RNA
5nep	nuc      1.60	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 BR N3 O8 P	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH METHYLGUANIDINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, METHYLGUANIDINE, RNA
5neq	nuc      1.69	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 BR N3 O8 P	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH AMINOGUANIDINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, AMINOGUANIDINE, RNA
5nex	nuc      1.72	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 BR N3 O8 P	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH AGMATINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, RNA,
5nom	nuc      1.93	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C9 H13 BR N3 O8 P	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH GUANIDINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, RNA
5t5a	nuc      2.00	5-BROMOCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C9 H13 BR N3 O8 P)	CRYSTAL STRUCTURE OF THE TWISTER SISTER (TS) RIBOZYME AT 2.0 DNA/RNA (71-MER) RNA RNA JUNCTION CATALYSIS, RNA

CCC    CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE

Code	Class Resolution	Description
2gdi	nuc      2.05	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THIAMINE PYROPHOSPHATE-SPECIFIC RIBOSWI COMPLEX WITH THIAMINE PYROPHOSPHATE TPP RIBOSWITCH: SENSING DOMAIN RNA RIBOSWITCH, THIAMINE PYROPHOSPHATE, RNA
2quw	nuc      2.20	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	HAMMERHEAD RIBOZYME G12A MUTANT AFTER CLEAVAGE HAMMERHEAD RIBOZYME, CLEAVED FRAGMENT, HAMMERHEAD RIBOZYME, CLEAVED FRAGMENT RNA HAMMERHEAD RIBOZYME, RIBOZYME, CATALYTIC RNA, RIBOZYME-PRODU COMPLEX, RNA
3dig	nuc      2.80	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THE THERMOTOGA MARITIMA LYSINE RIBOSWIT TO S-(2-AMINOETHYL)-L-CYSTEINE RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3dil	nuc      1.90	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THE THERMOTOGA MARITIMA LYSINE RIBOSWIT TO LYSINE RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3dim	nuc      2.90	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH LYSINE, CS+ SOAK RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3dio	nuc      2.40	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH BOUND TO LYSINE, IRIDIUM HEXAMINE SOAK RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3diq	nuc      2.70	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH BOUND TO HOMOARGININE RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3dir	nuc      2.90	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH N6-1-IMINOETHYL-L-LYSINE RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3dis	nuc      3.10	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH FORM RNA (174-MER) RNA FREE FORM, RIBOSWITCH, RNA
3dix	nuc      2.90	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH LYSINE, K+ ANOMALOUS DATA RNA (174-MER) RNA RIBOSWITCH, LYSINE, POTASSIUM CATION, RNA
3diy	nuc      2.71	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH LYSINE, MN2+ SOAK RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3diz	nuc      2.85	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH LYSINE IN THE ABSENCE OF MG2+ RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3dj0	nuc      2.50	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH L-4-OXALYSINE RNA (174-MER) RNA LYSINE RIBSOWITCH, OXALYSINE, RNA
3dj2	nuc      2.50	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH LYSINE, TL+ SOAK RNA (174-MER) RNA LYSINE, RIBOSWITCH, RNA
3f2q	nuc      2.95	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN FMN RIBOSWITCH RNA FMN RIBOSWITCH, TRANSCRIPTION, RNA
3f2t	nuc      3.00	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, IRIDIU SOAK. FMN RIBOSWITCH RNA FMN RIBOSWITCH, TRANSCRIPTION, RNA
3f2w	nuc      3.45	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, BA2+ S FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, BARIUM, RNA
3f2x	nuc      3.11	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, CS+ SO FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, CESIUM, RNA
3f2y	nuc      3.20	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, MN2+ S FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, MANGANESE, RNA
3f30	nuc      3.15	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, COBALT SOAK. FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, COBALT HEXAMINE, RNA
3owi	nuc      2.85	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE GLYCINE RIBOSWITCH BOUND TO GLYCINE DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oww	nuc      2.80	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE GLYCINE RIBOSWITCH BOUND TO GLYCINE DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3owz	nuc      2.95	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, SOAKED IN IRIDIUM DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION, GLYCINE RIBOSWITCH, RNA
3ox0	nuc      3.05	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, UNBOUND STATE DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxb	nuc      2.95	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH WITH SINGLE MUTATION DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxd	nuc      3.00	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH WITH TWO MUTATIONS DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxe	nuc      2.90	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, MN2+ SOAKED DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxj	nuc      3.20	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, SOAKED IN BA2+ DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxm	nuc      2.95	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, TL-ACETATE SOAKED DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3ski	nuc      2.30	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE RNA (68-MER), RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skl	nuc      2.90	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, IRIDIUM HEXAMMINE SOAK RNA (66-MER) RNA THREE WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skr	nuc      3.10	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, COBALT HEXAMMINE SOAK RNA (66-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skt	nuc      3.10	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, MANGANESE SOAK RNA (66-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY-GUANOSINE, RNA
3skw	nuc      2.95	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, CESIUM SOAK RNA (66-MER) RNA THREE-WAY RNA JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
3skz	nuc      2.60	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND GUANOSINE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
3slm	nuc      2.70	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE-5'-MONOPHOSPHATE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
3slq	nuc      2.50	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND GUANOSINE-5'-MONOPHOSPHATE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
3suh	nuc      2.65	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THF RIBOSWITCH, BOUND WITH 5-FORMYL-THF RIBOSWITCH RNA THREE-WAY JUNCTION, PSEUDOKNOT, GENE REGULATOR, THF, RNA
3sux	nuc      2.90	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THF RIBOSWITCH, BOUND WITH THF RIBOSWITCH RNA THREE-WAY JUNCTION, PSEUDOKNOT, GENE REGULATOR, THF, RNA
3suy	nuc      3.21	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CRYSTAL STRUCTURE OF THF RIBOSWITCH, UNBOUND STATUS RIBOSWITCH RNA THREE-WAY JUNCTION, PSEUDOKNOT, GENE REGULATOR, RNA
488d	nuc      3.10	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	CATALYTIC RNA ENZYME-PRODUCT COMPLEX SECOND RNA FRAGMENT OF CLEAVED SUBSTRATE, FIRST RNA FRAGMENT OF CLEAVED SUBSTRATE, RNA RIBOZYME STRAND, UNCLEAVED RNA SUBSTRATE RNA CATALYTIC RNA, RIBOZYME, ENZYME-PRODUCT COMPLEX, CRYSTAL LATTICE TRAPPING
4gxy	nuc      3.05	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	RNA STRUCTURE ADENOSYLCOBALAMIN RIBOSWITCH RNA RNA, RIBOSWITCH, ADENOSYLCOBALAMIN
4nya	nuc      2.65	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE E. COLI THIM RIBOSWITCH IN COMPLEX (AZIDOMETHYL)-2-METHYLPYRIMIDIN-4-AMINE THIM TPP RIBOSWITCH RNA FRAGMENT-BASED DRUG DISCOVERY, RIBOSWITCH, RNA
4ts0	nuc      2.80	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE SPINACH RNA APTAMER IN COMPLEX WITH BARIUM IONS SPINACH RNA APTAMER, BIMOLECULAR CONSTRUCT, SPINACH RNA APTAMER, BIMOLECULAR CONSTRUCT RNA APTAMER, FLUORESCENCE, G-QUADRUPLEX, RNA
4ts2	nuc      2.88	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	CRYSTAL STRUCTURE OF THE SPINACH RNA APTAMER IN COMPLEX WITH MAGNESIUM IONS SPINACH APTAMER RNA, BIMOLECULAR CONSTRUCT, SPINACH APTAMER RNA, BIMOLECULAR CONSTRUCT RNA APTAMER, FLUORESCENCE, G-QUADRUPLEX, RNA
4wfl	nuc      2.49	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE C9 H13 N3 O10 P2	STRUCTURE OF THE COMPLETE BACTERIAL SRP ALU DOMAIN RNA: RESIDUES 3-81,RESIDUES 3-81 RNA NON-CODING, RNA, SRP RNA, ELONGATION ARREST
4wfm	nuc      3.10	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	STRUCTURE OF THE COMPLETE BACTERIAL SRP ALU DOMAIN BACILLUS SUBTILIS SMALL CYTOPLASMIC RNA (SCRNA),R CHAIN: A, B RNA NON-CODING, RNA, SRP RNA, ELONGATION ARREST
5lys	nuc      2.32	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	THE CRYSTAL STRUCTURE OF 7SK 5'-HAIRPIN - GOLD DERIVATIVE RNA (57-MER) RNA NON-CODING RNA MAJOR GROOVE BASE TRIPLE TRANSCRIPTION, RNA
5lyu	nuc      2.20	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	THE NATIVE CRYSTAL STRUCTURE OF 7SK 5'-HAIRPIN RNA (58-MER) RNA NON-CODING RNA MAJOR GROOVE BASE TRIPLE TRANSCRIPTION, RNA
5lyv	nuc      2.35	CYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE 2(C9 H13 N3 O10 P2)	THE CRYSTAL STRUCTURE OF 7SK 5'-HAIRPIN - OSMIUM DERIVATIVE RNA (57-MER) RNA NON-CODING RNA MAJOR GROOVE BASE TRIPLE TRANSCRIPTION, RNA

CCI    CALICHEAMICIN GAMMA-1-OLIGOSACCHARIDE

Code	Class Resolution	Description
1qms	nuc      NMR    	CALICHEAMICIN GAMMA-1-OLIGOSACCHARIDE 2(C38 H61 I N2 O17 S)	HEAD-TO-TAIL DIMER OF CALICHEAMICIN GAMMA-1-I OLIGOSACCHARIDE BOUND TO DNA DUPLEX, NMR, 9 STRUCTURES DNA (5'-D(*GP*CP*AP*CP*CP*TP*TP*CP*CP*TP*GP*C)-3'), DNA (5'-D(*GP*CP*AP*GP*GP*AP*AP*GP*GP*TP*GP*C)-3') DNA DEOXYRIBONUCLEIC ACID/CALICHEAMICIN, CALICHEAMICIN, HEAD-TO-TAIL DIMER, DNA, MINOR GROOVE BINDING, ANTITUMOR AGENT, LIGAND-DNA COMPLEX, DEOXYRIBONUCLEIC ACID

CD    CADMIUM ION

Code	Class Resolution	Description
1ykq	nuc      3.50	CADMIUM ION 5(CD 2+)	CRYSTAL STRUCTURE OF DIELS-ALDER RIBOZYME DIELS-ALDER RIBOZYME, DIELS-ALDER RIBOZYME RNA CARBON-CARBON BOND, CATALYTIC MECHANISM, RNA CRYSTAL STRUCTU DIELS-ALDER REACTION, RIBOZYME, RNA
488d	nuc      3.10	CADMIUM ION 8(CD 2+)	CATALYTIC RNA ENZYME-PRODUCT COMPLEX SECOND RNA FRAGMENT OF CLEAVED SUBSTRATE, FIRST RNA FRAGMENT OF CLEAVED SUBSTRATE, RNA RIBOZYME STRAND, UNCLEAVED RNA SUBSTRATE RNA CATALYTIC RNA, RIBOZYME, ENZYME-PRODUCT COMPLEX, CRYSTAL LATTICE TRAPPING

CDR    2,3-DIDEOXYFUCOSE

Code	Class Resolution	Description
1d83	nuc      NMR    	2,3-DIDEOXYFUCOSE 4(C6 H12 O3)	STRUCTURE REFINEMENT OF THE CHROMOMYCIN DIMER/DNA OLIGOMER COMPLEX IN SOLUTION DNA (5'-D(*AP*AP*GP*GP*CP*CP*TP*T)-3') DNA DNA, NMR, DOUBLE HELIX, CHROMOMYCIN
1vaq	nuc      2.00	2,3-DIDEOXYFUCOSE 8(C6 H12 O3)	CRYSTAL STRUCTURE OF THE MG2+-(CHROMOMYCIN A3)2-D(TTGGCCAA) 2 COMPLEX REVEALS GGCC BINDING SPECIFICITY OF THE DRUG DIMER CHELATED BY METAL ION 5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3' DNA CHROMOMYCIN A3, X-RAY DIFFRACTION, MAD, DNA DUPLEX, GGCC SITE, DNA KINK, CD SPECTRA
5erz	nuc      1.75	2,3-DIDEOXYFUCOSE 4(C6 H12 O3)	CRYSTAL STRUCTURE OF THE [NI2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX
5es0	nuc      2.10	2,3-DIDEOXYFUCOSE 4(C6 H12 O3)	CRYSTAL STRUCTURE OF THE [CO2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX

CFL    4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)PYRIMIDIN-2(1H)-ONE

Code	Class Resolution	Description
1fc8	nuc      NMR    	4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)PYRIMIDIN-2(1H)-ONE 2(C9 H13 F N3 O7 P)	NMR SOLUTION STRUCTURE OF A CHIMERIC OLIGONUCLEOTIDE HAIRPIN R(GGAC)D(TTCG)2'F-A(GTCC) 5'-R(*GP*GP*AP*CP)D(*TP*TP*CP*GP*(GFL)P*(TAF) P*(CFL)P*(CFL))-3' RNA/DNA CHIMERA 2'F-ARABINONUCLEIC ACID, RNA, DNA, HYBRID DUPLEX, HAIRPIN, RNA/DNA CHIMERA COMPLEX
2kp4	nuc      NMR    	4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)PYRIMIDIN-2(1H)-ONE C9 H13 F N3 O7 P	STRUCTURE OF 2'F-ANA/RNA HYBRID DUPLEX DNA (5'-D(*(GFL)P*(CFL)P*(TAF)P*(A5L)P*(TAF)P*(A5 P*(TAF)P*(GFL)P*(GFL))-3'), RNA (5'-R(*CP*CP*AP*UP*UP*AP*UP*AP*GP*C)-3') DNA/RNA 2-DEOXY-2-FLUORO-D-ARABINOSE, FANA, NUCLEIC ACID STRUCTURE, NMR/MD/TI, HYBRID DUPLEX, DNA-RNA COMPLEX
2lsc	nuc      NMR    	4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)PYRIMIDIN-2(1H)-ONE 8(C9 H13 F N3 O7 P)	SOLUTION STRUCTURE OF 2'F-ANA AND ANA SELF-COMPLEMENTARY DUP DNA (5'-D(*(CFL)P*(GFL)P*(CFL)P*(GFL)P*(A5O)P*(A5 P*(UAR)P*(CFL)P*(GFL)P*(CFL)P*(GFL))-3') DNA DNA, DICKERSON DREW DODECAMER
2m84	nuc      NMR    	4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)PYRIMIDIN-2(1H)-ONE 4(C9 H13 F N3 O7 P)	STRUCTURE OF 2'F-RNA/2'F-ANA CHIMERIC DUPLEX 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA 2'F-RNA/2'F-ANA CHIMERIC DUPLEX, A-FORM, 12-MER, DICKERSON D DODECAMER, MODIFIED NUCLEOTIDES, DNA, RNA
2m8a	nuc      NMR    	4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)PYRIMIDIN-2(1H)-ONE 4(C9 H13 F N3 O7 P)	2'F-ANA/2'F-RNA ALTERNATED SEQUENCES 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA A-FORM, 12-MER, DICKERSON DREW DODECAMER, MODIFIED NUCLEOTID RNA
2n89	nuc      NMR    	4-AMINO-1-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)PYRIMIDIN-2(1H)-ONE 8(C9 H13 F N3 O7 P)	TETRAMERIC I-MOTIF STRUCTURE OF DT-DC-DC-CFL-CFL-DC AT ACIDI DNA (5'-D(*TP*CP*CP*(CFL)P*(CFL)P*C)-3') DNA 2'F-ARAC, I-MOTIF, 2'F-ANA, MODIFIED NUCLEOTIDES, DNA

CFZ    2'-DEOXY-2'-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2kwg	nuc      NMR    	2'-DEOXY-2'-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 2(C9 H13 F N3 O7 P)	SOLUTION STRUCTURE OF A FULLY MODIFIED 2'-F/2'-OME SIRNA CON 5'-R(P*(A2M)P*(UFT)P*(OMG)P*(AF2)P*(A2M)P*(GF2)P* P*(AF2)P*(OMU)P*(GF2)P*(OMU)P*(AF2)P*(OMU)P*(UFT)P*(OMU)P*( P*(OMC)P*(CFZ)P*(OMC)P*(UFT)P*(OMU))-3', 5'-R(*(GF2)P*(OMG)P*(GF2)P*(OMU)P*(AF2)P*(A2M)P*( P*(OMU)P*(AF2)P*(OMC)P*(AF2)P*(OMU)P*(UFT)P*(OMC)P*(UFT)P*( P*(CFZ)P*(A2M)P*(UFT)P*(OMU)P*(UFT))-3' RNA SIRNA, 2'-FLUORO, 2'-O-METHYL, RNA
2m84	nuc      NMR    	2'-DEOXY-2'-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H13 F N3 O7 P)	STRUCTURE OF 2'F-RNA/2'F-ANA CHIMERIC DUPLEX 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA 2'F-RNA/2'F-ANA CHIMERIC DUPLEX, A-FORM, 12-MER, DICKERSON D DODECAMER, MODIFIED NUCLEOTIDES, DNA, RNA
2m8a	nuc      NMR    	2'-DEOXY-2'-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H13 F N3 O7 P)	2'F-ANA/2'F-RNA ALTERNATED SEQUENCES 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA A-FORM, 12-MER, DICKERSON DREW DODECAMER, MODIFIED NUCLEOTID RNA
3p4a	nuc      1.20	2'-DEOXY-2'-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 12(C9 H13 F N3 O7 P)	2'FLUORO MODIFIED RNA OCTAMER FA2U2 2'FLUORO MODIFIED RNA 8-MER RNA RNA, 2'-FLUORO-RNA, O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYGUANOSINE, 2'-FLUORO 2'- DEOXYADENOSINE, 2'-FLUORO 2'-DEOXYURIDINE, SIRNA
3p4b	nuc      1.45	2'-DEOXY-2'-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 12(C9 H13 F N3 O7 P)	ALTERNATINGLY MODIFIED 2'FLUORO RNA OCTAMER F/RA2U2-P3 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ)P*G)-3' RNA RNA, 2'-FLUORO-RNA, O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYADENOSINE, 2'-FLUORO 2'- DEOXYURIDINE, SIRNA
3p4c	nuc      1.15	2'-DEOXY-2'-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H13 F N3 O7 P)	ALTERNATINGLY MODIFIED 2'FLUORO RNA OCTAMER F/RA2U2-R32 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ)P*G)-3' RNA RNA, 2'-FLUORO-RNA O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYADENOSINE, 2'-FLUORO 2'- DEOXYURIDINE, SIRNA
3p4d	nuc      1.85	2'-DEOXY-2'-FLUOROCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) 4(C9 H13 F N3 O7 P)	ALTERNATINGLY MODIFIED 2'FLUORO RNA OCTAMER F/RC4G4 5'-R(*(CFZ)P*CP*(CFZ)P*CP*(GF2)P*GP*(GF2)P*G)-3' RNA RNA, 2'-FLUORO-RNA, O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYGUANOSINE, SIRNA

CGQ    3-[C-[N'-(3-CARBAMIMIDOYL-BENZYLIDENIUM)-HYDRAZINO]- [[AMINOMETHYLIDENE]AMINIUM]-IMINOMETHYL]-BENZAMIDINIUM

Code	Class Resolution	Description
1m6f	nuc      1.78	3-[C-[N'-(3-CARBAMIMIDOYL-BENZYLIDENIUM)-HYDRAZINO]- [[AMINOMETHYLIDENE]AMINIUM]-IMINOMETHYL]-BENZAMIDINIUM C17 H22 N9 3+	STRONG BINDING IN THE DNA MINOR GROOVE BY AN AROMATIC DIAMIDINE WITH A SHAPE THAT DOES NOT MATCH THE CURVATURE OF THE GROOVE DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA NUCLEIC ACIDS, MINOR GROOVE BINDER, DOUBLE HELIX, DNA-DRUG COMPLEX

CH    N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1kos	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	SOLUTION NMR STRUCTURE OF AN ANALOG OF THE YEAST TRNA PHE T STEM LOOP CONTAINING RIBOTHYMIDINE AT ITS NATURALLY OCCURRING POSITION 5'-R(*CP*UP*GP*UP*GP*(5MU)P*UP*CP*GP*AP*UP*(CH) P*CP*AP*CP*AP*G)- 3': TPSIC DOMAIN OF TRNA RNA TRNA, T STEM LOOP, TRNA DOMAIN, RNA HAIRPIN, RNA FOLDING
1kpy	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	PEMV-1 P1-P2 FRAMESHIFTING PSEUDOKNOT, 15 LOWEST ENERGY STRUCTURES P1-P2 FRAMESHIFTING PSEUDOKNOT RNA PSEUDOKNOT, NMR, FRAMESHIFTING, LUTEOVIRUS, TRIPLE HELIX, PROTONATED CYTIDINE, RIBONUCLEIC ACID, RNA
1kpz	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	PEMV-1 P1-P2 FRAMESHIFTING PSEUDOKNOT REGULARIZED AVERAGE STRUCTURE P1-P2 FRAMESHIFTING PSEUDOKNOT RNA PSEUDOKNOT, NMR, FRAMESHIFTING, LUTEOVIRUS, TRIPLE HELIX, PROTONATED CYTIDINE, RIBONUCLEIC ACID, RNA
1yg3	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	SOLUTION STRUCTURE OF THE SCYLV P1-P2 FRAMESHIFTING PSEUDOKNOT, 20 LOWEST ENERGY STRUCTURES SCYLV RNA PSEUDOKNOT RNA RNA PSEUDOKNOT; RIBOSOMAL FRAMESHIFTING; PROTONATED CYTIDINE
1yg4	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	SOLUTION STRUCTURE OF THE SCYLV P1-P2 FRAMESHIFTING PSEUDOKNOT, REGULARIZED AVERAGE STRUCTURE SCYLV RNA PSEUDOKNOT RNA RNA PSEUDOKNOT; RIBOSOMAL FRAMESHIFTING; PROTONATED CYTIDINE
2ap0	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	SOLUTION STRUCTURE OF THE C27A SCYLV P1-P2 FRAMESHIFTING PSEUDOKNOT, 20 LOWEST ENERGY STRUCTURES C27A SUGARCANE YELLOW LEAF VIRUS RNA PSEUDOKNOT RNA RNA PSEUDOKNOT; FRAMESHIFTING
2ap5	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	SOLUTION STRUCTURE OF THE C27A SCYLV P1-P2 FRAMESHIFTING PSEUDOKNOT, AVERAGE STRUCTURE C27A SUGARCANE YELLOW LEAF VIRUS RNA PSEUDOKNOT RNA RNA PSEUDOKNOT; FRAMESHIFTING
2rp0	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	REFINED SOLUTION STRUCTURE OF THE PEMV-1 MRNA PSEUDOKNOT, 28 LOWEST ENERGY STRUCTURES PEMV-1 MRNA PSEUDOKNOT RNA RNA PSEUDOKNOT, FRAMESHIFTING
2rp1	nuc      NMR    	N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O8 P 1+	REFINED SOLUTION STRUCTURE OF THE PEMV-1 MRNA PSEUDOKNOT, REGULARIZED AVERAGE STRUCTURE PEMV-1 MRNA PSEUDOKNOT RNA RNA PSEUDOKNOT, FRAMESHIFTING

CHD    CHOLIC ACID

Code	Class Resolution	Description
1on5	nuc      NMR    	CHOLIC ACID 2(C24 H40 O5)	SOLUTION STRUCTURE OF A CHOLIC ACID-CAPPED DNA DUPLEX STEROID-DNA HYBRID DNA DNA, STEROID, SYNTHETIC HYBRID

CIR    CITRULLINE

Code	Class Resolution	Description
1kod	nuc      NMR    	CITRULLINE C6 H13 N3 O3	RNA APTAMER COMPLEXED WITH CITRULLINE, NMR RNA (5'-R(P*AP*GP*AP*AP*GP*GP*AP*GP*UP*GP*U)-3'), RNA (5'- R(P*AP*CP*GP*GP*UP*UP*AP*GP*GP*UP*CP*GP*CP*U)-3') RNA IN VITRO SELECTED RNA, RNA APTAMER

CL    CHLORIDE ION

Code	Class Resolution	Description
1da3	nuc      2.00	CHLORIDE ION CL 1-	THE CRYSTAL STRUCTURE OF THE TRIGONAL DECAMER C-G-A-T-C-G- 6MEA-T-C-G: A B-DNA HELIX WITH 10.6 BASE-PAIRS PER TURN DNA (5'-D(*CP*GP*AP*TP*CP*GP*(6MA)P*TP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED
1enn	nuc      0.89	CHLORIDE ION CL 1-	SOLVENT ORGANIZATION IN AN OLIGONUCLEOTIDE CRYSTAL: THE STRUCTURE OF D(GCGAATTCG)2 AT ATOMIC RESOLUTION DNA (5'-D(*GP*CP*GP*AP*AP*TP*TP*CP*G)-3') DNA B-DNA, ATOMIC RESOLUTION, IONS, HYDRATION, BASE TRIPLET
1icg	nuc      1.53	CHLORIDE ION 2(CL 1-)	STRUCTURE OF THE HYBRID RNA/DNA R-GCUUCGGC-D[F]U IN PRESENCE OF IR(NH3)6+++ 5'-R(*GP*CP*UP*UP*CP*GP*GP*C)-D(P*(UFP))-3' DNA/RNA RNA/DNA HYBRID, FLUORO-URACIL, C-U MISMATCH, G-U MISMATCH, RHODIUM HEXAMMINE, IRIDIUM HEXAMMINE, DNA/RNA COMPLEX
1id9	nuc      1.60	CHLORIDE ION 2(CL 1-)	STRUCTURE OF THE HYBRID RNA/DNA R-GCUUCGGC-D[F]U IN PRESENCE OF RH(NH3)6+++ 5'-R(*GP*CP*UP*UP*CP*GP*GP*C)-D(P*(UFP))-3' DNA/RNA RNA/DNA HYBRID, FLUORO URACIL, RHODIUM(III) HEXAMMINE, C-U MISMATCH, G-U MISMATCH, DNA/RNA COMPLEX
1idw	nuc      1.80	CHLORIDE ION 2(CL 1-)	STRUCTURE OF THE HYBRID RNA/DNA R-GCUUCGGC-D[CL]U IN PRESENCE OF RH(NH3)6+++ 5'-R(*GP*CP*UP*UP*CP*GP*GP*C)-D(P*(UCL))-3' DNA/RNA RNA/DNA HYBRID, RHODIUM HEXAMMINE, C-U MISMATCH, G-U MISMATCH, DNA/RNA COMPLEX
1iha	nuc      1.60	CHLORIDE ION 2(CL 1-)	STRUCTURE OF THE HYBRID RNA/DNA R-GCUUCGGC-D[BR]U IN PRESENCE OF RH(NH3)6+++ 5'-R(*GP*CP*UP*UP*CP*GP*GP*C)-D(P*(BRU))-3' DNA/RNA RNA/DNA HYBRID, BROMO URACIL, RHODIUM(III) HEXAMMINE, C-U G- U MISMATCH, DNA/RNA COMPLEX
1ue2	nuc      1.40	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE OF D(GC38GAAAGCT) 5'-D(*GP*(C38)P*GP*AP*AP*AP*GP*CP*T)-3' DNA DNA, BASE-INTERCALATED DUPLEX, MINI-HAIRPIN STRUCTURE, SHEAR PAIR, ZIPPER-LIKE DUPLEX
1ue3	nuc      2.15	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE OF D(GCGAAAGC) CONTAINING HEXAAMMINECOBALT 5'-D(*GP*CP*GP*AP*AP*AP*GP*C)-3' DNA DNA, BASE-INTERCALATED DUPLEX, MINI-HAIRPIN STRUCTURE, SHEARED G:A PAIR, ZIPPER-LIKE DUPLEX
1uhx	nuc      2.00	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE OF D(GCGAGAGC): THE BASE-INTERCALATED DUPL 5'-D(*GP*(CBR)P*GP*AP*GP*AP*GP*C)-3' DNA BASE-INTERCALATED DUPLEX, BASE-INTERCALATED MOTIF, SHEARED G DNA, DEOXYRIBONUCLEIC ACID
1uhy	nuc      1.70	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE OF D(GCGATAGC): THE BASE-INTERCALATED DUPL 5'-D(*GP*(CBR)P*GP*AP*TP*AP*GP*C)-3' DNA BASE-INTERCALATED DUPLEX, BASE-INTERCALATED MOTIF, SHEARED G DNA, DEOXYRIBONUCLEIC ACID
1xpe	nuc      1.94	CHLORIDE ION CL 1-	HIV-1 SUBTYPE B GENOMIC RNA DIMERIZATION INITIATION SITE 5'- R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*GP*CP*GP*CP*AP*CP*GP*GP *CP*AP*AP*G)-3' RNA RNA, LOOP-LOOP COMPLEX, HIV-1
2fcx	nuc      2.00	CHLORIDE ION CL 1-	HIV-1 DIS KISSING-LOOP IN COMPLEX WITH NEAMINE HIV-1 DIS RNA RNA HIV-1, RNA, AMINOGLYCOSIDE, ANTIBIOTICS
2fcy	nuc      2.20	CHLORIDE ION CL 1-	HIV-1 DIS KISSING-LOOP IN COMPLEX WITH NEOMYCIN HIV-1 DIS RNA RNA HIV-1, RNA, AMINOGLYCOSIDE, ANTIBIOTICS
2fd0	nuc      1.80	CHLORIDE ION CL 1-	HIV-1 DIS KISSING-LOOP IN COMPLEX WITH LIVIDOMYCIN HIV-1 DIS RNA RNA HIV-1, RNA, AMINOGLYCOSIDE, ANTIBIOTICS
2fij	nuc      1.19	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE ANALYSIS OF THE A-DNA DECAMER GCGT-2'OMEA- WITH INCORPORATED 2'-O-METHYLATED-ADENOSINE (2'OMEA) AND AR URIDINE (AU) 5'-D(*GP*CP*GP*TP*(A2M)P*(UAR)P*AP*CP*GP*C)-3' DNA ARABINONUCLEIC ACID, SUGAR MODIFICATIONS, A-FORM DNA, DNA
2zy6	nuc      1.75	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE OF A TRUNCATED TRNA, TPHE39A PHENYLALANYL TRANSFER RNA RNA TRUNCATED TRNA
363d	nuc      2.00	CHLORIDE ION 12(CL 1-)	HIGH-RESOLUTION CRYSTAL STRUCTURE OF A FULLY MODIFIED N3'-> PHOSPHORAMIDATE DNA DODECAMER DUPLEX 5'-D(*(C42)P*(G38)P*(C42)P*(G38)P*(A43)P*(A43)P*( P*(NYM)P*(C42)P*(G38)P*(C42)P*DG)-3' DNA A-DNA, MODIFIED, DNA
3c44	nuc      2.00	CHLORIDE ION 2(CL 1-)	CRYSTAL STRUCTURE OF HIV-1 SUBTYPE F DIS EXTENDED DUPLEX RNA BOUND TO PAROMOMYCIN HIV-1 SUBTYPE F GENOMIC RNA RNA HIV-1, RNA, ANTIBIOTIC, PAROMOMYCIN, EXTENDED DUPLEX
3dvv	nuc      2.00	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE OF HIV-1 SUBTYPE F DIS EXTENDED DUPLEX RNA BOUND TO RIBOSTAMYCIN (U267OME) HIV-1 GENOMIC RNA RNA HIV-1, RNA, ANTIBIOTIC, AMINOGLYCOSIDE
3gsj	nuc      1.80	CHLORIDE ION CL 1-	A BULKY RHODIUM COMPLEX BOUND TO AN ADENOSINE-ADENOSINE DNA MISMATCH 5'-D(*CP*GP*GP*AP*AP*AP*TP*TP*AP*CP*CP*G)-3' DNA DNA MISMATCH, METALLOINTERCALATOR, DNA RECOGNITION
4e8s	nuc      1.24	CHLORIDE ION CL 1-	LAMBDA-[RU(TAP)2(DPPZ{ME2}2)]2+ BOUND TO TCGGCGCCGA AT HIGH 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3' DNA INTERCALATION, PHOTOREACTIVE, DNA, RUTHENIUM COMPLEX
4fp6	nuc      1.28	CHLORIDE ION CL 1-	DNA OCTAMER D(GTGGCCAC) WITH 2'-SE MODIFICATION DNA (5'-D(*GP*(2ST)P*GP*GP*CP*CP*AP*C)-3') DNA 2'-SE-THYMIDINE DNA, DNA
4fs5	nuc      1.30	CHLORIDE ION 4(CL 1-)	CRYSTAL STRUCTURE OF THE Z-DNA HEXAMER CGCGCG AT 500 MM MGCL DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, MG2+ BINDING, DNA
4fs6	nuc      1.30	CHLORIDE ION 2(CL 1-)	CRYSTAL STRUCTURE OF THE Z-DNA HEXAMER CGCGCG AT 500 MM CACL DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, CA2+ BINDING, DNA
4hif	nuc      0.85	CHLORIDE ION CL 1-	ULTRAHIGH-RESOLUTION CRYSTAL STRUCTURE OF Z-DNA IN COMPLEX W IONS DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA SELF-COMPLEMENTARY DNA, DNA, Z-DNA
4k27	nuc      2.35	CHLORIDE ION 6(CL 1-)	MYOTONIC DYSTROPHY TYPE 2 RNA: STRUCTURAL STUDIES AND DESIGN MOLECULES THAT MODULATE RNA FUNCTION MYOTONIC DYSTROPHY TYPE 2 RNA RNA A-FORM RNA, MYOTONIC DYSTROPHY TYPE 2, UNKNOWN, RNA
4ltg	nuc      1.18	CHLORIDE ION CL 1-	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 74% RELATIVE HUMIDITY (2/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4lti	nuc      1.41	CHLORIDE ION CL 1-	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 74% RELATIVE HUMIDITY (4/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4ltk	nuc      1.45	CHLORIDE ION CL 1-	DEHYDRATION/REHYDRATION OF A NUCLEIC ACID SYSTEM CONTAINING POLYPYRIDYL RUTHENIUM COMPLEX AT 74% RELATIVE HUMIDITY (6/7 DNA DNA DEHYDRATION, HC1B, KINKING, RUTHENIUM, DNA
4mj9	nuc      0.97	CHLORIDE ION CL 1-	LAMBDA-[RU(TAP)2(DPPZ-10-ME)]2+ BOUND TO A SYNTHETIC DNA OLI DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA METHYL-SUBSTITUTED, INTERCALATION, RUTHENIUM, ASYMMETRIC SUBSTITUTION, DNA
4pco	nuc      1.32	CHLORIDE ION 3(CL 1-)	CRYSTAL STRUCTURE OF DOUBLE-STRANDED RNA WITH FOUR TERMINAL BASE PAIRS RNA (5'-D(*GP*GP*UP*GP*GP*CP*UP*GP*UP*U)-3') RNA GU WOBBLE BASE PAIR MOTIF, RNA
4qio	nuc      0.95	CHLORIDE ION CL 1-	LAMBDA-[RU(TAP)2(DPPZ)]2+ BOUND TO D(TCGGCGCCIA) AT HIGH RES 5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*IP*A)-3' DNA INTERCALATION, RUTHENIUM COMPLEX, INOSINE, DNA
4r8j	nuc      1.21	CHLORIDE ION CL 1-	D(TCGGCGCCGA) WITH LAMBDA-[RU(TAP)2(DPPZ)]2+ SOAKED IN D2O DNA (5'-D(*(THM)P*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA DNA KINKING, INFRA-RED, RUTHENIUM, DNA
4x18	nuc      1.05	CHLORIDE ION CL 1-	[RU(TAP)2(DPPZ-11-ME)]2+ BOUND TO D(TCGGCGCCGA) DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA RUTHENIUM, DNA, SUBSTITUTION, DUPLEX
4xqz	nuc      2.15	CHLORIDE ION 7(CL 1-)	CALCIUM(II) AND COPPER(II) BOUND TO THE Z-DNA FORM OF D(CGCG COMPLEXED BY CHLORIDE AND MES DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, COPPER(II), DNA
4ymc	nuc      1.88	CHLORIDE ION CL 1-	LAMBDA-[RU(TAP)2(DPPZ)]2+ BOUND TO D(CCGGATCCGG)2 DNA (5'-D(*CP*CP*GP*GP*AP*TP*CP*CP*GP*G)-3') DNA RUTHENIUM, COMPLEX, DNA, INTERCALATION
5cnr	nuc      2.59	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE-GUIDED DESIGN OF SELF-ASSEMBLING RNA NANO RNA (5'-R(*AP*GP*AP*GP*GP*AP*CP*GP*GP*CP*G)-3'), RNA (5'-R(*GP*UP*CP*UP*AP*CP*CP*CP*AP*CP*CP*UP*CP 3') RNA SENECA VALLEY VIRUS, NANOTRIANGLE, SELF-ASSEMBLY, RNA
5eme	nuc      1.15	CHLORIDE ION 2(CL 1-)	COMPLEX OF RNA R(GCAGCAGC) WITH ANTISENSE PNA P(CTGCTGC) ANTISENSE PNA STRAND, RNA (5'-R(*GP*CP*AP*GP*CP*AP*GP*C)-3') RNA CAG REPEATS, RNA/PNA, PNA ANTISENSE OLIGOMER, POLY-Q DIESEAS
5emf	nuc      1.14	CHLORIDE ION 2(CL 1-)	CRYSTAL STRUCTURE OF RNA R(GCUGCUGC) WITH ANTISENSE PNA P(GC RNA (5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'), ANTISENSE PNA P(GCAGCAGC) RNA CUG REPEATS, RNA/PNA DUPLEX, ANTISENSE PNA, MYOTONIC DYSTROP 1, RNA
5ew4	nuc      1.47	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE OF C9ORF72 ANTISENSE CCCCGG REPEAT RNA ASS WITH LOU GEHRIG'S DISEASE AND FRONTOTEMPORAL DEMENTIA, CRYS WITH SR2+ RNA (5'- R(*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP*GP*GP*CP 3') RNA REPEAT EXPANSION DISORDER, GENETIC DISEASE, RNA
5jeu	nuc      0.97	CHLORIDE ION CL 1-	DEL-[RU(PHEN)2(DPPZ)]2+ BOUND TO D(TCGGCGCCGA) WITH BA2+ DNA (5'-D(*TP*CP*GP*GP*CP*GP*CP*CP*GP*A)-3') DNA DNA, RUTHENIUM, LIGHT-SWITCH, SEMI-INTERCALATION
5ju4	nuc      2.00	CHLORIDE ION CL 1-	CRYSTAL STRUCTURE OF A DNA SEQUENCE D(CGTGAATTCACG) AT 130K DNA (5'-D(*CP*GP*TP*GP*AP*AP*TP*TP*CP*AP*CP*G)-3' CHAIN: A, B DNA DNA
5lfs	nuc      1.85	CHLORIDE ION CL 1-	LAMBDA-[RU(BPY)2(DPPZ)]2+ BOUND TO BROMINATED DNA DNA (5'-D(*(CBR)P*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*G)-3') DNA DNA, RUTHENIUM, INTERCALATION, LIGHT-SWITCH
5lyu	nuc      2.20	CHLORIDE ION 2(CL 1-)	THE NATIVE CRYSTAL STRUCTURE OF 7SK 5'-HAIRPIN RNA (58-MER) RNA NON-CODING RNA MAJOR GROOVE BASE TRIPLE TRANSCRIPTION, RNA
5lyv	nuc      2.35	CHLORIDE ION CL 1-	THE CRYSTAL STRUCTURE OF 7SK 5'-HAIRPIN - OSMIUM DERIVATIVE RNA (57-MER) RNA NON-CODING RNA MAJOR GROOVE BASE TRIPLE TRANSCRIPTION, RNA

CM0    5-(CARBOXYMETHOXY) URIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2jrg	nuc      NMR    	5-(CARBOXYMETHOXY) URIDINE-5'-MONOPHOSPHATE C11 H15 N2 O12 P	NMR SOLUTION STRUCTURE OF THE ANTICODON OF E. COLI TRNA-VAL3 MODIFICATIONS (CMO5U34 M6A37) 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*(6MZ) P*AP*GP*GP*AP*GP*G)-3' RNA E.COLI, VALINE, TRNA, ANTICODON STEM LOOP, TRNA DOMAIN, RNA URIDINE 5-OXYACETIC ACID, CMO5U, N6-METHYLADENOSINE, M6A, R
2jrq	nuc      NMR    	5-(CARBOXYMETHOXY) URIDINE-5'-MONOPHOSPHATE C11 H15 N2 O12 P	NMR SOLUTION STRUCTURE OF THE ANTICODON OF E. COLI TRNA- VAL3 WITH 1 MODIFICATION (CMO5U34) 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0) P*AP*CP*AP*AP*GP*GP*AP*GP*G)-3' RNA E.COLI, VALINE, TRNA, ANTICODON STEM LOOP, TRNA DOMAIN, RNA HAIRPIN, URIDINE 5-OXYACETIC ACID, CMO5U

CMD    3'-DESAMINO-3'-(3-CYANO-4-MORPHOLINYL)-DOXORUBICIN

Code	Class Resolution	Description
236d	nuc      1.80	3'-DESAMINO-3'-(3-CYANO-4-MORPHOLINYL)-DOXORUBICIN C32 H34 N2 O12	CRYSTAL STRUCTURE OF FOUR MORPHOLINO-DOXORUBICIN ANTICANCER DRUGS COMPLEXED WITH D(CGTACG) AND D(CGATCG): IMPLICATIONS IN DRUG-DNA CROSSLINK DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

CMR    2'-DEOXY-CYTIDINE-5'-RP-MONOMETHYLPHOSPHONATE

Code	Class Resolution	Description
1k1h	nuc      NMR    	2'-DEOXY-CYTIDINE-5'-RP-MONOMETHYLPHOSPHONATE 2(C10 H16 N3 O6 P)	HETERODUPLEX OF CHIRALLY PURE METHYLPHOSPHONATE/DNA DUPLEX 5'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3', 5'-D(*CP*(CMR)P*(RMP)P*(RMP)P*(SMP)P*(CMR) P*(RMP))-3' DNA METHYL PHOSPHONATE, ANTI SENSE, DNA
1k1r	nuc      NMR    	2'-DEOXY-CYTIDINE-5'-RP-MONOMETHYLPHOSPHONATE 2(C10 H16 N3 O6 P)	HETERODUPLEX OF CHIRALLY PURE R-METHYLPHOSPHONATE/DNA DUPLEX 5'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3', 5'-D(*CP*(CMR)P*(RMP)P*(RMP)P*(RMP)P*(CMR) P*(RMP))-3' DNA METHYL PHOSPHONATE, MODIFIED DNA, ANTI SENSE, APTAMERS

CMY    (6-AMINOHEXYL)CARBAMIC ACID

Code	Class Resolution	Description
2dp7	nuc      1.55	(6-AMINOHEXYL)CARBAMIC ACID 2(C7 H16 N2 O2)	CRYSTAL STRUCTURE OF D(CGCGAATXCGCG) WHERE X IS 5-(N- AMINOHEXYL)CARBAMOYL-2'-DEOXYURIDINE DNA (5'- D(*DCP*DGP*DCP*DGP*DAP*DAP*DTP*DUP*DCP*DGP*DCP*DG)-3') DNA MODIFIED NUCLEOTIDE, 5-(N-AMINOHEXYL)CARBAMOYL-2'- DEOXYURIDINE, B-DNA
2dpb	nuc      1.50	(6-AMINOHEXYL)CARBAMIC ACID 2(C7 H16 N2 O2)	CRYSTAL STRUCTURE OF D(CGCGAATXCGCG) WHERE X IS 5-(N- AMINOHEXYL)CARBAMOYL-2'-DEOXYURIDINE DNA (5'- D(*DCP*DGP*DCP*DGP*DAP*DAP*DTP*DUP*DCP*DGP*DCP*DG)-3') DNA MODIFIED NUCLEOTIDE, 5-(N-AMINOHEXYL)CARBAMOYL-2'- DEOXYURIDINE, B-DNA
2dpc	nuc      1.55	(6-AMINOHEXYL)CARBAMIC ACID 2(C7 H16 N2 O2)	CRYSTAL STRUCTURE OF D(CGCGAATXCGCG) WHERE X IS 5-(N- AMINOHEXYL)CARBAMOYL-2'-O-METHYLURIDINE DNA (5'-D(*DCP*DGP*DCP*DGP*DAP*DAP*DTP*(OMU) P*DCP*DGP*DCP*DG)-3') DNA MODIFIED NUCLEOTIDE, 5-(N-AMINOHEXYL)CARBAMOYL-2'-O- METHYLURIDINE, B-DNA
2dqo	nuc      2.30	(6-AMINOHEXYL)CARBAMIC ACID 2(C7 H16 N2 O2)	CRYSTAL STRUCTURE OF D(CXCTXCTTC):R(GAAGAAGAG) WHERE X IS 5- (N-AMINOHEXYL)CARBAMOYL-2'-O-METHYLURIDINE RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3'), DNA (5'-D(*DCP*(OMU)P*DCP*DTP*(OMU) P*DCP*DTP*DTP*DC)-3') DNA-RNA HYBRID MODIFIED NUCLEOTIDE, 5-(N-AMINOHEXYL)CARBAMOYL-2'-O- METHYLURIDINE, A-FORM RNA:DNA HYBRID DUPLEX, DNA-RNA HYBRID
2dqp	nuc      2.10	(6-AMINOHEXYL)CARBAMIC ACID 2(C7 H16 N2 O2)	STRUCTURAL ANALYSES OF DNA:DNA AND RNA:DNA DUPLEXES CONTAINING 5-(N-AMINOHEXYL)CARBAMOYL MODIFIED URIDINES RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3'), DNA (5'-D(*DCP*(OMU)P*DCP*DTP*(OMU) P*DCP*DTP*DTP*DC)-3') DNA-RNA HYBRID MODIFIED NUCLEOTIDE, 5-(N-AMINOHEXYL)CARBAMOYL-2'-O- METHYLURIDINE, A-FORM RNA:DNA HYBRID DUPLEX, DNA-RNA HYBRID
2dqq	nuc      2.00	(6-AMINOHEXYL)CARBAMIC ACID 2(C7 H16 N2 O2)	CRYSTAL STRUCTURE OF D(CXCTXCTTC):R(GAAGAAGAG) WHERE X IS 5- (N-AMINOHEXYL)CARBAMOYL-2'-O-METHYLURIDINE DNA (5'-D(*DCP*(OMU)P*DCP*DTP*(OMU) P*DCP*DTP*DTP*DC)-3'), RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3') DNA-RNA HYBRID MODIFIED NUCLEOTIDE, 5-(N-AMINOHEXYL)CARBAMOYL-2'-O- METHYLURIDINE, A-FORM RNA:DNA HYBRID DUPLEX, DNA-RNA HYBRID

CNC    CO-CYANOCOBALAMIN

Code	Class Resolution	Description
1et4	nuc      2.30	CO-CYANOCOBALAMIN 5(C63 H88 CO N14 O14 P 1+)	CRYSTAL STRUCTURE OF A VITAMIN B12 BINDING RNA APTAMER WITH 2.3 A RNA APTAMER, 35-MER RNA B12 BINDING RNA, VITAMIN B12, COBALAMIN, RNA

CNY    13,15-DIAMINO-2-(AMINOMETHYL)-3,4,9,12- TETRAHYDROXYHEXADECAHYDRO-2H-7,10-EPOXYPYRANO[2,3- B][1,10,4]BENZODIOXAZACYCLODODECIN-8-YL 2,6-DIAMINO-2, 6-DIDEOXYHEXOPYRANOSIDE

Code	Class Resolution	Description
1zz5	nuc      3.00	13,15-DIAMINO-2-(AMINOMETHYL)-3,4,9,12- TETRAHYDROXYHEXADECAHYDRO-2H-7,10-EPOXYPYRANO[2,3- B][1,10,4]BENZODIOXAZACYCLODODECIN-8-YL 2,6-DIAMINO-2, 6-DIDEOXYHEXOPYRANOSIDE 4(C23 H44 N6 O12)	MOLECULAR RECOGNITION OF RNA BY NEOMYCIN AND A RESTRICTED NEOMYCIN DERIVATIVE 5'- R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*CP*GP*G)-3': RIBOSOMAL RNA A-SITE, 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*AP*CP*C)- 3': RIBOSOMAL RNA A-SITE RNA RIBOSOME, RNA, A-SITE. DOUBLE HELIX, RESTRICTED NEOMYCIN, CYCLICNEO, NEOCYCLIC

CO    COBALT (II) ION

Code	Class Resolution	Description
1ekh	nuc      NMR    	COBALT (II) ION CO 2+	NMR STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND CO DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1eki	nuc      NMR    	COBALT (II) ION CO 2+	AVERAGE SOLUTION STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMY COBALT DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1fd5	nuc      1.10	COBALT (II) ION 2(CO 2+)	BINDING OF A MACROCYCLIC BISACRIDINE AND AMETANTRONE TO CGTACG INVOLVES SIMILAR UNUSUAL INTERCALATION PLATFORMS (BISACRIDINE COMPLEX) DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA HIGH RESOLUTION CRYSTAL STRUCTURE, INTERCALATION PLATFORM, MAD, ANTICANCER DRUG, DRUG-DNA COMPLEX, METAL IONS, TERTIARY BASE PAIRS
1fdg	nuc      1.60	COBALT (II) ION 2(CO 2+)	BINDING OF A MACROCYCLIC BISACRIDINE AND AMETANTRONE TO CGTACG INVOLVES SIMILAR UNUSUAL INTERCALATION PLATFORMS (AMETANTRONE COMPLEX) DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA HIGH RESOLUTION CRYSTAL STRUCTURE, INTERCALATION PLATFORM, MAD, ANTICANCER DRUG, DRUG-DNA COMPLEX, METAL IONS, TERTIARY BASE PAIRS
1fn1	nuc      1.60	COBALT (II) ION 2(CO 2+)	CRYSTAL STRUCTURE OF 9-AMINO-(N-(2-DIMETHYLAMINO)BUTYL) ACRIDINE-4-CARBOXAMIDE BOUND TO D(CG(5BR)UACG)2 DNA (5'-D(P*GP*(BRO)UP*AP*CP*G)-3'), DNA (5'-D(*CP*GP*(BRO)UP*AP*CP*G)-3') DNA 9-AMINOACRIDINE-4-CARBOAMIDE, HEXANUCLEOTIDE, X-RAY CRYSTALLOGRAPHY, INTERCALATION, QUADRUPLEX, DNA
1fn2	nuc      1.60	COBALT (II) ION 2(CO 2+)	9-AMINO-(N-(2-DIMETHYLAMINO)BUTYL)ACRIDINE-4-CARBOXAMIDE BOUND TO D(CGTACG)2 DNA (5'-D(*CP*GP*TP*AP*CP*G)-3'), DNA (5'-D(P*GP*TP*AP*CP*G)-3') DNA DNA, ACRIDINE-4-CARBOXAMIDE, INTERCALATION, QUADRUPLEX
1k2l	nuc      2.40	COBALT (II) ION 2(CO 2+)	STRUCTURAL CHARACTERIZATION OF BISINTERCALATION IN HIGHER- ORDER DNA AT A JUNCTION-LIKE QUADRUPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DNA STRAND EXCHANGE, QUADRUPLEX, BISINTERCALATION
1nyi	nuc      2.85	COBALT (II) ION 4(CO 2+)	CROSSLINKED HAMMERHEAD RIBOZYME INITIAL STATE 5'- R(P*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP*GP*AP*GP*GP*CP*C)-3', 5'- R(*GP*CP*CP*GP*AP*AP*AP*CP*UP*CP*GP*UP*AP*AP*GP*AP*GP*UP*CP *AP*CP*CP*AP*C)-3' RNA HAMMERHEAD RIBOZYME CROSSLINK CONFORMATIONAL CHANGE, RNA
1o55	nuc      1.04	COBALT (II) ION CO 2+	MOLECULAR STRUCTURE OF TWO CRYSTAL FORMS OF CYCLIC TRIADENYLIC ACID AT 1 ANGSTROM RESOLUTION DNA (5'-CD(*AP*AP*AP)-3') DNA CYCLIC TRINUCLEOTIDE, DNA
1p24	nuc      3.02	COBALT (II) ION 5(CO 2+)	CRYSTAL STRUCTURE OF COBALT(II)-D(GGCGCC)2 DNA (5'-D(*GP*GP*CP*GP*CP*C)-3') DNA B-DNA, COBALT BINDING
1q29	nuc      3.00	COBALT (II) ION 5(CO 2+)	HAMMERHEAD RIBOZYME WITH 5'-5' G-G LINKAGE: CONFORMATIONAL CHANGE EXPERIMENT 5'- R(*GP*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP*GP*AP*GP*GP*CP*C)-3', RIBOZYME RNA HAMMERHEAD RIBOZYME, RNA
1qzl	nuc      2.85	COBALT (II) ION CO 2+	GCATGCT + COBALT 5'-D(*GP*CP*AP*TP*GP*CP*T)-3' DNA DNA QUADRUPLEX
1rqy	nuc      1.55	COBALT (II) ION 2(CO 2+)	9-AMINO-[N-(2-DIMETHYLAMINO)PROPLY]-ACRIDINE-4-CARBOXAMIDE BOUND TO D(CGTACG)2 5'-D(CP*GP*TP*AP*CP*G)-3' DNA B-DNA, CYTOSINE EXCHANGE, QUADRUPLEX, ACRIDINE, UNUSUAL INTERCALATION
1s23	nuc      1.60	COBALT (II) ION CO 2+	CRYSTAL STRUCTURE ANALYSIS OF THE B-DNA DECAMER CGCAATTGCG 5'-D(*CP*GP*CP*AP*AP*TP*TP*GP*CP*G)-3' DNA DEOXYOLIGONUCLEOTIDE, COBALT, VARIABILITY, DNA
1wvd	nuc      2.93	COBALT (II) ION 8(CO 2+)	HIV-1 DIS(MAL) DUPLEX COCL2-SOAKED 5'- R(*CP*UP*UP*GP*CP*UP*GP*AP*GP*GP*UP*GP*CP*AP*CP*AP*CP*AP*GP *CP*AP*AP*G)-3' RNA HIV-1, RNA, BULGE, METAL IONS
1xcs	nuc      1.40	COBALT (II) ION 2(CO 2+)	STRUCTURE OF OLIGONUCLEOTIDE/DRUG COMPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, DOUBLE HELIX, CO2+, DNA
1xcu	nuc      2.00	COBALT (II) ION 3(CO 2+)	OLIGONUCLEOTID/DRUG COMPLEX 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, ANTHRAQUINONE, CO2+
1z3f	nuc      1.50	COBALT (II) ION 3(CO 2+)	STRUCTURE OF ELLIPTICINE IN COMPLEX WITH A 6-BP DNA 5'-D(*CP*GP*AP*TP*CP*G)-3' DNA ANTICANCER, DNA BINDING, DRUG DESIGN, ELLIPTICINE, INTERCALATOR
2dpc	nuc      1.55	COBALT (II) ION 3(CO 2+)	CRYSTAL STRUCTURE OF D(CGCGAATXCGCG) WHERE X IS 5-(N- AMINOHEXYL)CARBAMOYL-2'-O-METHYLURIDINE DNA (5'-D(*DCP*DGP*DCP*DGP*DAP*DAP*DTP*(OMU) P*DCP*DGP*DCP*DG)-3') DNA MODIFIED NUCLEOTIDE, 5-(N-AMINOHEXYL)CARBAMOYL-2'-O- METHYLURIDINE, B-DNA
379d	nuc      3.10	COBALT (II) ION 8(CO 2+)	THE STRUCTURAL BASIS OF HAMMERHEAD RIBOZYME SELF-CLEAVAGE RNA (5'- R(*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP*GP*AP*GP*GP*CP*C)-3'), RNA (5'- R(*GP*GP*CP*CP*GP*AP*AP*AP*CP*UP*CP*GP*UP*AP*AP*GP*A P*GP*UP*CP*AP*CP*CP*AP*C)-3') RIBOZYME RNA HAMMERHEAD RIBOZYME, CATALYTIC RNA, LOOP
3far	nuc      2.40	COBALT (II) ION 2(CO 2+)	CATION-DEPENDENT SELF-CLEAVAGE ACTIVITY IN THE DUPLEX FORM OF THE SUBTYPE-B HIV-1 RNA DIMERIZATION INITIATION SITE RNA (5'- R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*GP*CP*GP*CP*AP*CP*GP*GP *CP*AP*AP*G)-3') RNA HIV-1, RNA, METAL IONS, CATALYTIC RNA
3ixn	nuc      2.87	COBALT (II) ION 3(CO 2+)	CRYSTAL STRUCTURE OF D(CCGGTACCGG) AS B-DNA DUPLEX DNA (5'-D(*CP*CP*GP*GP*TP*AP*CP*CP*GP*G)-3') DNA B-DNA, DNA
3r86	nuc      2.80	COBALT (II) ION 3(CO 2+)	CRYSTAL STRUCTURE OF D(CCGGTACCGG)2 AS B-DNA DUPLEX GROWN WI COCL2 DNA (5'-D(*CP*CP*GP*GP*TP*AP*CP*CP*GP*G)-3') DNA DUPLEX, DNA
4mnb	nuc      1.40	COBALT (II) ION CO 2+	CRYSTAL STRUCTURE OF A COMPLEX BETWEEN THE MARINE ANTICANCER VARIOLIN B AND DNA 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DNA DUPLEX, INTERCALATION, DRUG BINDING, NUCLEUS, DNA
4pzq	nuc      2.24	COBALT (II) ION 2(CO 2+)	CRYSTAL STRUCTURE OF CCG DNA REPEATS DNA (5'-D(*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*A)-3') DNA I-MOTIF, HEMIPROTONATED CC+ PAIRS, CCG TRIPLET REPEAT, DNA
4qno	nuc      1.66	COBALT (II) ION 2(CO 2+)	CRYSTAL STRUCTURE OF CCG DNA REPEATS AT 1.66 ANGSTROM RESOLU DNA (5'-D(*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*A)-3') DNA I-MOTIF, HEMIPROTONATED CC+ PAIRS, CCG TRIPLET REPEAT, HIGH RESOLUTION STRUCTURE, DNA
4r4a	nuc      1.49	COBALT (II) ION 5(CO 2+)	RACEMIC CRYSTAL STRUCTURE OF A COBALT-BOUND B-DNA DUPLEX 5'-D(*CP*CP*GP*GP*TP*AP*CP*CP*GP*G)-3' DNA RACEMIC DNA, RACEMATES, DNA
4rum	nuc      2.64	COBALT (II) ION 4(CO 2+)	CRYSTAL STRUCTURE OF THE NICO TRANSITION-METAL RIBOSWITCH BO COBALT NICO RIBOSWITCH RNA RNA RNA HELIX, LIGAND SENSOR, COBALT AND NICKEL BINDING, RNA, RI
4rzn	nuc      2.58	COBALT (II) ION 7(CO 2+)	CRYSTAL STRUCTURE OF D(GTGGAATGGAAC) 5'-D(*GP*TP*GP*GP*AP*AP*TP*GP*GP*AP*AP*C)-3' DNA (GGA) MOTIF, DNA EXPANSION IN SCA31 PATIENT, DNA
4u3r	nuc      1.70	COBALT (II) ION 3(CO 2+)	OCTAMERIC RNA DUPLEX CO-CRYSTALLIZED WITH COBALT(II)CHLORIDE RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3') RNA RNA, DUPLEX, DI- AND TRIVALENT METAL IONS
4zkk	nuc      1.80	COBALT (II) ION 3(CO 2+)	THE NOVEL DOUBLE-FOLD STRUCTURE OF D(GCATGCATGC) DNA (5'-D(*GP*CP*AP*TP*GP*CP*AP*TP*GP*C)-3') DNA FOLDED, MINOR-GROOVE TETRAD, BI-LOOP, TRIPLET, DNA
5cki	nuc      2.99	COBALT (II) ION 4(CO 2+)	CRYSTAL STRUCTURE OF 9DB1* DEOXYRIBOZYME (COBALT HEXAMMINE S CRYSTALS) DNA (44-MER), RNA (5'-R(P*GP*CP*AP*CP*UP*AP*GP*AP*UP*CP*GP*GP*A 3') DNA DEOXYRIBOZYME, RNA-LIGASE, CATALYTIC DNA, DNA
5es0	nuc      2.10	COBALT (II) ION 3(CO 2+)	CRYSTAL STRUCTURE OF THE [CO2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX
5fhj	nuc      1.68	COBALT (II) ION 7(CO 2+)	EXTENSIVE AMPHIMORPHISM IN DNA: THREE STABLE CONFORMATIONS F DECADEOXYNUCLEOTIDE D(GCATGCATGC) DNA (5'-D(*GP*CP*AP*TP*GP*CP*AP*TP*GP*C)-3') DNA DNA, AMPHIMORPHISM, DOUBLE-FOLDED, B-TYPE HELIX

CPH    1,8-DIHYDROXY-7-METHYL-3-(1,3,4-TRIHYDROXY-2-OXO- PENTYL)-3,10-DIHYDRO-2H-ANTHRACEN-9-ONE

Code	Class Resolution	Description
1d83	nuc      NMR    	1,8-DIHYDROXY-7-METHYL-3-(1,3,4-TRIHYDROXY-2-OXO- PENTYL)-3,10-DIHYDRO-2H-ANTHRACEN-9-ONE 2(C21 H24 O7)	STRUCTURE REFINEMENT OF THE CHROMOMYCIN DIMER/DNA OLIGOMER COMPLEX IN SOLUTION DNA (5'-D(*AP*AP*GP*GP*CP*CP*TP*T)-3') DNA DNA, NMR, DOUBLE HELIX, CHROMOMYCIN
1ekh	nuc      NMR    	1,8-DIHYDROXY-7-METHYL-3-(1,3,4-TRIHYDROXY-2-OXO- PENTYL)-3,10-DIHYDRO-2H-ANTHRACEN-9-ONE 2(C21 H24 O7)	NMR STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND CO DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1eki	nuc      NMR    	1,8-DIHYDROXY-7-METHYL-3-(1,3,4-TRIHYDROXY-2-OXO- PENTYL)-3,10-DIHYDRO-2H-ANTHRACEN-9-ONE 2(C21 H24 O7)	AVERAGE SOLUTION STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMY COBALT DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1vaq	nuc      2.00	1,8-DIHYDROXY-7-METHYL-3-(1,3,4-TRIHYDROXY-2-OXO- PENTYL)-3,10-DIHYDRO-2H-ANTHRACEN-9-ONE 4(C21 H24 O7)	CRYSTAL STRUCTURE OF THE MG2+-(CHROMOMYCIN A3)2-D(TTGGCCAA) 2 COMPLEX REVEALS GGCC BINDING SPECIFICITY OF THE DRUG DIMER CHELATED BY METAL ION 5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3' DNA CHROMOMYCIN A3, X-RAY DIFFRACTION, MAD, DNA DUPLEX, GGCC SITE, DNA KINK, CD SPECTRA
5erz	nuc      1.75	(1S)-5-DEOXY-1-O-METHYL-1-C-[(2R,3S)-3,5,7,10- TETRAHYDROXY-6-METHYL-4-OXO-1,2,3,4- TETRAHYDROANTHRACEN-2-YL]-D-XYLULOSE 2(C21 H24 O9)	CRYSTAL STRUCTURE OF THE [NI2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX
5es0	nuc      2.10	(1S)-5-DEOXY-1-O-METHYL-1-C-[(2R,3S)-3,5,7,10- TETRAHYDROXY-6-METHYL-4-OXO-1,2,3,4- TETRAHYDROANTHRACEN-2-YL]-D-XYLULOSE 2(C21 H24 O9)	CRYSTAL STRUCTURE OF THE [CO2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX

CPN    2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-CYTOSINE

Code	Class Resolution	Description
176d	nuc      NMR    	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-CYTOSINE 2(C10 H16 N5 O4 1+)	NMR SOLUTION STRUCTURE OF A PEPTIDE NUCLEIC ACID COMPLEXED W DNA (5'-D(*GPN*APN*APN*CPN*TPN*CPN)-3'), RNA (5'-R(P*GP*AP*GP*UP*UP*C)-3') PEPTIDE NUCLEIC ACID/RNA RNA, PNA, DOUBLE HELIX, PEPTIDE NUCLEIC ACID-RNA COMPLEX
1nr8	nuc      1.66	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-CYTOSINE C10 H16 N5 O4 1+	THE CRYSTAL STRUCTURE OF A D-LYSINE-BASED CHIRAL PNA-DNA DUP 5'-D(P*AP*GP*TP*GP*AP*TP*CP*TP*AP*C)-3', H-((GPN)*(TPN)*(APN)*(GPN)*(A66)*(T66)*(C66)*(APN *(TPN))-NH2 DNA/PEPTIDE NUCLEIC ACID CHIRAL PEPTIDE NUCLEIC ACID, DOUBLE STRANDED HELIX, P-FORM, PEPTIDE NUCLEIC ACID COMPLEX
1pdt	nuc      NMR    	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-CYTOSINE 2(C10 H16 N5 O4 1+)	PD235, PNA-DNA DUPLEX, NMR, 8 STRUCTURES DNA (5'-D(*GP*AP*CP*AP*TP*AP*GP*C)-3', PEPTIDE NUCLEIC ACID (COOH-P(*G*C*T*A*T*G*T*C)-NH CHAIN: B PEPTIDE NUCLEIC ACID/DNA COMPLEX (PEPTIDE NUCLEIC ACID-DNA), NUCLEIC ACID COMPLEX, DU HYBRID, PEPTIDE NUCLEIC ACID-DNA COMPLEX
5eme	nuc      1.15	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-CYTOSINE 3(C10 H16 N5 O4 1+)	COMPLEX OF RNA R(GCAGCAGC) WITH ANTISENSE PNA P(CTGCTGC) ANTISENSE PNA STRAND, RNA (5'-R(*GP*CP*AP*GP*CP*AP*GP*C)-3') RNA CAG REPEATS, RNA/PNA, PNA ANTISENSE OLIGOMER, POLY-Q DIESEAS
5emf	nuc      1.14	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-CYTOSINE 3(C10 H16 N5 O4 1+)	CRYSTAL STRUCTURE OF RNA R(GCUGCUGC) WITH ANTISENSE PNA P(GC RNA (5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'), ANTISENSE PNA P(GCAGCAGC) RNA CUG REPEATS, RNA/PNA DUPLEX, ANTISENSE PNA, MYOTONIC DYSTROP 1, RNA

CPT    CISPLATIN

Code	Class Resolution	Description
1a2e	nuc      1.63	CISPLATIN CL2 H6 N2 PT	CRYSTAL STRUCTURE OF A DOUBLE-STRANDED DNA DECAMER CONTAININ CISPLATIN INTERSTRAND CROSS-LINK ADDUCT DNA (5'-D(*CP*CP*TP*CP*GP*CP*TP*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*AP*GP*CP*GP*AP*GP*G)-3') DNA ANTITUMOR DRUG, CIS-DDP, INTERSTRAND CROSS-LINK, DNA
1a84	nuc      NMR    	CISPLATIN CL2 H6 N2 PT	NMR SOLUTION STRUCTURE OF A DNA DODECAMER DUPLEX CONTAINING DIAMMINEPLATINUM(II) D(GPG) INTRASTRAND CROSS-LINK, THE MAJ OF THE ANTICANCER DRUG CISPLATIN, 1 STRUCTURE DNA D(GGAGACCAGAGG), DNA D(CCTCTG*G*TCTCC) DNA DEOXYRIBONUCLEIC ACID, CISPLATIN, DNA, DUPLEX, DODECAMER, HM INTERACTION
1aio	nuc      2.60	CISPLATIN 2(CL2 H6 N2 PT)	CRYSTAL STRUCTURE OF A DOUBLE-STRANDED DNA CONTAINING THE MA OF THE ANTICANCER DRUG CISPLATIN DNA (5'-D(*GP*GP*AP*GP*AP*CP*CP*AP*GP*AP*GP*G)-3' CHAIN: B, D, DNA (5'-D(*CP*CP*(BRU)P*CP*TP*[PT(NH3)2(GP*GP) ]*TP*CP*TP*CP*C)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIE
1au5	nuc      NMR    	CISPLATIN CL2 H6 N2 PT	SOLUTION STRUCTURE OF INTRASTRAND CISPLATIN-CROSSLINKED DNA D(CCTG*G*TCC):D(GGACCAGG), NMR, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*GP*GP*AP*CP*CP*AP*GP*G)-3'), DNA (5'-D(*CP*CP*TP*GP*GP*TP*CP*C)-3') DNA INTRASTRAND, CISPLATIN, DNA, DEOXYRIBONUCLEIC ACID
1da4	nuc      NMR    	CISPLATIN CL2 H6 N2 PT	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE CIS-PT(NH3 )-N7-(G)-N7(G)N7(G)]ADDUCT AS DETERMINED WITH HIGH FIELD NM MOLECULAR MECHANICS/DYNAMICS DNA (5'-D(P*GP*TP*GP*AP*GP*CP*AP*CP*TP*AP*GP*AP*G CHAIN: B, DNA (5'-D(P*CP*TP*CP*TP*AP*GP*TP*GP*CP*TP*CP*AP*C CHAIN: A DNA DNA
1da5	nuc      NMR    	CISPLATIN CL2 H6 N2 PT	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE CIS-PT(NH3 )-N7-(G)-N7(G)N7(G)]ADDUCT AS DETERMINED WITH HIGH FIELD NM MOLECULAR MECHANICS/DYNAMICS DNA (5'-D(P*GP*TP*GP*AP*GP*CP*AP*CP*TP*AP*GP*AP*G CHAIN: B, DNA (5'-D(P*CP*TP*CP*TP*AP*GP*TP*GP*CP*TP*CP*AP*C CHAIN: A DNA DNA
1ddp	nuc      NMR    	CISPLATIN CL2 H6 N2 PT	SOLUTION STRUCTURE OF A CISPLATIN-INDUCED [CATAGCTATG]2 INTE CROSS-LINK DNA (5'-D(*CP*AP*TP*AP*GP*CP*TP*AP*TP*G)-3') DNA DNA, DOUBLE HELIX, ANTITUMOR DRUG, CIS-DDP, INTERSTRAND CROS
1i1p	nuc      1.63	CISPLATIN CL2 H6 N2 PT	REFINEMENT INCLUDING EXPERIMENTAL MAD PHASES ALLOWS AN EXHAU STUDY OF ORDERED SOLVENT MOLECULES FOR A PLATINATED DECANUC 5'-D(*CP*CP*TP*CP*GP*CP*TP*CP*TP*C)-3', 5'-D(*GP*AP*GP*AP*GP*CP*GP*AP*GP*G)-3' DNA ANTITUMOR DRUG, CIS-DDP, INTERSTRAND CROSS-LINK, DEOXYRIBONU ACID, SPERMINE, DNA
1ksb	nuc      NMR    	CISPLATIN CL2 H6 N2 PT	RELATIONSHIP OF SOLUTION AND PROTEIN-BOUND STRUCTURES OF DNA WITH THE MAJOR INTRASTRAND CROSS-LINK LESIONS FORMED ON CIS BINDING TO DNA 5'-D(*AP*GP*GP*CP*CP*GP*GP*AP*G)-3', 5'-D(*CP*TP*CP*CP*GP*GP*CP*CP*T)-3' DNA DEOXYRIBONUCLEIC ACID, CISPLATIN, DNA, DUPLEX, 9-MER, INTRAS CROSS-LINK, MODEL J
2npw	nuc      NMR    	CISPLATIN CL2 H6 N2 PT	SOLUTION STRUCTURES OF A DNA DODECAMER DUPLEX WITH A CISPLAT D(GG) INTRASTRAND CROSS-LINK 5'-D(*CP*CP*TP*CP*AP*GP*GP*CP*CP*TP*CP*C)-3', 5'-D(*GP*GP*AP*GP*GP*CP*CP*TP*GP*AP*GP*G)-3' DNA DEOXYRIBONUCLEIC ACID, CISPLATIN, DNA, DUPLEX, DODECAMER
2nq0	nuc      NMR    	CISPLATIN CL2 H6 N2 PT	SOLUTION STRUCTURES OF A DNA DODECAMER DUPLEX WITH A CISPLAT D(GG) INTRASTRAND CROSS-LINK 5'-D(*CP*CP*TP*CP*AP*GP*GP*CP*CP*TP*CP*C)-3', 5'-D(*GP*GP*AP*GP*GP*CP*CP*TP*GP*AP*GP*G)-3' DNA DEOXYRIBONUCLEIC ACID, CISPLATIN, DNA, DUPLEX, DODECAMER
3lpv	nuc      1.77	CISPLATIN 2(CL2 H6 N2 PT)	X-RAY CRYSTAL STRUCTURE OF DUPLEX DNA CONTAINING A CISPLATIN D(GPG) INTRASTRAND CROSS-LINK 5'-D(*CP*CP*TP*CP*TP*GP*GP*TP*CP*TP*CP*C)-3', 5'-D(*GP*GP*AP*GP*AP*CP*CP*AP*GP*AP*GP*G)-3' DNA CISPLATIN, DNA

CR    CHROMIUM ION

Code	Class Resolution	Description
4r15	nuc      0.97	CHROMIUM ION 3(CR 3+)	HIGH-RESOLUTION CRYSTAL STRUCTURE OF Z-DNA IN COMPLEX WITH C CATIONS DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA SELF-COMPLEMENTARY DNA, Z-DNA, DNA

CRH    1,2-HYDRO-1-OXY-3,4-HYDRO-3-(1-METHOXY-2-OXY-3,4- DIHYDROXYPENTYL)-8,9-DIHYROXY-7-METHYLANTHRACENE

Code	Class Resolution	Description
146d	nuc      NMR    	1,2-HYDRO-1-OXY-3,4-HYDRO-3-(1-METHOXY-2-OXY-3,4- DIHYDROXYPENTYL)-8,9-DIHYROXY-7-METHYLANTHRACENE 2(C21 H24 O7)	SOLUTION STRUCTURE OF THE MITHRAMYCIN DIMER-DNA COMPLEX DNA (5'-D(*TP*CP*GP*CP*GP*A)-3') DNA DNA, NMR, MITHRAMYCIN DIMER
207d	nuc      NMR    	1,2-HYDRO-1-OXY-3,4-HYDRO-3-(1-METHOXY-2-OXY-3,4- DIHYDROXYPENTYL)-8,9-DIHYROXY-7-METHYLANTHRACENE 4(C21 H24 O7)	SOLUTION STRUCTURE OF MITHRAMYCIN DIMERS BOUND TO PARTIALLY OVERLAPPING SITES ON DNA DNA (5'-D(*TP*AP*GP*CP*TP*AP*GP*CP*TP*A)-3') DNA DNA, NMR, DOUBLE HELIX, MITHRAMYCIN

CS    CESIUM ION

Code	Class Resolution	Description
1i0j	nuc      1.06	CESIUM ION 3(CS 1+)	1.06 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-METHYL-3'-METHYLENEPHOSPHONATE (T23) THYMINE IN PLACE OF T6, HIGH CS-SALT 5'-D(*GP*CP*GP*TP*AP*(T23)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
1i0k	nuc      1.05	CESIUM ION 3(CS 1+)	1.05 A STRUCTURE OF THE A-DECAMER GCGTATACGC WITH A SINGLE 2'-O-METHYL-[TRI(OXYETHYL)] THYMINE IN PLACE OF T6, MEDIUM CS-SALT 5'-D(*GP*CP*GP*TP*AP*(126)P*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, MODIFIED SUGAR, DNA
2qwy	nuc      2.80	CESIUM ION 2(CS 1+)	SAM-II RIBOSWITCH BOUND TO S-ADENOSYLMETHIONINE SAM-II RIBOSWITCH RNA MRNA, RIBOSWITCH, SAM, S-ADENOSYLMETHIONINE, ADOMET, RNA- LIGAND COMPLEX, DOUBLE HELIX, PSEUDOKNOT, BASE TRIPLE
3dim	nuc      2.90	CESIUM ION 2(CS 1+)	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH LYSINE, CS+ SOAK RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3f2x	nuc      3.11	CESIUM ION 4(CS 1+)	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, CS+ SO FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, CESIUM, RNA
3skw	nuc      2.95	CESIUM ION 6(CS 1+)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, CESIUM SOAK RNA (66-MER) RNA THREE-WAY RNA JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
4e8r	nuc      3.36	CESIUM ION 35(CS 1+)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF CS+ AND MG2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4ena	nuc      2.85	CESIUM ION 5(CS 1+)	CRYSTAL STRUCTURE OF FLUORIDE RIBOSWITCH, SOAKED IN CS+ FLUORIDE RIBOSWITCH RNA PSEUDOKNOT, RNA
4jf2	nuc      2.28	CESIUM ION 15(CS 1+)	STRUCTURE OF A CLASS II PREQ1 RIBOSWITCH REVEALS LIGAND RECO A NEW FOLD PREQ1-II RIBOSWITCH RNA RIBOSWITCH, H-TYPE PSEUDOKNOT, RNA
5d5l	nuc      2.50	CESIUM ION 32(CS 1+)	PREQ1-II RIBOSWITCH WITH AN ENGINEERED G-U WOBBLE PAIR BOUND PREQ1-II RIBOSWITCH RNA GU WOBBLE, PSEUDOKNOT, SHINE-DALGARNO SEQUENCE, RNA

CSL    (D)-2'-METHYLSELENYL-2'-DEOXYCYTIDINE-5'-PHOSPHATE

Code	Class Resolution	Description
1yls	nuc      3.00	(D)-2'-METHYLSELENYL-2'-DEOXYCYTIDINE-5'-PHOSPHATE 6(C10 H16 N3 O7 P SE)	CRYSTAL STRUCTURE OF SELENIUM-MODIFIED DIELS-ALDER RIBOZYME WITH THE PRODUCT OF THE REACTION BETWEEN N-PENTYLMALEIMIDE COVALENTLY ATTACHED 9-HYDROXYMETHYLANTHRACENE RNA DIELS-ALDER RIBOZYME, RNA DIELS-ALDER RIBOZYME RNA CARBON-CARBON BOND FORMATION, CATALYTIC MECHANISM, DIELS-ALD REACTION, RIBOZYME, RNA
4ys5	nuc      1.65	(D)-2'-METHYLSELENYL-2'-DEOXYCYTIDINE-5'-PHOSPHATE C10 H16 N3 O7 P SE	DNA SEQUENCE CONTAINING 2'-SE-DC MODIFICATION DNA (5'-D(*GP*TP*GP*GP*(2SC)P*CP*AP*C)-3') DNA DNA, SELENIUM

CSM    1-{2,5-ANHYDRO-6-O-METHYL-4-[(PHOSPHONOOXY)METHYL]- ALPHA-L-MANNOFURANOSYL}PYRIMIDINE-2,4(1H,3H)-DIONE

Code	Class Resolution	Description
3uke	nuc      1.68	1-{2,5-ANHYDRO-6-O-METHYL-4-[(PHOSPHONOOXY)METHYL]- ALPHA-L-MANNOFURANOSYL}PYRIMIDINE-2,4(1H,3H)-DIONE 2(C12 H17 N2 O10 P)	(S)-CMOE-BNA DECAMER STRUCTURE DNA (5'-D(*GP*CP*GP*TP*AP*(CSM)P*AP*CP*GP*C)-3') DNA A-FORM DNA, BICYCLIC NUCLEIC ACID, BNA, DNA, C-MOE-BNA, ANTI OLIGONUCLEOTIDES

CTG    (5R,6S)-5,6-DIHYDRO-5,6-DIHYDROXYTHYMIDINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
2kh5	nuc      NMR    	(5R,6S)-5,6-DIHYDRO-5,6-DIHYDROXYTHYMIDINE-5'- MONOPHOSPHATE C10 H17 N2 O10 P	SOLUTION STRUCTURE OF CIS-5R,6S-THYMINE GLYCOL OPPOSITE COMPLEMENTARY ADENINE IN DUPLEX DNA 5'-D(*AP*CP*AP*AP*AP*CP*AP*CP*GP*CP*AP*C)-3', 5'-D(*GP*TP*GP*CP*GP*(CTG)P*GP*TP*TP*TP*GP*T)-3' DNA THYMINE GLYCOL, DNA
2kh6	nuc      NMR    	(5R,6S)-5,6-DIHYDRO-5,6-DIHYDROXYTHYMIDINE-5'- MONOPHOSPHATE C10 H17 N2 O10 P	SOLUTION STRUCTURE OF CIS-5R,6S-THYMINE GLYCOL OPPOSITE COMPLEMENTARY ADENINE IN DUPLEX DNA 5'-D(*GP*TP*GP*CP*GP*(CTG)P*GP*TP*TP*TP*GP*T)-3', 5'-D(*AP*CP*AP*AP*AP*CP*AP*CP*GP*CP*AP*C)-3' DNA THYMINE GLYCOL, DNA
2kh7	nuc      NMR    	(5R,6S)-5,6-DIHYDRO-5,6-DIHYDROXYTHYMIDINE-5'- MONOPHOSPHATE C10 H17 N2 O10 P	SOLUTION STRUCTURE OF CIS-5R,6S-THYMINE GLYCOL OPPOSITE COMPLEMENTARY GUANINE IN DUPLEX DNA 5'-D(*AP*CP*AP*AP*AP*CP*GP*CP*GP*CP*AP*C)-3', 5'-D(*GP*TP*GP*CP*GP*(CTG)P*GP*TP*TP*TP*GP*T)-3' DNA THYMINE GLYCOL, NMR, DNA
2kh8	nuc      NMR    	(5R,6S)-5,6-DIHYDRO-5,6-DIHYDROXYTHYMIDINE-5'- MONOPHOSPHATE C10 H17 N2 O10 P	SOLUTION STRUCTURE OF CIS-5R,6S-THYMINE GLYCOL OPPOSITE COMPLEMENTARY GUANINE IN DUPLEX DNA 5'-D(*AP*CP*AP*AP*AP*CP*GP*CP*GP*CP*AP*C)-3', 5'-D(*GP*TP*GP*CP*GP*(CTG)P*GP*TP*TP*TP*GP*T)-3' DNA THYMINE GLYCOL, DNA, NMR

CTI    1,2-DIMETHOXY-12-METHYL[1,3]BENZODIOXOLO[5,6- C]PHENANTHRIDIN-12-IUM

Code	Class Resolution	Description
4d9y	nuc      2.10	1,2-DIMETHOXY-12-METHYL[1,3]BENZODIOXOLO[5,6- C]PHENANTHRIDIN-12-IUM C21 H18 N O4 1+	THE CRYSTAL STRUCTURE OF CHELERYTHRINE BOUND TO DNA D(CGTACG DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA DRUG-DNA COMPLEX, DOUBLE HELIX, DNA

CU    COPPER (II) ION

Code	Class Resolution	Description
1d39	nuc      1.20	COPPER (II) ION 6(CU 2+)	COVALENT MODIFICATION OF GUANINE BASES IN DOUBLE STRANDED DNA: THE 1.2 ANGSTROMS Z-DNA STRUCTURE OF D(CGCGCG) IN THE PRESENCE OF CUCL2 DNA (5'-D(*CP*(CU)GP*CP*(CU)GP*CP*(CU)G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1d40	nuc      1.30	COPPER (II) ION 3(CU 2+)	BASE SPECIFIC BINDING OF COPPER(II) TO Z-DNA: THE 1.3- ANGSTROMS SINGLE CRYSTAL STRUCTURE OF D(M5CGUAM5CG) IN THE PRESENCE OF CUCL2 DNA (5'-D(*(5CM)P*(CU)GP*UP*AP*(5CM)P*(CU)G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED
1jes	nuc      1.50	COPPER (II) ION 2(CU 2+)	CRYSTAL STRUCTURE OF A COPPER-MEDIATED BASE PAIR IN DNA 5'-D(*CP*GP*CP*GP*(DPY)P*AP*TP*(DRP) P*CP*GP*CP*G)-3' DNA CU, COPPER, DNA, METAL, Z-DNA, DODECAMER, DUPLEX, UNNATURAL, DESIGNED
2jja	nuc      1.30	COPPER (II) ION CU 2+	CRYSTAL STRUCTURE OF GNA WITH SYNTHETIC COPPER BASE PAIR GNA RNA NUCLEIC ACID, SYNTHETIC BASE PAIR, GLYCOL NUCLEIC ACID, GNA, RNA
4u78	nuc      1.50	COPPER (II) ION 2(CU 2+)	OCTAMERIC RNA DUPLEX SOAKED IN COPPER(II)CHLORIDE RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3') RNA RNA, DUPLEX, DIVALENT METAL IONS
4xqz	nuc      2.15	COPPER (II) ION 6(CU 2+)	CALCIUM(II) AND COPPER(II) BOUND TO THE Z-DNA FORM OF D(CGCG COMPLEXED BY CHLORIDE AND MES DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, COPPER(II), DNA
4xsn	nuc      1.45	COPPER (II) ION CU 2+	COPPER(II) BOUND TO THE Z-DNA FORM OF D(CGCGCG) DNA (5'-D(*CP*(BGM)P*CP*GP*CP*GP)-3') DNA Z-DNA, COPPER(II), DNA
5ihd	nuc      1.57	COPPER (II) ION 4(CU 2+)	CALCIUM(II) AND COPPER(II) BOUND TO THE Z-DNA FORM OF D(CGCG COMPLEXED BY L-LACTATE AND SUCCINATE DNA (5'-D(*CP*GP*CP*GP*CP*G)-3') DNA Z-DNA, COPPER(II), DNA

CUF    [2,2'-{(4,5-DIFLUOROBENZENE-1,2-DIYL)BIS[(NITRILO- KAPPAN)METHYLYLIDENE]}BIS{5-[2-(PIPERIDIN-1-YL) ETHOXY]PHENOLATO-KAPPAO}(2-)]COPPER (II)

Code	Class Resolution	Description
3qsc	nuc      2.40	[2,2'-{(4,5-DIFLUOROBENZENE-1,2-DIYL)BIS[(NITRILO- KAPPAN)METHYLYLIDENE]}BIS{5-[2-(PIPERIDIN-1-YL) ETHOXY]PHENOLATO-KAPPAO}(2-)]COPPER (II) C34 H38 CU F2 N4 O4	THE FIRST CRYSTAL STRUCTURE OF A HUMAN TELOMERIC G-QUADRUPLE BOUND TO A METAL-CONTAINING LIGAND (A COPPER COMPLEX) 5'-D(*AP*GP*GP*GP*TP*(BRU)P*AP*GP*GP*GP*TP*T)-3' DNA PARALLEL, TELOMERE, QUADRUPLEX, DRUG, DNA, METAL COMPLEX, CO COMPLEX

CUL    COPPER (II) CHLORIDE

Code	Class Resolution	Description
1d40	nuc      1.30	COPPER (II) CHLORIDE CL2 CU	BASE SPECIFIC BINDING OF COPPER(II) TO Z-DNA: THE 1.3- ANGSTROMS SINGLE CRYSTAL STRUCTURE OF D(M5CGUAM5CG) IN THE PRESENCE OF CUCL2 DNA (5'-D(*(5CM)P*(CU)GP*UP*AP*(5CM)P*(CU)G)-3') DNA Z-DNA, DOUBLE HELIX, MODIFIED

CVC    [(1~{R},5~{R},6~{R},8~{R})-6-(4-AZANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-3,3-BIS(OXIDANYL)-2,4,7-TRIOXA- 3$L^{4}-VANADABICYCLO[3.3.0]OCTAN-8-YL]METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
5eao	nuc      2.99	[(1~{R},5~{R},6~{R},8~{R})-6-(4-AZANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-3,3-BIS(OXIDANYL)-2,4,7-TRIOXA- 3$L^{4}-VANADABICYCLO[3.3.0]OCTAN-8-YL]METHYL DIHYDROGEN PHOSPHATE C9 H14 N3 O10 P V	TWO ACTIVE SITE DIVALENT ION IN THE CRYSTAL STRUCTURE OF THE HAMMERHEAD RIBOZYME BOUND TO A TRANSITION STATE ANALOG-MG2+ RNA (5'-R(*GP*GP*GP*CP*GP*U*(CVC) *UP*GP*GP*GP*CP*AP*GP*UP*AP*CP*CP*CP*A)-3'), RNA (48-MER) RNA RIBOZYME, HAMMERHEAD, RNA
5eaq	nuc      3.20	[(1~{R},5~{R},6~{R},8~{R})-6-(4-AZANYL-2-OXIDANYLIDENE- PYRIMIDIN-1-YL)-3,3-BIS(OXIDANYL)-2,4,7-TRIOXA- 3$L^{4}-VANADABICYCLO[3.3.0]OCTAN-8-YL]METHYL DIHYDROGEN PHOSPHATE C9 H14 N3 O10 P V	TWO ACTIVE SITE DIVALENT ION IN THE CRYSTAL STRUCTURE OF THE HAMMERHEAD RIBOZYME BOUND TO A TRANSITION STATE ANALOG-MN2+ RNA (48-MER), RNA (5'-R(*GP*GP*GP*CP*GP*U*(CVC) *UP*GP*GP*GP*CP*AP*GP*UP*AP*CP*CP*CP*A)-3') RNA RIBOZYME, HAMMERHEAD, RNA

CYE    45-(3-AMINOPROPYL)-5,11,22,28,34-PENTAMETHYL-3,9,15, 20,26,32,38,43-OCTAOXO-2,5,8,14,19,22,25,28,31,34,37, 42,45,48-TETRADECAAZA-11-AZONIAHEPTACYCLO[42.2.1.1~4, 7~.1~10,13~.1~21,24~.1~27,30~.1~33,36~]DOPENTACONTA- 1(46),4(52),6,10(51),12,21(50),23,27(49),

Code	Class Resolution	Description
1pqq	nuc      NMR    	45-(3-AMINOPROPYL)-5,11,22,28,34-PENTAMETHYL-3,9,15, 20,26,32,38,43-OCTAOXO-2,5,8,14,19,22,25,28,31,34,37, 42,45,48-TETRADECAAZA-11-AZONIAHEPTACYCLO[42.2.1.1~4, 7~.1~10,13~.1~21,24~.1~27,30~.1~33,36~]DOPENTACONTA- 1(46),4(52),6,10(51),12,21(50),23,27(49), C45 H55 N16 O8 1+	NMR STRUCTURE OF A CYCLIC POLYAMIDE-DNA COMPLEX 5'-D(*CP*GP*CP*TP*AP*AP*CP*AP*GP*GP*C)-3', 5'-D(*GP*CP*CP*TP*GP*TP*TP*AP*GP*CP*G)-3' DNA DNA

CYY    2-DEOXYSTREPTAMINE

Code	Class Resolution	Description
1at8	nuc      model  	2-DEOXYSTREPTAMINE C6 H14 N2 O3	THEORETICAL MODEL OF THE REV BINDING ELEMENT (RBE, 30 RIBONUCLEOTIDE FRAGMENT) OF HUMAN IMMUNODEFICIENCY VIRUS-1 COMPLEXED WITH NEOMYCIN B REV BINDING ELEMENT: 30 RIBONUCLEOTIDE FRAGMENT RIBONUCLEIC ACID RNA/AMINOGLYCOSIDE COMPLEX, MRNA TRANSPORT, INHIBITION OF VIRAL REPLICATION, RIBONUCLEIC ACID
1auf	nuc      model  	2-DEOXYSTREPTAMINE C6 H14 N2 O3	THEORETICAL MODEL OF THE REV BINDING ELEMENT (RBE, 30 RIBONUCLEOTIDE FRAGMENT) OF HUMAN IMMUNODEFICIENCY VIRUS-1 COMPLEXED WITH TOBRAMYCIN REV BINDING ELEMENT: 30 RIBONUCLEOTIDE FRAGMENT RIBONUCLEIC ACID RNA/AMINOGLYCOSIDE COMPLEX, MRNA TRANSPORT, INHIBITION OF VIRAL REPLICATION, RIBONUCLEIC ACID
1pbr	nuc      NMR    	2-DEOXYSTREPTAMINE C6 H14 N2 O3	STRUCTURE OF 16S RIBOSOMAL RNA, NMR, MINIMIZED AVERAGE STRUC 16S RIBOSOMAL RNA RNA AMINOGLYCOSIDE, RIBOSOMAL RNA, RNA TRANSCRIPT, ANTIBIOTIC, RIBONUCLEIC ACID, RNA
1qd3	nuc      NMR    	2-DEOXYSTREPTAMINE C6 H14 N2 O3	HIV-1 TAR RNA/NEOMYCIN B COMPLEX HIV-1 TAR RNA: RESIDUES 17-45 RNA NMR, HIV-1, AMINOGLYCOSIDE-RNA-COMPLEX, MINOR GROOVE BINDING

D00    2'-DEOXY-N-ETHYLCYTIDINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
1n4b	nuc      NMR    	2'-DEOXY-N-ETHYLCYTIDINE 5'-(DIHYDROGEN PHOSPHATE) C11 H18 N3 O7 P	SOLUTION STRUCTURE OF THE UNDECAMER CGAAAC*TTTCG 5'-D(*CP*GP*AP*AP*AP*D00*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*CP*TP*TP*TP*CP*G)-3' DNA INTERSTRAND CROSS-LINK, ALKYLATED DNA, MODIFIED CYTOSINE, AL CYTOSINE, DNA

D18    2,5-BIS{[4-(N-ISOPROPYL)DIAMINOMETHYL]PHENYL}FURAN

Code	Class Resolution	Description
298d	nuc      2.20	2,5-BIS{[4-(N-ISOPROPYL)DIAMINOMETHYL]PHENYL}FURAN C24 H32 N4 O	TARGETING THE MINOR GROOVE OF DNA: CRYSTAL STRUCTURES OF TWO COMPLEXES BETWEEN FURAN DERIVATIVES OF BERENIL AND THE DNA DODECAMER D(CGCGAATTCGCG)2 DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

D19    2,5-BIS{[4-(N-CYCLOPROPYLDIAMINOMETHYL)PHENYL]}FURAN

Code	Class Resolution	Description
289d	nuc      2.20	2,5-BIS{[4-(N-CYCLOPROPYLDIAMINOMETHYL)PHENYL]}FURAN C24 H28 N4 O	TARGETING THE MINOR GROOVE OF DNA: CRYSTAL STRUCTURES OF TWO COMPLEXES BETWEEN FURAN DERIVATIVES OF BERENIL AND THE DNA DODECAMER D(CGCGAATTCGCG)2 DNA (5'-R(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

D1B    2-(5-{4-[AMINO(IMINO)METHYL]PHENYL}-2- THIENYL)-1H-BENZIMIDAZOLE-6- CARBOXIMIDAMIDE DIHYDROCHLORIDE

Code	Class Resolution	Description
1vzk	nuc      1.77	2-(5-{4-[AMINO(IMINO)METHYL]PHENYL}-2- THIENYL)-1H-BENZIMIDAZOLE-6- CARBOXIMIDAMIDE DIHYDROCHLORIDE C19 H16 N6 S	A THIOPHENE BASED DIAMIDINE FORMS A "SUPER" AT BINDING MINOR GROOVE AGENT 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP *CP*G)-3' NUCLEIC ACID NUCLEIC ACID, NUCLEIC ACIDS, MINOR GROOVE BINDER, DOUBLE HELIX, DNA-DRUG COMPLEX, MAGNESIUM-WATER COMPLEX, DNA HYDRATION

D24    2,5-BIS-[4-[CYCLOPENTA-1,3-DIEN-5-YLAMINO-1- AMINOMETHYL]-PHEN-1-YL]FURAN

Code	Class Resolution	Description
1eel	nuc      2.40	2,5-BIS-[4-[CYCLOPENTA-1,3-DIEN-5-YLAMINO-1- AMINOMETHYL]-PHEN-1-YL]FURAN C28 H28 N4 O	STRUCTURE OF A COMPLEX BETWEEN THE DNA SEQUENCE DCGCGAATTCGCG AND BIS[PIPERIDINO-ETHYL]-FURAMIDINE 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA MINOR GROOVE BINDING LIGAND, B-DNA, BULKY SIDE-CHAINS

D2A    2-(4'-AMIDINOBIPHENYL-4-YL)-1H-BENZIMIDAZOLE-5-AMIDINE

Code	Class Resolution	Description
2b0k	nuc      1.64	2-(4'-AMIDINOBIPHENYL-4-YL)-1H-BENZIMIDAZOLE-5-AMIDINE C21 H18 N6	CRYSTAL STRUCTURE OF THE DB921-D(CGCGAATTCGCG)2 COMPLEX. 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA NUCLEIC ACIDS, DNA, DOUBLE HELIX, MINOR GROOVE, DNA MINOR GROOVE BINDER, DNA MINOR GROOVE-LIGAND COMPLEX, DB921, A2T2 DICKERSON AND DREW DNA, CRYSTAL STRUCTURE OF B-DNA, DNA- DRUG COMPLEX, MAGNESIUM-WATER COMPLEX, HYDRATED MAGNESIUM, DNA HYDRATION.
4ah1	nuc      1.42	2-(4'-AMIDINOBIPHENYL-4-YL)-1H-BENZIMIDAZOLE- 5-AMIDINE C21 H18 N6	CRYSTAL STRUCTURE OF THE DB 921-D(CGCAAATTTGCG)2 COMPLEX AT 1.42 A RESOLUTION 5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*GP)-3' DNA DNA, DNA DOUBLE HELIX, MINOR GROOVE, DODECAMER, A3T3, DNA-DR COMPLEX, DNA HYDRATION,

D2X    3-[(4-HYDROXY-2-METHYLPYRIMIDIN-5-YL)METHYL]-5-(2- {[(R)-HYDROXY(PHOSPHONOOXY)PHOSPHORYL]OXY}ETHYL)-4- METHYL-1,3-THIAZOL-3-IUM

Code	Class Resolution	Description
3d2x	nuc      2.50	3-[(4-HYDROXY-2-METHYLPYRIMIDIN-5-YL)METHYL]-5-(2- {[(R)-HYDROXY(PHOSPHONOOXY)PHOSPHORYL]OXY}ETHYL)-4- METHYL-1,3-THIAZOL-3-IUM 2(C12 H18 N3 O8 P2 S 1+)	STRUCTURE OF THE THIAMINE PYROPHOSPHATE-SPECIFIC RIBOSWITCH BOUND TO OXYTHIAMINE PYROPHOSPHATE TPP-SPECIFIC RIBOSWITCH RNA RNA, STRUCTURE, RIBOSWITCH, THIAMINE PYROPHOSPHATE, OXYTHIAMINE PYROPHOSPHATE, ANTIBIOTIC, DRUGS, COMPLEX

D3    1-(2-DEOXY-BETA-D-RIBOFURANOSYL)-4-(3-BENZAMIDO) PHENYLIMIDAZOLE

Code	Class Resolution	Description
1wan	nuc      NMR    	1-(2-DEOXY-BETA-D-RIBOFURANOSYL)-4-(3-BENZAMIDO) PHENYLIMIDAZOLE C21 H22 N3 O7 P	DNA DTA TRIPLEX, NMR, 7 STRUCTURES DNA (5'- D(*AP*GP*AP*TP*AP*GP*AP*AP*CP*CP*CP*CP*TP*TP*CP*TP*AP*TP*CP *TP*TP*AP*TP*AP*TP*CP*TP*(D3)P*TP*CP*TP*T)-3') DNA TRIPLEX, INTERCALATOR, DEOXYRIBONUCLEIC ACID, DNA

D33    1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZOLE

Code	Class Resolution	Description
2k67	nuc      NMR    	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZOLE 3(C8 H13 N2 O6 P)	NMR SOLUTION STRUCTURE OF MODIFIED DNA CONTAINING IMIDAZOLE NUCLEOSIDES AT ACIDIC PH DNA (5'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)P*(D3 P*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3') DNA DNA 17-MER, HAIRPIN, ARTIFICIAL NUCLEOBASE, IMIDAZOLE NUCLEO SHIFTED PKA, DNA
2k68	nuc      NMR    	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZOLE 3(C8 H13 N2 O6 P)	NMR SOLUTION STRUCTURE OF MODIFIED DNA CONTAINING IMIDAZOLE NUCLEOSIDES AT NEUTRAL PH DNA (5'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33) P*(D33)P*(D33)P*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3') DNA DNA 17-MER, HAIRPIN, ARTIFICIAL NUCLEOBASE, IMIDAZOLE NUCLEOSIDE, SHIFTED PKA, NMR
2k69	nuc      NMR    	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZOLE 3(C8 H13 N2 O6 P)	NMR SOLUTION STRUCTURE OF MODIFIED DNA CONTAINING IMIDAZOLE NUCLEOSIDES AT BASIC PH DNA (5'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33) P*(D33)P*(D33)P*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3') DNA DNA 17-MER, HAIRPIN, ARTIFICIAL NUCLEOBASE, IMIDAZOLE NUCLEOSIDE, SHIFTED PKA, NMR
2ke8	nuc      NMR    	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZOLE 6(C8 H13 N2 O6 P)	NMR SOLUTION STRUCTURE OF METAL-MODIFIED DNA DNA (5'-D(*TP*TP*AP*AP*TP*TP*TP*(D33)P*(D33)P*(D3 P*AP*AP*AP*TP*TP*AP*A)-3') DNA DNA, ARTIFICIAL NUCLEOBASE, IMIDAZOLE NUCLEOSIDE, AG+
2m54	nuc      NMR    	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-IMIDAZOLE 6(C8 H13 N2 O6 P)	REFINED NMR SOLUTION STRUCTURE OF METAL-MODIFIED DNA DNA (5'-D(*TP*TP*AP*AP*TP*TP*TP*(D33)P*(D33)P*(D3 P*AP*AP*AP*TP*TP*AP*A)-3') DNA DNA, ARTIFICIAL NUCLEOBASE, IMIDAZOLE NUCLEOSIDE

D34    2,5-BIS{[4-(N-CYCLOBUTYLDIAMINOMETHYL)PHENYL]}FURAN

Code	Class Resolution	Description
1fmq	nuc      2.00	2,5-BIS{[4-(N-CYCLOBUTYLDIAMINOMETHYL)PHENYL]}FURAN C26 H32 N4 O	CYCLO-BUTYL-BIS-FURAMIDINE COMPLEXED WITH DCGCGAATTCGCG 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA DNA-DRUG MINOR GROOVE COMPLEX

D35    2,5-BIS{[4-(N-CYCLOHEXYLDIAMINOMETHYL)PHENYL]}FURAN

Code	Class Resolution	Description
1fms	nuc      1.90	2,5-BIS{[4-(N-CYCLOHEXYLDIAMINOMETHYL)PHENYL]}FURAN C30 H40 N4 O	STRUCTURE OF COMPLEX BETWEEN CYCLOHEXYL-BIS-FURAMIDINE AND D(CGCGAATTCGCG) 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA DNA-DRUG MINOR GROOVE COMPLEX

D3N    1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-PERIMIDIN-2(3H)-ONE

Code	Class Resolution	Description
2m11	nuc      NMR    	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-PERIMIDIN-2(3H)-ONE 2(C16 H17 N2 O7 P)	STRUCTURE OF PERIMIDINONE-DERIVED SYNTHETIC NUCLEOSIDE PAIRE GUANINE IN DNA DUPLEX DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(D3N)P*GP*CP*G CHAIN: A, B DNA B-FORM DNA, DPER, PERIMIDINONE-DERIVED NUCLEOSIDE, DICKERSON DODECAMER, DNA
4hqi	nuc      1.70	1-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-1H-PERIMIDIN-2(3H)-ONE 2(C16 H17 N2 O7 P)	STRUCTURE OF O6-BENZYL-2'-DEOXYGUANOSINE OPPOSITE PERIMIDINO SYNTHETIC NUCLEOSIDE IN DNA DUPLEX SHORT MODIFIED NUCLEIC ACIDS DNA B-FORM DNA, O6-BENZYL-2'-DEOXYGUANOSINE, DPER, PERIMIDINONE- NUCLEOSIDE, DICKERSON-DREW DODECAMER, DNA

D63    4'-(5-CARBAMIMIDOYL-1H-BENZIMIDAZOL-2-YL)BIPHENYL-4- CARBOXAMIDE

Code	Class Resolution	Description
3u08	nuc      1.25	4'-(5-CARBAMIMIDOYL-1H-BENZIMIDAZOL-2-YL)BIPHENYL-4- CARBOXAMIDE C21 H17 N5 O	CRYSTAL STRUCTURE OF DB1963-D(CGCGAATTCGCG)2 COMPLEX AT 1.25 RESOLUTION 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA DOUBLE HELIX, DNA MINOR GROOVE-LIGAND BINDER, DB1963, DNA

D83    2-(4'-CARBAMIMIDOYLBIPHENYL-4-YL)-1H-INDOLE-6- CARBOXIMIDAMIDE

Code	Class Resolution	Description
3u0u	nuc      1.24	2-(4'-CARBAMIMIDOYLBIPHENYL-4-YL)-1H-INDOLE-6- CARBOXIMIDAMIDE C22 H19 N5	CRYSTAL STRUCTURE OF THE DB1883-D(CGCGAATTCGCG)2 COMPLEX AT RESOLUTION 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA DOUBLE HELIX, MINOR GROOVE, DNA MINOR GROOVE BINDER, DB1883, DNA

D98    2-(4'-CARBAMIMIDOYL-2'-HYDROXYBIPHENYL-4-YL)- 1H-BENZIMIDAZOLE-5-CARBOXIMIDAMIDE

Code	Class Resolution	Description
4agz	nuc      1.25	2-(4'-CARBAMIMIDOYL-2'-HYDROXYBIPHENYL-4-YL)- 1H-BENZIMIDAZOLE-5-CARBOXIMIDAMIDE C21 H18 N6 O	CRYSTAL STRUCTURE OF THE DB 985-D(CGCGAATTCGCG)2 COMPLEX AT RESOLUTION. 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*GP)-3' DNA DNA, DNA DOUBLE HELIX, DNA-DRUG COMPLEX, DNA HYDRATION
4ah0	nuc      1.20	2-(4'-CARBAMIMIDOYL-2'-HYDROXYBIPHENYL-4-YL)- 1H-BENZIMIDAZOLE-5-CARBOXIMIDAMIDE C21 H18 N6 O	CRYSTAL STRUCTURE OF THE DB 985-D(CGCAAATTTGCG)2 COMPLEX AT RESOLUTION 5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*GP)-3' DNA DNA, MINOR GROOVE, DODECAMER, A3T3, DNA-DRUG COMPLEX, DNA HY HYDRATED MAGNESIUM

DA5    5-BROMO-9-AMINO-N-ETHYL(DIAMINOMETHYL)ACRIDINE-4- CARBOXAMIDE

Code	Class Resolution	Description
367d	nuc      1.20	5-BROMO-9-AMINO-N-ETHYL(DIAMINOMETHYL)ACRIDINE-4- CARBOXAMIDE 3(C18 H21 BR N4 O 2+)	1.2 A STRUCTURE DETERMINATION OF THE D(CG(5-BRU)ACG)2/5- BROMO-9-AMINO-DACA COMPLEX 5'-D(*CP*GP*(BRU)P*AP*CP*G)-3' DNA DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED

DA6    6-BROMO-9-AMINO-N-ETHYL(DIAMINOMETHYL)ACRIDINE-4- CARBOXAMIDE

Code	Class Resolution	Description
366d	nuc      1.30	6-BROMO-9-AMINO-N-ETHYL(DIAMINOMETHYL)ACRIDINE-4- CARBOXAMIDE 2(C18 H21 BR N4 O 2+)	1.3 A STRUCTURE DETERMINATION OF THE D(CG(5-BRU)ACG)2/6- BROMO-9-AMINO-DACA COMPLEX DNA (5'-D(*CP*GP*(BRU)P*AP*CP*G)-3') DNA DNA, DRUG INTERCALATION, MAJOR GROOVE BINDING

DA7    5-FLUORO-9-AMINO-(N-(2-DIMETHYLAMINO)ETHYL)ACRIDINE-4- CARBOXAMIDE

Code	Class Resolution	Description
1dl8	nuc      1.55	5-FLUORO-9-AMINO-(N-(2-DIMETHYLAMINO)ETHYL)ACRIDINE-4- CARBOXAMIDE 2(C18 H19 F N4 O)	CRYSTAL STRUCTURE OF 5-F-9-AMINO-(N-(2-DIMETHYLAMINO)ETHYL) ACRIDINE-4-CARBOXAMIDE BOUND TO D(CGTACG)2 DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA INTERCALATION, DNA, ACRIDINE

DAG    4,6-DIDEOXY-4-AMINO-BETA-D-GLUCOPYRANOSIDE

Code	Class Resolution	Description
1pik	nuc      NMR    	4,6-DIDEOXY-4-AMINO-BETA-D-GLUCOPYRANOSIDE C6 H13 N O4	ESPERAMICIN A1-DNA COMPLEX, NMR, 4 STRUCTURES DNA (5'-D(C*GP*GP*AP*TP*CP*CP*GP)-3') DNA DEOXYRIBONUCLEIC ACID, DRUG COMPLEX, DNA
2pik	nuc      NMR    	4,6-DIDEOXY-4-AMINO-BETA-D-GLUCOPYRANOSIDE C6 H13 N O4	CALICHEAMICIN GAMMA1I-DNA COMPLEX, NMR, 6 STRUCTURES DNA(5'-D(C*AP*CP*TP*CP*CP*TP*GP*GP*TP*TP*TP*TP* TP*GP*TP*GP*AP*GP*GP*AP*CP*CP)-3') DNA DEOXYRIBONUCLEIC ACID, CALICHEAMICIN GAMMA1I - DNA COMPLEX, ENEDIYNE ALIGNMENT IN MINOR GROOVE, SACCHARIDE DNA MINOR GROOVE INTERACTIONS, INTERMOLECULAR DRUG IODINE-GUANINE AMINO PROTON INTERACTIONS, SPECIFICITY AND CLEAVAGE PROCESS

DAI    (3AS,9AS)-2-PENTYL-4-HYDROXYMETHYL-3A,4,9,9A- TETRAHYDRO-4,9[1',2']-BENZENO-1H-BENZ[F]ISOINDOLE-1, 3(2H)-DIONE

Code	Class Resolution	Description
1ykv	nuc      3.30	(3AS,9AS)-2-PENTYL-4-HYDROXYMETHYL-3A,4,9,9A- TETRAHYDRO-4,9[1',2']-BENZENO-1H-BENZ[F]ISOINDOLE-1, 3(2H)-DIONE 2(C24 H25 N O3)	CRYSTAL STRUCTURE OF THE DIELS-ALDER RIBOZYME COMPLEXED WITH PRODUCT OF THE REACTION BETWEEN N-PENTYLMALEIMIDE AND COVAL ATTACHED 9-HYDROXYMETHYLANTHRACENE DIELS-ALDER RIBOZYME, DIELS-ALDER RIBOZYME RNA CARBON-CARBON BOND, CATALYTIC MECHANISM, DIELS-ALDER REACTIO RIBOZYME, RNA
1yls	nuc      3.00	(3AS,9AS)-2-PENTYL-4-HYDROXYMETHYL-3A,4,9,9A- TETRAHYDRO-4,9[1',2']-BENZENO-1H-BENZ[F]ISOINDOLE-1, 3(2H)-DIONE 2(C24 H25 N O3)	CRYSTAL STRUCTURE OF SELENIUM-MODIFIED DIELS-ALDER RIBOZYME WITH THE PRODUCT OF THE REACTION BETWEEN N-PENTYLMALEIMIDE COVALENTLY ATTACHED 9-HYDROXYMETHYLANTHRACENE RNA DIELS-ALDER RIBOZYME, RNA DIELS-ALDER RIBOZYME RNA CARBON-CARBON BOND FORMATION, CATALYTIC MECHANISM, DIELS-ALD REACTION, RIBOZYME, RNA

DAJ    DECARBAMOYL-2,7-DIAMINOMITOSENE

Code	Class Resolution	Description
1jo1	nuc      NMR    	DECARBAMOYL-2,7-DIAMINOMITOSENE 2(C13 H16 N3 O2 1+)	N7-GUANINE ADDUCT OF 2,7-DIAMINOMITOSENE WITH DNA 5'-D(*GP*TP*GP*(DAJ)GP*TP*AP*TP*AP*CP*CP*AP*C)- 3' DNA DOUBLE HELIX, MAJOR GROOVE BINDING DRUG, GUANINE-N7- ALKYLATOR, DNA

DAP    6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE

Code	Class Resolution	Description
1d30	nuc      2.40	6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE C16 H15 N5	THE STRUCTURE OF DAPI BOUND TO DNA DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
3ajl	nuc      2.70	6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE C16 H15 N5	CRYSTAL STRUCTURE OF D(CGCGGATF5UCGCG): 5-FORMYLURIDINE:GUAN BASE-PAIR IN B-DNA WITH DAPI 5'-D(*CP*GP*CP*GP*GP*AP*TP*(UFR)P*CP*GP*CP*G)-3' DNA DOUBLE HELIX, DNA
3gjh	nuc      2.90	6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE C16 H15 N5	CRYSTAL STRUCTURE OF A DNA DUPLEX CONTAINING 7,8- DIHYDROPYRIDOL[2,3-D]PYRIMIDIN-2-ONE 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(B7C)P*GP*CP*G)-3' DNA DNA DUPLEX, BICYCLIC CYTOSINE, 7, 8-DIHYDROPYRIDOL[2, 3- D]PYRIMIDIN-2-ONE, DNA
432d	nuc      1.89	6-AMIDINE-2-(4-AMIDINO-PHENYL)INDOLE C16 H15 N5	D(GGCCAATTGG) COMPLEXED WITH DAPI DNA (5'-D(*GP*GP*CP*CP*AP*AP*TP*TP*GP*G)-3') DNA DEOXYRIBONUCLEIC ACID, DNA-DRUG COMPLEX, TRIPLET FORMATION, 4',6-DIAMIDINO-2-PHENYL INDOLE, DAPI, MINOR GROOVE BINDER

DAR    D-ARGININE

Code	Class Resolution	Description
2kmj	nuc      NMR    	D-ARGININE 4(C6 H15 N4 O2 1+)	HIGH RESOLUTION NMR SOLUTION STRUCTURE OF A COMPLEX OF HIV-2 TAR RNA AND A SYNTHETIC TRIPEPTIDE IN A 1:2 STOICHIOMETRY PYRIMIDINYLPEPTIDE, RNA (28-MER) RNA/PEPTIDE RNA-LIGAND COMPLEX, BINDING STOICHIOMETRY, HIV-2 TAR, RNA/PEPTIDE COMPLEX

DAX    5-BROMO-N[2-(DIMETHYLAMINO)ETHYL]-9-AMINOACRIDINE-4- CARBOXAMIDE

Code	Class Resolution	Description
1m69	nuc      1.10	5-BROMO-N[2-(DIMETHYLAMINO)ETHYL]-9-AMINOACRIDINE-4- CARBOXAMIDE 2(C18 H21 BR N4 O 2+)	ATOMIC RESOLUTION STRUCTURE OF 5BR-9AMINO-DACA WITH D[CGTACG 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA ATOMIC RESOLUTION, ADENINE-THYMINE DISORDER, TOPOISOMERASE I DNA

DB9    2-{4'-[AMINO(IMINO)METHYL]BIPHENYL-3-YL}-1H- BENZIMIDAZOLE-6-CARBOXIMIDAMIDE

Code	Class Resolution	Description
2nlm	nuc      2.05	2-{4'-[AMINO(IMINO)METHYL]BIPHENYL-3-YL}-1H- BENZIMIDAZOLE-6-CARBOXIMIDAMIDE C21 H18 N6	CRYSTAL STRUCTURE OF THE DB 911- D(CGCGAATTCGCG)2 COMPLEX AT 2.05 A RESOLUTION. 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA B-TYPE DNA DODECAMER WITH COMPOUND DB 911.

DBN    6-(4,5-DIHYDRO-1H-IMIDAZOL-2-YL)-2-{5-[4-(4,5-DIHYDRO- 1H-IMIDAZOL-2-YL)PHENYL]THIEN-2-YL}-1H-BENZIMIDAZOLE

Code	Class Resolution	Description
2b3e	nuc      1.36	6-(4,5-DIHYDRO-1H-IMIDAZOL-2-YL)-2-{5-[4-(4,5-DIHYDRO- 1H-IMIDAZOL-2-YL)PHENYL]THIEN-2-YL}-1H-BENZIMIDAZOLE C23 H20 N6 S	CRYSTAL STRUCTURE OF DB819-D(CGCGAATTCGCG)2 COMPLEX. 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3' DNA NUCLEIC ACIDS, DNA, DOUBLE HELIX, MINOR GROOVE, DNA MINOR, GROOVE BINDER, DNA MINOR GROOVE-LIGAND COMPLEX, DB819, A2T2 DICKERSON AND DREW DODECAMER, CRYSTAL STRUCTURE OF B-DNA, DNA-DRUG COMPLEX, MAGNESIUM-WATER COMPLEX, HYDRATED MAGNESIUM, DNA HYDRATION.

DC    2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1p3x	nuc      NMR    	2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE 2(C9 H14 N3 O7 P)	INTRAMOLECULAR DNA TRIPLEX WITH 1-PROPYNYL DEOXYURIDINE IN THE THIRD STRAND, NMR, 10 STRUCTURES DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3') DNA OLIGONUCLEOTIDE, TRIPLEX, PROPYNE, DNA
3zd4	nuc      2.20	2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C9 H14 N3 O7 P	FULL-LENGTH HAMMERHEAD RIBOZYME WITH G12A SUBSTITUTION AT THE GENERAL BASE POSITION HAMMERHEAD RIBOZYME, ENZYME STRAND, HAMMERHEAD RIBOZYME, SUBSTRATE STRAND RNA RNA, GENERAL BASE CATALYSIS
3zd5	nuc      2.20	2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C9 H14 N3 O7 P	THE 2.2 A STRUCTURE OF A FULL-LENGTH CATALYTICALLY ACTIVE HAMMERHEAD RIBOZYME HAMMERHEAD RIBOZYME, ENZYME STRAND, HAMMERHEAD RIBOZYME, SUBSTRATE STRAND RNA CATALYTIC RNA, IN-LINE ATTACK, HAMMERHEAD RNA, STEM-LOOP INTERACTION, URIDINE TURN, A-FORM HELIX, RNA

DCM    2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1p3x	nuc      NMR    	2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C9 H14 N3 O7 P	INTRAMOLECULAR DNA TRIPLEX WITH 1-PROPYNYL DEOXYURIDINE IN THE THIRD STRAND, NMR, 10 STRUCTURES DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3') DNA OLIGONUCLEOTIDE, TRIPLEX, PROPYNE, DNA
3g2r	nuc      2.15	2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C9 H14 N3 O7 P	CRYSTAL STRUCTURE OF D(CACGCG).D(CGCGTG) COCRYSTALLIZED WITH MNCL2 5'-D(*CP*GP*TP*GP*CP*G)-3' DNA DUPLEX Z-FORM DNA WITH WATSON-CRICK BASE PAIRING

DCZ    2'-DEOXYCYTIDINE

Code	Class Resolution	Description
3qba	nuc      1.53	2'-DEOXYCYTIDINE 2(C9 H13 N3 O4)	REINTRODUCING ELECTROSTATICS INTO MACROMOLECULAR CRYSTALLOGR REFINEMENT: Z-DNA (X-RAY) Z-DNA DNA Z-DNA, DNA

DDA    2,6-DIDEOXY-BETA-D-GLUCOSE

Code	Class Resolution	Description
146d	nuc      NMR    	2,6-DIDEOXY-BETA-D-GLUCOSE 6(C6 H12 O4)	SOLUTION STRUCTURE OF THE MITHRAMYCIN DIMER-DNA COMPLEX DNA (5'-D(*TP*CP*GP*CP*GP*A)-3') DNA DNA, NMR, MITHRAMYCIN DIMER
1bp8	nuc      NMR    	2,6-DIDEOXY-BETA-D-GLUCOSE 12(C6 H12 O4)	4:2:1 MITHRAMYCIN:MG++:D(ACCCGGGT)2 COMPLEX 5'-D(*AP*CP*CP*CP*GP*GP*GP*T)-3' DNA MITHRAMYCIN, DNA, OLIGONUCLEOTIDE, NMR
1cp8	nuc      NMR    	2,6-DIDEOXY-BETA-D-GLUCOSE 6(C6 H12 O4)	NMR STRUCTURE OF DNA (5'-D(TTGGCCAA)2-3') COMPLEXED WITH NOVEL ANTITUMOR DRUG UCH9 DNA (5'-D(P*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DNA
1ekh	nuc      NMR    	2,6-DIDEOXY-BETA-D-GLUCOSE 4(C6 H12 O4)	NMR STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND CO DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1eki	nuc      NMR    	2,6-DIDEOXY-BETA-D-GLUCOSE 4(C6 H12 O4)	AVERAGE SOLUTION STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMY COBALT DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
207d	nuc      NMR    	2,6-DIDEOXY-BETA-D-GLUCOSE 12(C6 H12 O4)	SOLUTION STRUCTURE OF MITHRAMYCIN DIMERS BOUND TO PARTIALLY OVERLAPPING SITES ON DNA DNA (5'-D(*TP*AP*GP*CP*TP*AP*GP*CP*TP*A)-3') DNA DNA, NMR, DOUBLE HELIX, MITHRAMYCIN

DDI    SPIRO[NAPHTHALENE-2(3H),3'(10'H)-PENTALENO[1,2- B]NAPHTHALENE]-3,10'-DIONE, 2'-[(2-AMINO-2-DEOXY-B-D- GULOPYRANOSYL)OXY]-1,1',2',3'A,4,10'A-HEXAHYDRO-,(2'R, 3'AS,10'AR)-(9CI)

Code	Class Resolution	Description
1p96	nuc      NMR    	SPIRO[NAPHTHALENE-2(3H),3'(10'H)-PENTALENO[1,2- B]NAPHTHALENE]-3,10'-DIONE, 2'-[(2-AMINO-2-DEOXY-B-D- GULOPYRANOSYL)OXY]-1,1',2',3'A,4,10'A-HEXAHYDRO-,(2'R, 3'AS,10'AR)-(9CI) C31 H31 N O7	SOLUTION STRUCTURE OF A WEDGE-SHAPED SYNTHETIC MOLECULE AT A TWO-BASE BULGE SITE IN DNA 5'-D(*GP*TP*CP*CP*GP*AP*TP*GP*CP*GP*TP*G)-3', 5'-D(*CP*AP*CP*GP*CP*AP*GP*TP*TP*CP*GP*GP*AP*C)- 3' DNA WEDGE-SHAPED SYNTHETIC DRUG-BULGED DNA COMPLEX
1r4e	nuc      NMR    	SPIRO[NAPHTHALENE-2(3H),3'(10'H)-PENTALENO[1,2- B]NAPHTHALENE]-3,10'-DIONE, 2'-[(2-AMINO-2-DEOXY-B-D- GULOPYRANOSYL)OXY]-1,1',2',3'A,4,10'A-HEXAHYDRO-,(2'R, 3'AS,10'AR)-(9CI) C31 H31 N O7	SOLUTION STRUCTURE OF THE COMPLEX FORMED BETWEEN A LEFT-HAND SHAPED SPIROCYCLIC MOLECULE AND BULGED DNA 5'-D(*GP*TP*CP*CP*GP*AP*TP*GP*CP*GP*TP*G)-3', 5'-D(*CP*AP*CP*GP*CP*AP*GP*TP*TP*CP*GP*GP*AP*C)-3 CHAIN: A DNA WEDGE-SHAPED SPIROCYCLIC ENANTIOMER-BULGED DNA COMPLEX, DNA

DDL    2,6-DIDEOXY-BETA-D-GALACTOSE

Code	Class Resolution	Description
146d	nuc      NMR    	2,6-DIDEOXY-BETA-D-GALACTOSE 2(C6 H12 O4)	SOLUTION STRUCTURE OF THE MITHRAMYCIN DIMER-DNA COMPLEX DNA (5'-D(*TP*CP*GP*CP*GP*A)-3') DNA DNA, NMR, MITHRAMYCIN DIMER
1bp8	nuc      NMR    	2,6-DIDEOXY-BETA-D-GALACTOSE 4(C6 H12 O4)	4:2:1 MITHRAMYCIN:MG++:D(ACCCGGGT)2 COMPLEX 5'-D(*AP*CP*CP*CP*GP*GP*GP*T)-3' DNA MITHRAMYCIN, DNA, OLIGONUCLEOTIDE, NMR
1cp8	nuc      NMR    	2,6-DIDEOXY-BETA-D-GALACTOSE 2(C6 H12 O4)	NMR STRUCTURE OF DNA (5'-D(TTGGCCAA)2-3') COMPLEXED WITH NOVEL ANTITUMOR DRUG UCH9 DNA (5'-D(P*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DNA
207d	nuc      NMR    	2,6-DIDEOXY-BETA-D-GALACTOSE 4(C6 H12 O4)	SOLUTION STRUCTURE OF MITHRAMYCIN DIMERS BOUND TO PARTIALLY OVERLAPPING SITES ON DNA DNA (5'-D(*TP*AP*GP*CP*TP*AP*GP*CP*TP*A)-3') DNA DNA, NMR, DOUBLE HELIX, MITHRAMYCIN

DFT    1-[2-DEOXYRIBOFURANOSYL]-2,4-DIFLUORO-5-METHYL-BENZENE- 5'MONOPHOSPHATE

Code	Class Resolution	Description
1bw7	nuc      NMR    	1-[2-DEOXYRIBOFURANOSYL]-2,4-DIFLUORO-5-METHYL-BENZENE- 5'MONOPHOSPHATE C12 H15 F2 O6 P	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING A REPLICABLE DIFLUOROTOLUENE-ADENINE PAIR DNA (5'-D(*CP*GP*CP*AP*TP*(DFT)P*GP*TP*TP*AP*CP*C CHAIN: ADNA (5'-D(*GP*GP*TP*AP*AP*CP*AP*AP*TP*GP*CP*G)-3' CHAIN: B DNA DNA, DIFLUOROTOLUENE
1eek	nuc      NMR    	1-[2-DEOXYRIBOFURANOSYL]-2,4-DIFLUORO-5-METHYL- BENZENE-5'MONOPHOSPHATE C12 H15 F2 O6 P	SOLUTION STRUCTURE OF A NONPOLAR, NON HYDROGEN BONDED BASE PAIR SURROGATE IN DNA. 5'-D(*GP*GP*TP*AP*AP*CP*(MBZ)P*AP*TP*GP*CP*G)-3', 5'-D(*CP*GP*CP*AP*TP*(DFT)P*GP*TP*TP*AP*CP*C)-3' DNA DNA, NONPOLAR, ISOSTERIC, DNA BASE ANALOGS

DGP    2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
3slm	nuc      2.70	2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C10 H14 N5 O7 P)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE-5'-MONOPHOSPHATE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA

DIM    DIIMIDAZOLE LEXITROPSIN

Code	Class Resolution	Description
334d	nuc      1.80	DIIMIDAZOLE LEXITROPSIN 2(C14 H20 N9 O3 1+)	DEFINING GC-SPECIFICITY IN THE MINOR GROOVE: SIDE-BY-SIDE BINDING OF THE DI-IMIDAZOLE LEXITROPSIN TO C-A-T-G-G-C-C-A- T-G DNA (5'-D(*CP*AP*TP*GP*GP*CP*CP*AP*TP*G)-3') DNA B-DNA, DOUBLE HELIX

DIT    DITERCALINIUM

Code	Class Resolution	Description
1d32	nuc      1.70	DITERCALINIUM C46 H50 N6 O2 2+	DRUG-INDUCED DNA REPAIR: X-RAY STRUCTURE OF A DNA- DITERCALINIUM COMPLEX DNA (5'-D(*CP*GP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

DLF    2-DEOXY-ALPHA-L-FUCOPYRANOSIDE

Code	Class Resolution	Description
1pik	nuc      NMR    	2-DEOXY-ALPHA-L-FUCOPYRANOSIDE C6 H12 O4	ESPERAMICIN A1-DNA COMPLEX, NMR, 4 STRUCTURES DNA (5'-D(C*GP*GP*AP*TP*CP*CP*GP)-3') DNA DEOXYRIBONUCLEIC ACID, DRUG COMPLEX, DNA

DM1    DAUNOMYCIN

Code	Class Resolution	Description
110d	nuc      1.90	DAUNOMYCIN C27 H29 N O10	ANTHRACYCLINE-DNA INTERACTIONS AT UNFAVOURABLE BASE BASE- PAIR TRIPLET-BINDING SITES: STRUCTURES OF D(CGGCCG) /DAUNOMYCIN AND D(TGGCCA)/ADRIAMYCIN COMPL DNA (5'-D(*CP*GP*GP*CP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
152d	nuc      1.40	DAUNOMYCIN C27 H29 N O10	DIVERSITY OF WATER RING SIZE AT DNA INTERFACES: HYDRATION AND DYNAMICS OF DNA-ANTHRACYCLINE COMPLEXES DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1d10	nuc      1.50	DAUNOMYCIN C27 H29 N O10	STRUCTURAL COMPARISON OF ANTICANCER DRUG-DNA COMPLEXES. ADRIAMYCIN AND DAUNOMYCIN DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1d11	nuc      1.18	DAUNOMYCIN C27 H29 N O10	INTERACTIONS BETWEEN AN ANTHRACYCLINE ANTIBIOTIC AND DNA MOL STRUCTURE OF DAUNOMYCIN COMPLEXED TO D(CPGPTPAPCPG) AT 1.2- RESOLUTION DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DNA
1d33	nuc      1.50	DAUNOMYCIN C27 H29 N O10	FORMALDEHYDE CROSS-LINKS DAUNORUBICIN AND DNA EFFICIENTLY: HPLC AND X-RAY DIFFRACTION STUDIES 5'-D(*CP*GP*CP*(G49)P*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
1da0	nuc      1.50	DAUNOMYCIN C27 H29 N O10	DNA-DRUG INTERACTIONS: THE CRYSTAL STRUCTURE OF D(CGATCG) COMPLEXED WITH DAUNOMYCIN DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1jo2	nuc      1.50	DAUNOMYCIN C27 H29 N O10	CRYSTAL STRUCTURE OF THE B-DNA HEXAMER (CGATCG).DAUNOMYCIN COMPLEX CONTAINING A RIBOSE AT THE INTERCALATION SITE 5'-D(*C)-R(P*G)-D(P*AP*TP*CP*G)-3' DNA, RNA INTERCALATION, DNA/RNA CHIMER, DNA, RNA
1o0k	nuc      1.17	DAUNOMYCIN 3(C27 H29 N O10)	STRUCTURE OF THE FIRST PARALLEL DNA QUADRUPLEX-DRUG COMPLEX 5'-D(*TP*GP*GP*GP*GP*T)-3' DNA G-4 QUADRUPLEX DRUG COMPLEX, PARALLEL QUADRUPLEX, DNA
1vth	nuc      1.60	DAUNOMYCIN C27 H29 N O10	DNA-DRUG INTERACTIONS: THE CRYSTAL STRUCTURES OF D(TGTACA) C WITH DAUNOMYCIN DNA (5'-D(*TP*GP*TP*AP*CP*A)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DNA
1vti	nuc      1.70	DAUNOMYCIN C27 H29 N O10	DNA-DRUG INTERACTIONS: THE CRYSTAL STRUCTURES OF D(TGATCA) C WITH DAUNOMYCIN DNA (5'-D(*TP*GP*TP*AP*CP*A)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DNA
2d34	nuc      1.40	DAUNOMYCIN C27 H29 N O10	FORMALDEHYDE CROSS-LINKS DAUNORUBICIN AND DNA EFFICIENTLY: HPLC AND X-RAY DIFFRACTION STUDIES 5'-D(*CP*GP*TP*(A35)P*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
308d	nuc      1.50	DAUNOMYCIN 2(C27 H29 N O10)	BINDING OF DAUNOMYCIN TO B-D-GLUCOSYLATED DNA FOUND IN PROTOZOA TRYPANOSOMA BRUCEI STUDIED BY X-RAY CRYSTALLOGRAPH DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
3tvb	nuc      1.08	DAUNOMYCIN 4(C27 H29 N O10)	A HIGHLY SYMMETRIC DNA G-4 QUADRUPLEX/DRUG COMPLEX DNA (5'-D(*GP*GP*GP*G)-3') DNA/ANTIBIOTIC G-4 QUADRUPLEX, DAUNOMYCIN, DNA-DRUG COMPLEX, DNA-ANTIBIOTIC
427d	nuc      1.10	DAUNOMYCIN C27 H29 N O10	5'-D(*CP*GP*CP*(CH2-DM1)GP*CP*G)-3' DNA (5'-D(*CP*GP*CP*(G49)P*CP*G)-3') DNA DEOXYRIBONUCLEIC ACID, DRUG COMPLEX, FORMALDEHYDE CROSS- LINK, ATOMIC RESOLUTION, DOUBLE BACKBONE CONFORMATION, DNA

DM2    DOXORUBICIN

Code	Class Resolution	Description
151d	nuc      1.40	DOXORUBICIN C27 H29 N O11	DIVERSITY OF WATER RING SIZE AT DNA INTERFACES: HYDRATION AND DYNAMICS OF DNA-ANTHRACYCLINE COMPLEXES DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1d12	nuc      1.70	DOXORUBICIN C27 H29 N O11	STRUCTURAL COMPARISON OF ANTICANCER DRUG-DNA COMPLEXES. ADRIAMYCIN AND DAUNOMYCIN DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1da9	nuc      1.70	DOXORUBICIN C27 H29 N O11	ANTHRACYCLINE-DNA INTERACTIONS AT UNFAVOURABLE BASE BASE- PAIR TRIPLET-BINDING SITES: STRUCTURES OF D(CGGCCG) /DAUNOMYCIN AND D(TGGCCA)/ADRIAMYCIN COMPL DNA (5'-D(*TP*GP*GP*CP*CP*A)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1p20	nuc      1.34	DOXORUBICIN C27 H29 N O11	SURPRISING ROLES OF ELECTROSTATIC INTERACTIONS IN DNA- LIGAND COMPLEXES 5'-D(*CP*GP*AP*TP*CP*G)-3' DNA ADRIAMYCIN, INTERCALATION, ELECTROSTATICS, THALLIUM, DNA

DM3    6-DEOXYDAUNOMYCIN

Code	Class Resolution	Description
1d14	nuc      1.50	6-DEOXYDAUNOMYCIN C27 H29 N O9	STRUCTURE OF 11-DEOXYDAUNOMYCIN BOUND TO DNA CONTAINING A PHOSPHOROTHIOATE DNA (5'-D(*CP*GP*TP*(AS)P*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED

DM4    1-O-DEMETHYL-6-DEOXYDOXORUBICIN

Code	Class Resolution	Description
1d37	nuc      1.80	1-O-DEMETHYL-6-DEOXYDOXORUBICIN C26 H27 N O10	INFLUENCE OF AGLYCONE MODIFICATIONS ON THE BINDING OF ANTHRACYCLINE DRUGS TO DNA: THE MOLECULAR STRUCTURE OF IDARUBICIN AND 4-O-DEMETHYL-11-DEOXYDOXORUBICIN COMPLEXED TO D(CGATCG) DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

DM5    IDARUBICIN

Code	Class Resolution	Description
198d	nuc      1.97	IDARUBICIN 4(C26 H27 N O9)	A TRIGONAL FORM OF THE IDARUBICIN-D(CGATCG) COMPLEX: CRYSTAL AND MOLECULAR STRUCTURE AT 2.0 ANGSTROMS RESOLUTION DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1d38	nuc      1.70	IDARUBICIN C26 H27 N O9	INFLUENCE OF AGLYCONE MODIFICATIONS ON THE BINDING OF ANTHRACYCLINE DRUGS TO DNA: THE MOLECULAR STRUCTURE OF IDARUBICIN AND 4-O-DEMETHYL-11-DEOXYDOXORUBICIN COMPLEXED TO D(CGATCG) DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1d67	nuc      1.60	IDARUBICIN C26 H27 N O9	THE MOLECULAR STRUCTURE OF AN IDARUBICIN-D(TGATCA) COMPLEX AT HIGH RESOLUTION DNA (5'-D(*TP*GP*AP*TP*CP*A)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

DM6    4'-EPIDOXORUBICIN

Code	Class Resolution	Description
1d15	nuc      1.50	4'-EPIDOXORUBICIN C27 H30 N O11 1+	TERNARY INTERACTIONS OF SPERMINE WITH DNA: 4'-EPIADRIAMYCIN AND OTHER DNA: ANTHRACYCLINE COMPLEXES DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1d54	nuc      1.40	4'-EPIDOXORUBICIN C27 H30 N O11 1+	ANTHRACYCLINE BINDING TO DNA: HIGH RESOLUTION STRUCTURE OF D(TGTACA) COMPLEXED WITH 4'-EPIADRIAMYCIN DNA (5'-D(*TP*GP*TP*AP*CP*A)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1d58	nuc      1.70	4'-EPIDOXORUBICIN C27 H30 N O11 1+	THE MOLECULAR STRUCTURE OF A 4'-EPIADRIAMYCIN COMPLEX WITH D(TGATCA) AT 1.7 ANGSTROM RESOLUTION-COMPARISON WITH THE STRUCTURE OF 4'-EPIADRIAMYCIN D(TGTACA) AND D(CGATCG) COMPLEXES DNA (5'-D(*TP*GP*AP*TP*CP*A)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1qda	nuc      1.60	4'-EPIDOXORUBICIN C27 H30 N O11 1+	CRYSTAL STRUCTURE OF EPIDOXORUBICIN-FORMALDEHYDE VIRTUAL CRO DNA 5' -D(CP*GP*CP*(G49)P*CP*GP)-3' DNA DOUBLE HELIX, DRUG-DNA COMPLEX, DNA

DM7    4'-DEOXY-4'-IODODOXORUBICIN

Code	Class Resolution	Description
1imr	nuc      1.60	4'-DEOXY-4'-IODODOXORUBICIN C27 H29 I N O10 1+	MOLECULAR STRUCTURE OF THE HALOGENATED ANTI-CANCER DRUG IODODOXORUBICIN COMPLEXED WITH D(TGTACA) AND D(CGATCG) DNA (5'-D(*TP*GP*TP*AP*CP*A)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
1ims	nuc      1.50	4'-DEOXY-4'-IODODOXORUBICIN C27 H29 I N O10 1+	MOLECULAR STRUCTURE OF THE HALOGENATED ANTI-CANCER DRUG IODODOXORUBICIN COMPLEXED WITH D(TGTACA) AND D(CGATCG) DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

DM8    2'-BROMO-4'-EPIDAUNORUBICIN

Code	Class Resolution	Description
276d	nuc      1.80	2'-BROMO-4'-EPIDAUNORUBICIN C27 H28 BR N O10	SUBSTITUTIONS AT C2' OF DAUNOSAMINE IN THE ANTICANCER DAUNORUBICIN ALTER ITS DNA-BINDING SEQUENCE SPECIFICITY DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
277d	nuc      1.80	2'-BROMO-4'-EPIDAUNORUBICIN C27 H28 BR N O10	SUBSTITUTIONS AT C2' OF DAUNOSAMINE IN THE ANTICANCER DAUNORUBICIN ALTER ITS DNA-BINDING SEQUENCE SPECIFICITY 5'-D(*CP*GP*CP*(G49)P*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
278d	nuc      1.80	2'-BROMO-4'-EPIDAUNORUBICIN C27 H28 BR N O10	SUBSTITUTIONS AT C2' OF DAUNOSAMINE IN THE ANTICANCER DAUNORUBICIN ALTER ITS DNA-BINDING SEQUENCE SPECIFICITY DNA (5'-D(*CP*GP*(G49)P*CP*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
288d	nuc      1.80	2'-BROMO-4'-EPIDAUNORUBICIN C27 H28 BR N O10	SUBSTITUTIONS AT C2' OF DAUNOSAMINE IN THE ANTICANCER DAUNORUBICIN ALTER ITS DNA-BINDING SEQUENCE SPECIFICITY DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
380d	nuc      2.00	2'-BROMO-4'-EPIDAUNORUBICIN 2(C27 H28 BR N O10)	BINDING OF THE MODIFIED DAUNORUBICIN WP401 ADJACENT TO A T-G INDUCES THE REVERSE WATSON-CRICK CONFORMATION: CRYSTAL STRU THE WP401-TGGCCG AND WP401-CGG[BR5C]CG COMPLEXES DNA (5'-D(*CP*GP*(G49)P*(CBR)P*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, MODIFIED, DNA
381d	nuc      2.10	2'-BROMO-4'-EPIDAUNORUBICIN 2(C27 H28 BR N O10)	BINDING OF THE MODIFIED DAUNORUBICIN WP401 ADJACENT TO A T-G INDUCES THE REVERSE WATSON-CRICK CONFORMATION: CRYSTAL STRU THE WP401-TGGCCG AND WP401-CGG[BR5C]CG COMPLEXES DNA (5'-D(*TP*GP*(G49)P*CP*CP*G)-3'), DNA (5'-D(*TP*GP*GP*CP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIE MISMATCHED, DNA

DM9    N-HYDROXYMETHYL-N-(2-METHOXYETHYL)-DAUNOMYCIN

Code	Class Resolution	Description
482d	nuc      1.54	N-HYDROXYMETHYL-N-(2-METHOXYETHYL)-DAUNOMYCIN C31 H39 N O12	RELEASE OF THE CYANO MOIETY IN THE CRYSTAL STRUCTURE OF N- CYANOMETHYL-N-(2-METHOXYETHYL)-DAUNOMYCIN COMPLEXED WITH D(CGATCG) 5'-D(*CP*GP*AP*TP*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DEOXYRIBONUCLEIC ACID

DMM    3'-DESAMINO-3'-(2-METHOXY-4-MORPHOLINYL)-DOXORUBICIN

Code	Class Resolution	Description
215d	nuc      1.70	3'-DESAMINO-3'-(2-METHOXY-4-MORPHOLINYL)-DOXORUBICIN C32 H37 N O13	CRYSTAL STRUCTURE OF FOUR MORPHOLINO-DOXORUBICIN ANTICANCER DRUGS COMPLEXED WITH D(CGTACG) AND D(CGATCG): IMPLICATIONS IN DRUG-DNA CROSSLINK DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
234d	nuc      1.80	3'-DESAMINO-3'-(2-METHOXY-4-MORPHOLINYL)-DOXORUBICIN C32 H37 N O13	CRYSTAL STRUCTURE OF FOUR MORPHOLINO-DOXORUBICIN ANTICANCER DRUGS COMPLEXED WITH D(CGTACG) AND D(CGATCG): IMPLICATIONS IN DRUG-DNA CROSSLINK DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
235d	nuc      1.80	3'-DESAMINO-3'-(2-METHOXY-4-MORPHOLINYL)-DOXORUBICIN C32 H37 N O13	CRYSTAL STRUCTURE OF FOUR MORPHOLINO-DOXORUBICIN ANTICANCER DRUGS COMPLEXED WITH D(CGTACG) AND D(CGATCG): IMPLICATIONS IN DRUG-DNA CROSSLINK DNA (5'-D(*CP*GP*AP*TP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
2des	nuc      1.50	3'-DESAMINO-3'-(2-METHOXY-4-MORPHOLINYL)-DOXORUBICIN 2(C32 H37 N O13)	INTERACTIONS BETWEEN MORPHOLINYL ANTHRACYCLINES AND DNA: THE CRYSTAL STRUCTURE OF A MORPHOLINO DOXORUBICIN BOUND TO D(CGTACG) DNA (5'-D(*CP*GP*TP*AP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG

DMY    DISTAMYCIN A

Code	Class Resolution	Description
159d	nuc      1.80	DISTAMYCIN A C22 H27 N9 O4	SIDE BY SIDE BINDING OF TWO DISTAMYCIN A DRUGS IN THE MINOR GROOVE OF AN ALTERNATING B-DNA DUPLEX DNA (5'-D(*IP*CP*IP*CP*IP*CP*IP*C)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
1jtl	nuc      1.85	DISTAMYCIN A C22 H27 N9 O4	THE CRYSTAL STRUCTURE OF D(GGCCAATTGG) COMPLEXED WITH DISTAMYCIN 5'-D(*GP*GP*CP*CP*AP*AP*TP*TP*GP*G)-3' DNA B-DNA DOUBLE HELIX, BASE TRIPLETS, MINOR GROOVE BINDING, DRUG, DISTAMYCIN
1jux	nuc      1.60	DISTAMYCIN A C22 H27 N9 O4	1.6A RESOLUTION CRYSTAL STRUCTURES OF THE DNA OCTAMERS D(IUATATAC) AND D(ITITACAC):BINDING OF TWO DISTAMYCIN DRUGS SIDE-BY-SIDE 5'-D(*IP*TP*IP*TP*AP*CP*AP*C)-3' DNA DNA, OCTAMER, DISTAMYCIN, SIDE-BY-SIDE
1k2z	nuc      2.38	DISTAMYCIN A C22 H27 N9 O4	THE CRYSTAL STRUCTURE OF D(GGCCAATTGG) COMPLEXED WITH DISTAMYCIN. 5'-D(*GP*GP*CP*CP*AP*AP*TP*TP*GP*G)-3' DNA B-DNA DOUBLE HELIX, BASE TRIPLETS, MINOR GROOVE BINDING, DRUG, DISTAMYCIN
216d	nuc      1.73	DISTAMYCIN A C22 H27 N9 O4	CRYSTAL STRUCTURES OF THE B-FORM DNA-RNA CHIMER (5'-D(*IP*)- R(*CP*)-D(*IP*CP*IP*CP*IP*C)-3') COMPLEXED WITH DISTAMYCIN DNA/RNA (5'-D(*IP*)-R(*CP*)-D(*IP*CP*IP*CP*IP*C)- 3') DNA-RNA HYBRID B-DNA/RNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED, DNA- RNA HYBRID
217d	nuc      1.70	DISTAMYCIN A C22 H27 N9 O4	CRYSTAL STRUCTURES OF THE B-FORM DNA-RNA CHIMER (5'-D(*IP*)- R(*CP*)-D(*IP*)-R(*CP*)-D(*IP*CP*IP*C)-3') COMPLEXED WITH DISTAMYCIN DNA/RNA (5'-D(*IP*)-R(*CP*)-D(*IP*)-R(*CP*)- D(*IP*CP*IP*C)-3') DNA-RNA HYBRID B-DNA/RNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED, DNA- RNA HYBRID
267d	nuc      2.00	DISTAMYCIN A C22 H27 N9 O4	STRUCTURAL STUDIES ON NUCLEIC ACIDS DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(5CM)P*GP*CP*G CHAIN: A, B DNA B-DNA, DOUBLE HELIX, MODIFIED, COMPLEXED WITH DRUG, DNA
2dnd	nuc      2.20	DISTAMYCIN A C22 H27 N9 O4	A BIFURCATED HYDROGEN-BONDED CONFORMATION IN THE D(A.T) BASE PAIRS OF THE DNA DODECAMER D(CGCAAATTTGCG) AND ITS COMPLEX WITH DISTAMYCIN DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*G)- 3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG
2jt7	nuc      NMR    	DISTAMYCIN A 4(C22 H27 N9 O4)	NMR SOLUTION STRUCTURE OF THE 4:1 DISTAMYCIN A/[D(TGGGGT)]4 COMPLEX DNA (5'-D(*DTP*DGP*DGP*DGP*DGP*DT)-3') DNA QUADRUPLEX, DISTAMYCIN A, TGGGGT, COMPLEX, TELOMERE, DNA
304d	nuc      1.90	DISTAMYCIN A C22 H27 N9 O4	SIDE-BY-SIDE BINDING OF DISTAMYCIN MOLECULES TO D(ICATATIC) IN THE MONOCLINIC FORM DNA (5'-D(*IP*CP*AP*TP*AP*TP*IP*C)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DOUBLE DRUG IN THE MINOR GROOVE
305d	nuc      2.17	DISTAMYCIN A C22 H27 N9 O4	SIDE-BY-SIDE BINDING OF DISTAMYCIN MOLECULES TO D(ICATATIC) IN THE TETRAGONAL FORM DNA (5'-D(*IP*CP*AP*TP*AP*TP*IP*C)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DOUBLE DRUG IN THE MINOR GROOVE
306d	nuc      1.60	DISTAMYCIN A C22 H27 N9 O4	SIDE-BY-SIDE BINDING OF DISTAMYCIN MOLECULES TO D(ICITACIC) DNA (5'-D(*IP*CP*IP*TP*AP*CP*IP*C)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, DOUBLE DRUG IN THE MINOR GROOVE
378d	nuc      2.40	DISTAMYCIN A 4(C22 H27 N9 O4)	STRUCTURE OF THE SIDE-BY-SIDE BINDING OF DISTAMYCIN TO DNA DNA (5'-D(*GP*TP*AP*TP*AP*TP*AP*C)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, DOUBLE DRUG IN MINOR GROOVE

DNH    1R,2R-DIAMINOCYCLOHEXANE

Code	Class Resolution	Description
1ihh	nuc      2.40	1R,2R-DIAMINOCYCLOHEXANE C6 H14 N2	2.4 ANGSTROM CRYSTAL STRUCTURE OF AN OXALIPLATIN 1,2-D(GPG) INTRASTRAND CROSS-LINK IN A DNA DODECAMER DUPLEX 5'-D(*GP*GP*AP*GP*AP*CP*CP*AP*GP*AP*GP*G)-3', 5'-D(*CP*CP*TP*CP*TP*GP*GP*TP*CP*TP*CP*C)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, OXALIPLATIN, MODIFIED, DEOXYNUCLEIC ACID

DNR    2'-DEOXY-N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1laq	nuc      NMR    	2'-DEOXY-N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O7 P 1+	SOLUTION STRUCTURE OF THE B-DNA DUPLEX CGCGGTXTCCGCG (X=PDG) CONTAINING THE 1,N2-PROPANODEOXYGUANOSINE ADDUCT WITH THE DEOXYRIBOSE AT C20 OPPOSITE PDG IN THE C2' ENDO CONFORMATION. 5'-D(*CP*GP*CP*GP*GP*AP*(DNR)P*AP*CP*CP*GP*CP*G)- 3', 5'-D(*CP*GP*CP*GP*GP*TP*(P)P*TP*CP*CP*GP*CP*G)- 3' DNA DNA, B-TYPE, NMR, PROPANODEOXYGUANOSINE
1las	nuc      NMR    	2'-DEOXY-N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE C9 H15 N3 O7 P 1+	SOLUTION STRUCTURE OF THE B-DNA DUPLEX CGCGGTXTCCGCG (X=PDG) CONTAINING THE 1,N2-PROPANODEOXYGUANOSINE ADDUCT WITH THE DEOXYRIBOSE AT C20 OPPOSITE PDG IN THE C3' ENDO CONFORMATION. 5'-D(*CP*GP*CP*GP*GP*AP*(DNR)P*AP*CP*CP*GP*CP*G)- 3', 5'-D(*CP*GP*CP*GP*GP*TP*(P)P*TP*CP*CP*GP*CP*G)- 3' DNA DNA, B-TYPE, NMR, PROPANODEOXYGUANOSINE
1r2l	nuc      NMR    	2'-DEOXY-N3-PROTONATED CYTIDINE-5'-MONOPHOSPHATE 4(C9 H15 N3 O7 P 1+)	A PARALLEL STRANDED DNA DUPLEX WITH AN A-G MISMATCH BASE- PAIR DNA (5'-D(P*(DNR)P*(DNR) P*DAP*DTP*DAP*DAP*DTP*DTP*DTP*DAP*(DNR)P*(DNR))-3'), 5'-D(P*CP*CP*TP*AP*TP*GP*AP*AP*AP*TP*CP*C)-3' DNA PS-DNA, A:G MISMATCH, PARALLEL DNA DUPLEX

DPA    4,5-DIMETHOXY-N-(2'-METHOXYPROPENOYL ANTHRANILATE)

Code	Class Resolution	Description
1pik	nuc      NMR    	4,5-DIMETHOXY-N-(2'-METHOXYPROPENOYL ANTHRANILATE) C13 H15 N O5	ESPERAMICIN A1-DNA COMPLEX, NMR, 4 STRUCTURES DNA (5'-D(C*GP*GP*AP*TP*CP*CP*GP)-3') DNA DEOXYRIBONUCLEIC ACID, DRUG COMPLEX, DNA

DPY    2-DEOXYRIBOFURANOSYL-PYRIDINE-2,6-DICARBOXYLIC ACID- 5'-MONOPHOSPHATE

Code	Class Resolution	Description
1jes	nuc      1.50	2-DEOXYRIBOFURANOSYL-PYRIDINE-2,6-DICARBOXYLIC ACID- 5'-MONOPHOSPHATE 2(C12 H14 N O10 P)	CRYSTAL STRUCTURE OF A COPPER-MEDIATED BASE PAIR IN DNA 5'-D(*CP*GP*CP*GP*(DPY)P*AP*TP*(DRP) P*CP*GP*CP*G)-3' DNA CU, COPPER, DNA, METAL, Z-DNA, DODECAMER, DUPLEX, UNNATURAL, DESIGNED

DR1    5-METHYL-5H-INDOLO[3,2-B]QUINOLINE

Code	Class Resolution	Description
1k9g	nuc      1.40	5-METHYL-5H-INDOLO[3,2-B]QUINOLINE 2(C16 H12 N2)	CRYSTAL STRUCTURE OF THE COMPLEX OF CRYPTOLEPINE-D(CCTAGG)2 5'-D(*CP*CP*TP*AP*GP*G)-3' DNA DNA INTERCALATOR COMPLEX

DRC    9-AMINO-N-[2-(4-MORPHOLINYL)ETHYL]-4- ACRIDINECARBOXAMIDE

Code	Class Resolution	Description
1kci	nuc      1.80	9-AMINO-N-[2-(4-MORPHOLINYL)ETHYL]-4- ACRIDINECARBOXAMIDE 2(C20 H22 N4 O2)	CRYSTAL STRUCTURE OF 9-AMINO-N-[2-(4-MORPHOLINYL)ETHYL]-4- ACRIDINECARBOXAMIDE BOUND TO D(CGTACG)2 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DNA, INTERCALATOR, AMINOACRIDINECARBOXAMIDE

DRI    4-O-METHYL-2,6-DIDEOXY-BETA-D-GLUCOSE

Code	Class Resolution	Description
1cp8	nuc      NMR    	4-O-METHYL-2,6-DIDEOXY-BETA-D-GLUCOSE 2(C7 H14 O4)	NMR STRUCTURE OF DNA (5'-D(TTGGCCAA)2-3') COMPLEXED WITH NOVEL ANTITUMOR DRUG UCH9 DNA (5'-D(P*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DNA

DRP    2-DEOXYRIBOFURANOSYL-PYRIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1jes	nuc      1.50	2-DEOXYRIBOFURANOSYL-PYRIDINE-5'-MONOPHOSPHATE 2(C10 H14 N O6 P)	CRYSTAL STRUCTURE OF A COPPER-MEDIATED BASE PAIR IN DNA 5'-D(*CP*GP*CP*GP*(DPY)P*AP*TP*(DRP) P*CP*GP*CP*G)-3' DNA CU, COPPER, DNA, METAL, Z-DNA, DODECAMER, DUPLEX, UNNATURAL, DESIGNED

DSA    4-HYDROXY-8-METHYL-6-(4,5,6-TRIMETHOXY-1H-INDOLE-2- CARBONYL)-3,6,7,8-TETRAHYDRO-3,6-DIAZA-AS-INDACENE-2- CARBOXYLIC ACID METHYL ESTER

Code	Class Resolution	Description
1dsa	nuc      NMR    	4-HYDROXY-8-METHYL-6-(4,5,6-TRIMETHOXY-1H-INDOLE-2- CARBONYL)-3,6,7,8-TETRAHYDRO-3,6-DIAZA-AS-INDACENE-2- CARBOXYLIC ACID METHYL ESTER C25 H25 N3 O7	(+)-DUOCARMYCIN SA COVALENTLY LINKED TO DUPLEX DNA, NMR, 20 STRUCTURES DNA (5'-D(*GP*AP*CP*TP*AP*AP*TP*TP*GP*AP*C)-3', 5'-D(*GP*TP*CP*AP*AP*TP*TP*AP*GP*TP*C)-3'), DNA (5'-D(*GP*AP*CP*TP*AP*AP*TP*TP*GP*AP*C)-3', 5'-D(*GP*TP*CP*AP*AP*TP*TP*AP*GP*TP*C)-3') DNA DUOCARMYCIN, DNA, MINOR GROOVE BINDING, ANTITUMOR AGENT, DRUG-DNA COMPLEX, DEOXYRIBONUCLEIC ACID
1dsm	nuc      NMR    	4-HYDROXY-8-METHYL-6-(4,5,6-TRIMETHOXY-1H-INDOLE-2- CARBONYL)-3,6,7,8-TETRAHYDRO-3,6-DIAZA-AS-INDACENE-2- CARBOXYLIC ACID METHYL ESTER C25 H25 N3 O7	(-)-DUOCARMYCIN SA COVALENTLY LINKED TO DUPLEX DNA 5'-D(*GP*AP*CP*TP*AP*AP*TP*TP*GP*AP*C)-3', 5'-D(*GP*TP*CP*AP*AP*TP*TP*AP*GP*TP*C)-3' DNA DUOCARMYCIN, DNA, MINOR GROOVE BINDING, ANTITUMOR AGENT, DRUG-DNA COMPLEX

DSI    4-HYDROXY-6-(1H-INDOLE-2-CARBONYL)-8-METHYL-3,6,7,8- TETRAHYDRO-3,6-DIAZA-AS-INDACENE-2-CARBOXYLIC ACID METHYL ESTER

Code	Class Resolution	Description
1dsi	nuc      NMR    	4-HYDROXY-6-(1H-INDOLE-2-CARBONYL)-8-METHYL-3,6,7,8- TETRAHYDRO-3,6-DIAZA-AS-INDACENE-2-CARBOXYLIC ACID METHYL ESTER C22 H19 N3 O4	SOLUTION STRUCTURE OF A DUOCARMYCIN SA-INDOLE-ALKYLATED DNA DUPLEX DNA (5'-D(*GP*TP*CP*AP*AP*TP*TP*AP*GP*TP*C)-3'), DNA (5'-D(*GP*AP*CP*TP*AP*AP*TP*TP*GP*AP*C)-3') DNA DEOXYRIBONUCLEIC ACID, DUOCARMYCIN, DNA, MINOR GROOVE BINDING, ANTITUMOR AGENT, LIGAND-DNA COMPLEX

DSR    2,6-DIDEOXY-4-THIO-BETA-D-ALLOSEPYRANOSIDE

Code	Class Resolution	Description
2pik	nuc      NMR    	2,6-DIDEOXY-4-THIO-BETA-D-ALLOSEPYRANOSIDE C6 H12 O3 S	CALICHEAMICIN GAMMA1I-DNA COMPLEX, NMR, 6 STRUCTURES DNA(5'-D(C*AP*CP*TP*CP*CP*TP*GP*GP*TP*TP*TP*TP* TP*GP*TP*GP*AP*GP*GP*AP*CP*CP)-3') DNA DEOXYRIBONUCLEIC ACID, CALICHEAMICIN GAMMA1I - DNA COMPLEX, ENEDIYNE ALIGNMENT IN MINOR GROOVE, SACCHARIDE DNA MINOR GROOVE INTERACTIONS, INTERMOLECULAR DRUG IODINE-GUANINE AMINO PROTON INTERACTIONS, SPECIFICITY AND CLEAVAGE PROCESS

DUO    4-HYDROXY-2,8-DIMETHYL-1-OXO-6-(4,5,6-TRIMETHOXY-1H- INDOLE-2-CARBONYL)-1,2,3,6,7,8-HEXAHYDRO-3,6-DIAZA-AS- INDACENE-2-CARBOXYLIC ACID METHYL ESTER

Code	Class Resolution	Description
107d	nuc      NMR    	4-HYDROXY-2,8-DIMETHYL-1-OXO-6-(4,5,6-TRIMETHOXY-1H- INDOLE-2-CARBONYL)-1,2,3,6,7,8-HEXAHYDRO-3,6-DIAZA-AS- INDACENE-2-CARBOXYLIC ACID METHYL ESTER C26 H27 N3 O8	SOLUTION STRUCTURE OF THE COVALENT DUOCARMYCIN A-DNA DUPLEX COMPLEX DNA (5'-D(*CP*CP*TP*TP*TP*TP*C)-3'), DNA (5'-D(*GP*AP*AP*AP*AP*GP*G)-3') DNA DNA, NMR, DOUBLE HELIX

DX4    2-AMINO-1,9-DIHYDRO-6H-PURINE-6-THIONE

Code	Class Resolution	Description
3rkf	nuc      2.50	2-AMINO-1,9-DIHYDRO-6H-PURINE-6-THIONE 4(C5 H5 N5 S)	CRYSTAL STRUCTURE OF GUANINE RIBOSWITCH C61U/G37A DOUBLE MUT TO THIO-GUANINE GUANINE RIBOSWITCH RNA THREE-WAY JUNCTION, RIBOSWITCH, M-RNA, THIOGUANINE, RNA

DXA    1,2-HYDRO-1-OXY-3,4-HYDRO-3-(1-METHOXY-2-OXY-3,4- DIHYDROXYPENTYL)-8,9-DIHYDROXY-7-(SEC-BUTYL)- ANTHRACENE

Code	Class Resolution	Description
1cp8	nuc      NMR    	1,2-HYDRO-1-OXY-3,4-HYDRO-3-(1-METHOXY-2-OXY-3,4- DIHYDROXYPENTYL)-8,9-DIHYDROXY-7-(SEC-BUTYL)- ANTHRACENE 2(C24 H30 O7)	NMR STRUCTURE OF DNA (5'-D(TTGGCCAA)2-3') COMPLEXED WITH NOVEL ANTITUMOR DRUG UCH9 DNA (5'-D(P*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DNA

DXB    1,2-HYDRO-1-OXY-3,4-HYDRO-3-(1-METHOXY-2-OXY-3,4- DIHYDROXYPENTYL)-8,9-DIHYDROXY-7-METHYL-ANTHRACENE

Code	Class Resolution	Description
1bp8	nuc      NMR    	1,2-HYDRO-1-OXY-3,4-HYDRO-3-(1-METHOXY-2-OXY-3,4- DIHYDROXYPENTYL)-8,9-DIHYDROXY-7-METHYL-ANTHRACENE 4(C21 H24 O7)	4:2:1 MITHRAMYCIN:MG++:D(ACCCGGGT)2 COMPLEX 5'-D(*AP*CP*CP*CP*GP*GP*GP*T)-3' DNA MITHRAMYCIN, DNA, OLIGONUCLEOTIDE, NMR

DXD    (1S,3S,4R)-4-(PHOSPHOOXYMETHYL)-CYCLOPENTANE-1,3-DIOL

Code	Class Resolution	Description
1xcy	nuc      NMR    	(1S,3S,4R)-4-(PHOSPHOOXYMETHYL)-CYCLOPENTANE-1,3-DIOL C6 H13 O6 P	STRUCTURE OF DNA CONTAINING THE ALPHA-ANOMER OF A CARBOCYCLIC ABASIC SITE 5'-D(*CP*GP*TP*AP*CP*(DXD)P*CP*AP*TP*GP*C)-3', 5'-D(*GP*CP*AP*TP*GP*AP*GP*TP*AP*CP*G)-3' DNA DOUBLE HELIX, ABASIC SITE, DNA
1xcz	nuc      NMR    	(1S,3S,4R)-4-(PHOSPHOOXYMETHYL)-CYCLOPENTANE-1,3-DIOL C6 H13 O6 P	STRUCTURE OF DNA CONTAINING THE BETA-ANOMER OF A CARBOCYCLIC ABASIC SITE 5'-D(*GP*CP*AP*TP*GP*AP*GP*TP*AP*CP*G)-3', 5'-D(*CP*GP*TP*AP*CP*(DXD)P*CP*AP*TP*GP*C)-3' DNA DOUBLE HELIX, ABASIC SITE, DNA

E    N-((-)-(7S,8R,9S,10R)[7,8,9-TRIHYDROXY-7,8,9,10-TETRA HYDROBENZO[A]PYREN-10-YL])-2'-DEOXY-ADENOSINE-5'- MONOPHOSPHATE

Code	Class Resolution	Description
1agu	nuc      NMR    	N-((-)-(7S,8R,9S,10R)[7,8,9-TRIHYDROXY-7,8,9,10-TETRA HYDROBENZO[A]PYREN-10-YL])-2'-DEOXY-ADENOSINE-5'- MONOPHOSPHATE C30 H28 N5 O9 P	THE SOLUTION NMR STRUCTURE OF THE C10R ADDUCT OF BENZO[A]PYRENE-DIOL-EPOXIDE AT THE N6 POSITION OF ADENINE OF AN 11 BASE-PAIR OLIGONUCLEOTIDE SEQUENCE CODING FOR AMINO ACIDS 60-62 OF THE PRODUCT OF THE N-RAS PROTOONCOGENE, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*CP*TP*TP*CP*TP*TP*GP*TP*CP*CP*G)-3'), DNA (5'-D(*CP*GP*GP*AP*CP*EP*AP*GP*AP*AP*G)-3') DNA DNA DUPLEX, HUMAN N-RAS GENE, CODON 61 SEQUENCE, C10R-BPDE ADDUCT, INTERCALATION, N6-ADENINE ADDUCT, DEOXYRIBONUCLEIC ACID

E96    4-{[4-HYDROXY-PHENYL]-1H-BENZIMIDAZOLE-5-YL}- BENZIMIDAZOLE-2-YL-[4-HYDROXY-BENZENE]

Code	Class Resolution	Description
453d	nuc      1.80	4-{[4-HYDROXY-PHENYL]-1H-BENZIMIDAZOLE-5-YL}- BENZIMIDAZOLE-2-YL-[4-HYDROXY-BENZENE] C26 H18 N4 O2	5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'-BENZIMIDAZOLE COMPLEX DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA MINOR GROOVE BINDING, DNA

E97    [3-(4-{2'-[4-(3-DIMETHYLAMINO-PROPOXY)-PHENYL]-3H,3'H- [5,5']BIBENZOIMIDAZOLYL-2-YL}-PHENOXY)-PROPYL]- DIMETHYL-AMINE

Code	Class Resolution	Description
1ftd	nuc      2.00	[3-(4-{2'-[4-(3-DIMETHYLAMINO-PROPOXY)-PHENYL]-3H,3'H- [5,5']BIBENZOIMIDAZOLYL-2-YL}-PHENOXY)-PROPYL]- DIMETHYL-AMINE C36 H40 N6 O2	5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'-SYMMETRIC BIS- BENZIMIDAZOLE COMPLEX DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)- 3') DNA MINOR GROOVE BINDING, DNA

ECT    ECTEINASCIDIN 743

Code	Class Resolution	Description
1ez5	nuc      model  	ECTEINASCIDIN 743 C39 H43 N3 O11 S	COMPUTER MODEL OF A COVALENT COMPLEX BETWEEN D(TAAAGCTTA) AND ANTITUMOR DRUG ECTEINASCIDIN 743 DNA (5'-D(*TP*AP*AP*GP*CP*TP*TP*TP*A)-3'), DNA (5'-D(*TP*AP*AP*AP*GP*CP*TP*TP*A)-3') DEOXYRIBONUCLEIC ACID ANTICANCER, DNA, ECTEINASCIDIN, DEOXYRIBONUCLEIC ACID
1ezh	nuc      model  	ECTEINASCIDIN 743 C39 H43 N3 O11 S	COMPUTER MODEL OF A COVALENT COMPLEX BETWEEN D(TAACGGTTA) AND ANTITUMOR DRUG ECTEINASCIDIN 743 DNA (5'-D(*TP*AP*AP*CP*GP*GP*TP*TP*A)-3'), DNA (5'-D(*TP*AP*AP*CP*CP*GP*TP*TP*A)-3') DEOXYRIBONUCLEIC ACID ANTICANCER, DNA, ECTEINASCIDIN, DEOXYRIBONUCLEIC ACID, DNA BENDING
1kml	nuc      model  	ECTEINASCIDIN 743 3(C39 H43 N3 O11 S)	COMPUTER MODEL OF A COVALENT COMPLEX BETWEEN D(GTGGCGGCGGCC) AND THREE MOLECULES OF ANTITUMOR DRUG ECTEINASCIDIN 743 5'-D(*GP*GP*CP*CP*GP*CP*CP*GP*CP*CP*AP*C)-3', 5'-D(*GP*TP*GP*GP*CP*GP*GP*CP*GP*GP*CP*C)-3' DEOXYRIBONUCLEIC ACID ANTICANCER, DNA, ECTEINASCIDIN, DEOXYRIBONUCLEIC ACID
2b0i	nuc      model  	ECTEINASCIDIN 743 2(C39 H43 N3 O11 S)	COMPUTER MODEL OF A COVALENT COMPLEX BETWEEN D(GTATGGCCATAC) AND TWO MOLECULES OF ANTITUMOR DRUG TRABECTEDIN. 5'-D(*GP*TP*AP*TP*GP*GP*CP*CP*AP*TP*AP*C)-3' DEOXYRIBONUCLEIC ACID ANTICANCER, DNA, ECTEINASCIDINS, TRABECTEDIN, DEOXYRIBONUCLE

EDA    3-[2-DEOXY-RIBOFURANOSYL]-3H-1,3,4,5A,8-PENTAAZA-AS- INDACENE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
150d	nuc      2.25	3-[2-DEOXY-RIBOFURANOSYL]-3H-1,3,4,5A,8-PENTAAZA-AS- INDACENE-5'-MONOPHOSPHATE 2(C12 H14 N5 O6 P)	GUANINE.1,N6-ETHENOADENINE BASE-PAIRS IN THE CRYSTAL STRUCTURE OF D(CGCGAATT(EDA)GCG) DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(EDA) P*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, MODIFIED, MISMATCHED

EDC    N3,N4-ETHENO-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1b5k	nuc      NMR    	N3,N4-ETHENO-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C11 H14 N3 O7 P	3,N4-ETHENO-2'-DEOXYCYTIDINE OPPOSITE THYMIDINE IN AN 11-MER SOLUTION STRUCTURE FROM NMR AND MOLECULAR DYNAMICS DNA (5'-D(*CP*GP*TP*AP*CP*EDCP*CP*AP*TP*GP*C)-3') CHAIN: A, DNA (5'-D(*GP*CP*AP*TP*GP*TP*GP*TP*AP*CP*G)-3') DNA ETHENODC, EDC, EXOCYCLIC LESION, DNA
1b60	nuc      NMR    	N3,N4-ETHENO-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C11 H14 N3 O7 P	3,N4-ETHENO-2'-DEOXYCYTIDINE OPPOSITE CYTIDINE IN AN 11-MER SOLUTION STRUCTURE FROM NMR AND MOLECULAR DYNAMICS DNA (5'-D(*CP*GP*TP*AP*CP*(EDC)P*CP*AP*TP*GP*C)-3 CHAIN: A, DNA (5'-D(*GP*CP*AP*TP*GP*CP*GP*TP*AP*CP*G)-3') DNA ETHENODC, EDC, EXOCYCLIC LESION, DNA
1b6x	nuc      NMR    	N3,N4-ETHENO-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C11 H14 N3 O7 P	3,N4-ETHENO-2'-DEOXYCYTIDINE OPPOSITE GUANINE IN AN 11-MER D SOLUTION STRUCTURE FROM NMR AND MOLECULAR DYNAMICS, 4 STRUC 5'-D(*CP*GP*TP*AP*CP*(EDC)P*CP*AP*TP*GP*C)-3', 5'-D(*GP*CP*AP*TP*GP*GP*GP*TP*AP*CP*G)-3' DNA DEOXYRIBONUCLEIC ACID, ETHENODC, EDC, EXOCYCLIC LESION, DNA
1b6y	nuc      NMR    	N3,N4-ETHENO-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C11 H14 N3 O7 P	3,N4-ETHENO-2'-DEOXYCYTIDINE OPPOSITE ADENINE IN AN 11-MER D SOLUTION STRUCTURE FROM NMR AND MOLECULAR DYNAMICS, 2 STRUC 5'-D(*CP*GP*TP*AP*CP*(EDC)P*CP*AP*TP*GP*C)-3', 5'-D(*GP*CP*AP*TP*GP*AP*GP*TP*AP*CP*G)-3' DNA DEOXYRIBONUCLEIC ACID, ETHENODC, EDC, EXOCYCLIC LESION, DNA
1n5c	nuc      1.79	N3,N4-ETHENO-2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE C11 H14 N3 O7 P	CRYSTAL STRUCTURE ANALYSIS OF THE B-DNA DODECAMER CGCGAATT(E 5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(EDC)P*GP*CP*G)-3' DNA B FORM DOUBLE HELIX, 3, N4-ETHENO-2'-CYTIDINE MODIFICATION O G, DNA

EDI    2'-DEOXY-1-(2-IODOETHYL)INOSINE

Code	Class Resolution	Description
2mh6	nuc      NMR    	2'-DEOXY-1-(2-IODOETHYL)INOSINE C12 H16 I N4 O7 P	SOLUTION STRUCTURE OF DNA DUPLEX CONTAINING N3T-ETHYLENE-N1I INTERSTRAND CROSS-LINK 5'-D(*TP*GP*GP*AP*IP*CP*TP*G)-3', 5'-D(*CP*AP*GP*TP*TP*CP*CP*A)-3' DNA DNA DUPLEX, INTERSTRAND CROSS-LINK, DNA

EEM    [(3S)-3-AMINO-4-HYDROXY-4-OXO-BUTYL]-[[(2S,3S,4R,5R)- 5-(6-AMINOPURIN-9-YL)-3,4-DIHYDROXY-OXOLAN-2- YL]METHYL]-METHYL-SELANIUM

Code	Class Resolution	Description
3e5f	nuc      2.70	[(3S)-3-AMINO-4-HYDROXY-4-OXO-BUTYL]-[[(2S,3S,4R,5R)- 5-(6-AMINOPURIN-9-YL)-3,4-DIHYDROXY-OXOLAN-2- YL]METHYL]-METHYL-SELANIUM C15 H23 N6 O5 SE 1+	CRYSTAL STRUCTURES OF THE SMK BOX (SAM-III) RIBOSWITCH WITH SE-SAM SMK BOX (SAM-III) RIBOSWITCH FOR RNA RNA SMK SAM RIBOSWITCH SHINE-DELGARNO TRANSLATION REGULATION, RNA

EIT    ((3R,4R,5R)-4-(2-(1H-IMIDAZOL-1-YL)ETHOXY)-3-HYDROXY- 5-(5-METHYL-2,4-DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL)- TETRAHYDROFURAN-2-YL)METHYL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
1y84	nuc      1.60	((3R,4R,5R)-4-(2-(1H-IMIDAZOL-1-YL)ETHOXY)-3-HYDROXY- 5-(5-METHYL-2,4-DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL)- TETRAHYDROFURAN-2-YL)METHYL DIHYDROGEN PHOSPHATE 2(C15 H21 N4 O9 P)	CRYSTAL STRUCTURE OF THE A-DNA GCGTAT*CGC WITH A 2'-O-[2- (IMIDAZOLYL)ETHYL] THYMIDINE (T*) 5'-D(*GP*CP*GP*TP*AP*(EIT)P*AP*CP*GP*C)-3' DNA CRYSTAL STRUCTURE, A-DNA, O2'-MODIFICATION, DECAMER.

EL    ELLIPTICINE

Code	Class Resolution	Description
1z3f	nuc      1.50	ELLIPTICINE 2(C17 H15 N2 1+)	STRUCTURE OF ELLIPTICINE IN COMPLEX WITH A 6-BP DNA 5'-D(*CP*GP*AP*TP*CP*G)-3' DNA ANTICANCER, DNA BINDING, DRUG DESIGN, ELLIPTICINE, INTERCALATOR

EMP    2,4-DIDEOXY-4-(ETHYLAMINO)-3-O-METHYL ALPHA-L-THREO- PENTOPYRANOSIDE

Code	Class Resolution	Description
2pik	nuc      NMR    	2,4-DIDEOXY-4-(ETHYLAMINO)-3-O-METHYL ALPHA-L-THREO- PENTOPYRANOSIDE C8 H17 N O3	CALICHEAMICIN GAMMA1I-DNA COMPLEX, NMR, 6 STRUCTURES DNA(5'-D(C*AP*CP*TP*CP*CP*TP*GP*GP*TP*TP*TP*TP* TP*GP*TP*GP*AP*GP*GP*AP*CP*CP)-3') DNA DEOXYRIBONUCLEIC ACID, CALICHEAMICIN GAMMA1I - DNA COMPLEX, ENEDIYNE ALIGNMENT IN MINOR GROOVE, SACCHARIDE DNA MINOR GROOVE INTERACTIONS, INTERMOLECULAR DRUG IODINE-GUANINE AMINO PROTON INTERACTIONS, SPECIFICITY AND CLEAVAGE PROCESS

EOH    ETHANOL

Code	Class Resolution	Description
1en8	nuc      0.98	ETHANOL 4(C2 H6 O)	1 A CRYSTAL STRUCTURES OF B-DNA REVEAL SEQUENCE-SPECIFIC BINDING AND GROOVE-SPECIFIC BENDING OF DNA BY MAGNESIUM AND CALCIUM DNA (5'-D(*CP*CP*AP*AP*CP*GP*TP*TP*GP*G)-3') DNA DIVALENT CATIONS, DNA SEQUENCE-SPECIFIC BINDING, SHELXDNA, B-DNA
1ene	nuc      0.98	ETHANOL 3(C2 H6 O)	1A CRYSTAL STRUCTURES OF B-DNA REVEAL SEQUENCE-SPECIFIC BINDING AND GROOVE-SPECIFIC BENDING OF DNA BY MAGNESIUM AND CALCIUM. DNA (5'-D(*CP*CP*AP*GP*CP*GP*CP*TP*GP*G)-3') DNA DIVALENT CATIONS, DNA SEQUENCE-SPECIFIC BINDING, SHELXDNA, B-DNA

EPE    4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID

Code	Class Resolution	Description
4e8k	nuc      3.03	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 5(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF K+, CA2+ AND A NON-HYDROLYZED OLIGONUCLEOTIDE SUBSTRATE GROUP IIC INTRON: DOMAINS 1-5, 5'-R(*CP*G*AP*UP*UP*UP*AP*UP*UP*A)-3' RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, RNA
4e8m	nuc      3.50	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 6(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF K+ AND MG2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4e8n	nuc      2.96	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 4(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF NH4+ AND MG2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4e8p	nuc      3.28	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 6(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF RB+ AND MG2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, METALLOENZYMES, SELF-SPLICING, RETROTRANSPOSITION,
4e8q	nuc      2.84	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 5(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF TL+ AND MG2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4e8r	nuc      3.36	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 5(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF CS+ AND MG2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4e8t	nuc      3.34	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 6(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF K+, CA2+ AND AN OLIGONUCLEOTIDE FRAGMENT SUBSTRATE (LOW DATASET) GROUP IIC INTRON: DOMAINS 1-5, 5'-R(*AP*UP*UP*UP*AP*UP*UP*A)-3' RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4e8v	nuc      4.00	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 6(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF K+ AND BA2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, METALLOENZYME, SELF-SPLICING, RETROTRANSPOSITION,
4faq	nuc      3.11	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 6(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF K+, CA2+ AND 5'-EXON GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, SPLICEOSOME, RN
4far	nuc      2.86	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 5(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF K+, MG2+ AND 5'-EXON GRUUP IIC INTRON: DOMAINS 1-5, GROUP IIC INTRON: 5'-EXON RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, SPLICEOSOME, RN
4fau	nuc      2.87	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 3(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF LI+, MG2+ AND 5'-EXON GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, SPLICEOSOME, RN
4faw	nuc      2.70	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 4(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN THE OF K+, MG2+ AND A HYDROLYZED OLIGONUCLEOTIDE FRAGMENT GROUP IIC INTRON: DOMAINS 1-5, 5'-R(*A*UP*UP*UP*AP*UP*UP*A)-3' RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, SPLICEOSOME, RN
4fax	nuc      3.10	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 3(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON IN A L STATE IN THE PRESENCE OF NA+ AND MG2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, SPLICEOSOME, RN
4fb0	nuc      3.22	4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID 5(C8 H18 N2 O4 S)	STRUCTURE OF OCEANOBACILLUS IHEYENSIS GROUP II INTRON C377G A LIGAND-FREE STATE IN THE PRESENCE OF K+ AND MG2+ GROUP IIC INTRON: DOMAINS 1-5 RNA RIBOZYME, SELF-SPLICING, RETROTRANSPOSITION, SPLICEOSOME, RN

ERI    4-O-ACETYL-2,6-DIDEOXY-3-C-METHYL-BETA-L-ARABINO- HEXOPYRANOSE

Code	Class Resolution	Description
1d83	nuc      NMR    	4-O-ACETYL-2,6-DIDEOXY-3-C-METHYL-BETA-L-ARABINO- HEXOPYRANOSE 2(C9 H16 O5)	STRUCTURE REFINEMENT OF THE CHROMOMYCIN DIMER/DNA OLIGOMER COMPLEX IN SOLUTION DNA (5'-D(*AP*AP*GP*GP*CP*CP*TP*T)-3') DNA DNA, NMR, DOUBLE HELIX, CHROMOMYCIN
1ekh	nuc      NMR    	4-O-ACETYL-2,6-DIDEOXY-3-C-METHYL-BETA-L-ARABINO- HEXOPYRANOSE 2(C9 H16 O5)	NMR STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND CO DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1eki	nuc      NMR    	4-O-ACETYL-2,6-DIDEOXY-3-C-METHYL-BETA-L-ARABINO- HEXOPYRANOSE 2(C9 H16 O5)	AVERAGE SOLUTION STRUCTURE OF D(TTGGCCAA)2 BOUND TO CHROMOMY COBALT DNA (5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3') DNA DRUG BOUND IN THE MINOR GROOVE OF DNA, DNA
1vaq	nuc      2.00	4-O-ACETYL-2,6-DIDEOXY-3-C-METHYL-BETA-L-ARABINO- HEXOPYRANOSE 4(C9 H16 O5)	CRYSTAL STRUCTURE OF THE MG2+-(CHROMOMYCIN A3)2-D(TTGGCCAA) 2 COMPLEX REVEALS GGCC BINDING SPECIFICITY OF THE DRUG DIMER CHELATED BY METAL ION 5'-D(*TP*TP*GP*GP*CP*CP*AP*A)-3' DNA CHROMOMYCIN A3, X-RAY DIFFRACTION, MAD, DNA DUPLEX, GGCC SITE, DNA KINK, CD SPECTRA
5erz	nuc      1.75	4-O-ACETYL-2,6-DIDEOXY-3-C-METHYL-BETA-L-ARABINO- HEXOPYRANOSE 2(C9 H16 O5)	CRYSTAL STRUCTURE OF THE [NI2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX
5es0	nuc      2.10	4-O-ACETYL-2,6-DIDEOXY-3-C-METHYL-BETA-L-ARABINO- HEXOPYRANOSE 2(C9 H16 O5)	CRYSTAL STRUCTURE OF THE [CO2+-(CHROMOMYCIN A3)2]-D(TTCCGCCG COMPLEX DNA (5'-D(*TP*TP*CP*CP*GP*CP*CP*GP*CP*CP*GP*AP*A) CHAIN: A, B DNA/ANTIBIOTIC NUCLEOTIDE FLIPPING-OUT, CCG TRINUCLEOTIDE REPEATS, CHROMOMY METALLOANTIBIOTICS, MINOR GROOVE BINDING DRUG, DNA-ANTIBIOT COMPLEX

ERN    (3R,4S,5S,6R,7R,9R,10S,11S,12R,13S,14R)-10-AMINO-6- {[(2S,3R,4S,6R)-4-(DIMETHYLAMINO)-3-HYDROXY-6- METHYLTETRAHYDRO-2H-PYRAN-2-YL]OXY}-14-ETHYL-7,12,13- TRIHYDROXY-4-{[(2R,4R,5S,6S)-5-HYDROXY-4-METHOXY-4,6- DIMETHYLTETRAHYDRO-2H-PYRAN-2-YL]OXY}-3,5,7,9,11

Code	Class Resolution	Description
2o43	nuc      3.60	(3R,4S,5S,6R,7R,9R,10S,11S,12R,13S,14R)-10-AMINO-6- {[(2S,3R,4S,6R)-4-(DIMETHYLAMINO)-3-HYDROXY-6- METHYLTETRAHYDRO-2H-PYRAN-2-YL]OXY}-14-ETHYL-7,12,13- TRIHYDROXY-4-{[(2R,4R,5S,6S)-5-HYDROXY-4-METHOXY-4,6- DIMETHYLTETRAHYDRO-2H-PYRAN-2-YL]OXY}-3,5,7,9,11 C37 H70 N2 O12	STRUCTURE OF 23S RRNA OF THE LARGE RIBOSOMAL SUBUNIT FROM DE RADIODURANS IN COMPLEX WITH THE MACROLIDE ERYTHROMYCYLAMINE 23S RRNA RNA RIBOSOME, MACROLIDES, RNA

ESO    O3-PHOSPHONOESTRONE

Code	Class Resolution	Description
1ess	nuc      NMR    	O3-PHOSPHONOESTRONE 2(C18 H23 O5 P)	STEROID TETHERED DNA, NMR, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(P*TP*CP*CP*A)-3'), DNA (5'-D(P*CP*AP*GP*C)-3'), DNA (5'-D(P*TP*GP*GP*AP*GP*CP*TP*G)-3') DNA DEOXYRIBONUCLEIC ACID, ESTRONE, DNA, NMR, STEROID TETHERED

EU    EUROPIUM ION

Code	Class Resolution	Description
1bub	nuc      NMR    	EUROPIUM ION 2(EU 2+)	DETERMINATION OF INTERNUCLEAR ANGLES OF DNA USING PARAMAGNETIC ASSISTED MAGNETIC ALIGNMENT DNA (5'- D(*GP*GP*TP*TP*GP*GP*TP*GP*TP*GP*GP*TP*TP*GP*G)-3'): TELOMERE DNA QUDRAPLEX DNA, DUPLEX, EU BINDING DNA, TELOMERE DNA

EXC    3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-8-HYDROXY-7,7,9,9-TETRAMETHYL-7,8,9, 11-TETRAHYDROPYRIMIDO[4',5':5,6][1,4]OXAZINO[2,3- F]ISOINDOL-2(3H)-ONE RADICAL

Code	Class Resolution	Description
3ot0	nuc      1.70	3-(2-DEOXY-5-O-PHOSPHONO-BETA-D-ERYTHRO- PENTOFURANOSYL)-8-HYDROXY-7,7,9,9-TETRAMETHYL-7,8,9, 11-TETRAHYDROPYRIMIDO[4',5':5,6][1,4]OXAZINO[2,3- F]ISOINDOL-2(3H)-ONE RADICAL 2(C21 H26 N4 O9 P)	CRYSTAL STRUCTURE OF A DNA CONTAINING THE RIGID NITROXIDE SP NUCLEOTIDE C-SPIN SPIN-LABELED DNA DNA NITROXIDE, SPIN-LABEL, EPR SPECTROSCOPY, FLUORESCENCE SPECTR MODIFIED NUCLEIC ACID, C-SPIN, DEOXYCYTOSINE ANALOG, PHENOX SPECTROSCOPIC PROBE, PELDOR, 2'-O-METHYL U, DNA

F    FLUORIDE ION

Code	Class Resolution	Description
3vrs	nuc      2.60	FLUORIDE ION F 1-	CRYSTAL STRUCTURE OF FLUORIDE RIBOSWITCH, SOAKED IN MN2+ FLUORIDE RIBOSWITCH RNA PSEUDOKNOT, RNA
4en5	nuc      2.96	FLUORIDE ION F 1-	CRYSTAL STRUCTURE OF FLUORIDE RIBOSWITCH, TL-ACETATE SOAKED FLUORIDE RIBOSWITCH RNA PSEUDOKNOT, RNA
4ena	nuc      2.85	FLUORIDE ION F 1-	CRYSTAL STRUCTURE OF FLUORIDE RIBOSWITCH, SOAKED IN CS+ FLUORIDE RIBOSWITCH RNA PSEUDOKNOT, RNA
4enb	nuc      2.30	FLUORIDE ION F 1-	CRYSTAL STRUCTURE OF FLUORIDE RIBOSWITCH, BOUND TO IRIDIUM FLUORIDE RIBOSWITCH RNA PSEUDOKNOT, RNA
4enc	nuc      2.27	FLUORIDE ION F 1-	CRYSTAL STRUCTURE OF FLUORIDE RIBOSWITCH FLUORIDE RIBOSWITCH RNA PSEUDOKNOT, RNA

F3H    1,5-ANHYDRO-2,3-DIDEOXY-3-FLUORO-2-(5-METHYL-2,4-DIOXO- 3,4-DIHYDROPYRIMIDIN-1(2H)-YL)-6-O-PHOSPHONO-D- ALTRITOL

Code	Class Resolution	Description
3q61	nuc      1.56	1,5-ANHYDRO-2,3-DIDEOXY-3-FLUORO-2-(5-METHYL-2,4-DIOXO- 3,4-DIHYDROPYRIMIDIN-1(2H)-YL)-6-O-PHOSPHONO-D- ALTRITOL 2(C11 H16 F N2 O8 P)	3'-FLUORO HEXITOL NUCLEIC ACID DNA STRUCTURE DNA (5'-D(*GP*CP*GP*TP*AP*(F3H)P*AP*CP*GP*C)-3') DNA A-FORM DNA, 3'-FLUORO HEXITOL NUCLEIC ACID, FHNA, ANTISENSE OLIGONUCLEOTIDES, DNA

F4H    1,5-ANHYDRO-2,3-DIDEOXY-3-FLUORO-2-(5-METHYL-2,4-DIOXO- 3,4-DIHYDROPYRIMIDIN-1(2H)-YL)-6-O-PHOSPHONO-D- MANNITOL

Code	Class Resolution	Description
3sd8	nuc      1.67	1,5-ANHYDRO-2,3-DIDEOXY-3-FLUORO-2-(5-METHYL-2,4-DIOXO- 3,4-DIHYDROPYRIMIDIN-1(2H)-YL)-6-O-PHOSPHONO-D- MANNITOL 2(C11 H16 F N2 O8 P)	CRYSTAL STRUCTURE OF ARA-FHNA DECAMER DNA 5'-D(*GP*CP*GP*TP*AP*(F4H)P*AP*CP*GP*C)-3' DNA A-FORM DNA, ARA-3'-FLUORO HEXITOL NUCLEIC ACID, ARA-FHNA, AN OLIGONUCLEOTIDES, DNA

F5H    3,7-ANHYDRO-1,5,6-TRIDEOXY-5-FLUORO-6-(5-METHYL-2,4- DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL)-2-O-PHOSPHONO-D- GLYCERO-L-ALTRO-HEPTITOL

Code	Class Resolution	Description
3v06	nuc      1.53	3,7-ANHYDRO-1,5,6-TRIDEOXY-5-FLUORO-6-(5-METHYL-2,4- DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL)-2-O-PHOSPHONO-D- GLYCERO-L-ALTRO-HEPTITOL 2(C12 H18 F N2 O8 P)	CRYSTAL STRUCTURE OF S-6'-ME-3'-FLUORO HEXITOL NUCLEIC ACID DNA (5'-D(*GP*CP*GP*TP*AP*(F5H)P*AP*CP*GP*C)-3') DNA A-FORM DNA, 3'-FLUORO HEXITOL NUCLEIC ACID, FHNA, S-6'-ME-FH ANTISENSE OLIGONUCLEOTIDES, DNA

F6H    3,7-ANHYDRO-1,5,6-TRIDEOXY-5-FLUORO-6-(5-METHYL-2,4- DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL)-2-O-PHOSPHONO-D- GLYCERO-L-ALLO-HEPTITOL

Code	Class Resolution	Description
3v07	nuc      1.24	3,7-ANHYDRO-1,5,6-TRIDEOXY-5-FLUORO-6-(5-METHYL-2,4- DIOXO-3,4-DIHYDROPYRIMIDIN-1(2H)-YL)-2-O-PHOSPHONO-D- GLYCERO-L-ALLO-HEPTITOL 2(C12 H18 F N2 O8 P)	CRYSTAL STRUCTURE OF R-6'-ME-3'-FLUORO HEXITOL NUCLEIC ACID DNA (5'-D(*GP*CP*GP*TP*AP*(F6H)P*AP*CP*GP*C)-3') DNA A-FORM DNA, 3'-FLUORO HEXITOL NUCLEIC ACID, FHNA, R-6'-ME-FH ANTISENSE OLIGONUCLEOTIDES, DNA

FA2    5-(6-AMINO-9H-PURIN-9-YL)-4-HYDROXYTETRAHYDROFURAN-3- YL DIHYDROGEN PHOSPHATE

Code	Class Resolution	Description
1pwf	nuc      1.16	5-(6-AMINO-9H-PURIN-9-YL)-4-HYDROXYTETRAHYDROFURAN-3- YL DIHYDROGEN PHOSPHATE 2(C9 H12 N5 O6 P)	ONE SUGAR PUCKER FITS ALL: PAIRING VERSATILITY DESPITE CONFORMATIONAL UNIFORMITY IN TNA 5'-D(*GP*CP*GP*TP*AP*(2MU)P*(FA2)P*CP*GP*C)-3' DNA A-DNA, HYDROGEN BONDING, NUCLEIC ACID ETIOLOGY, TETROSE, FOUR CARBON SUGAR, X-RAY CRYSTALLOGRAPHY, NUCLEIC ACID ANALOGUE

FAG    [1',2'-DIDEOXY[2-AMINO-5-([9-HYDROXY-AFLATOXINB2-8- YL]-FORMYL-AMINO)-6-OXO-1,6-IHYDRO-PYRIMIDIN-4- YLAMINO]-RIBOFURANOSE]-5-MONOPHOSPHATE GROUP

Code	Class Resolution	Description
1hm1	nuc      NMR    	[1',2'-DIDEOXY[2-AMINO-5-([9-HYDROXY-AFLATOXINB2-8- YL]-FORMYL-AMINO)-6-OXO-1,6-IHYDRO-PYRIMIDIN-4- YLAMINO]-RIBOFURANOSE]-5-MONOPHOSPHATE GROUP C27 H28 N5 O15 P	THE SOLUTION NMR STRUCTURE OF A THERMALLY STABLE FAPY ADDUCT OF AFLATOXIN B1 IN AN OLIGODEOXYNUCLEOTIDE DUPLEX REFINED FROM DISTANCE RESTRAINED MOLECULAR DYNAMICS SIMULATED ANNEALING, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(TP*GP*AP*AP*TP*CP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*(FAG)P*AP*TP*TP*CP*A)-3') DNA AFLATOXIN B1, FAPY, FORMAMIDOPYRIMIDINE, INTERCALATION, DNA DUPLEX, NMR, SOLUTION STRUCTURE, DNA ADDUCT, DEOXYRIBONUCLEIC ACID
2kh3	nuc      NMR    	[1',2'-DIDEOXY[2-AMINO-5-([9-HYDROXY-AFLATOXINB2-8-YL]- FORMYL-AMINO)-6-OXO-1,6-IHYDRO-PYRIMIDIN-4-YLAMINO]- RIBOFURANOSE]-5-MONOPHOSPHATE GROUP C27 H28 N5 O15 P	NMR STRUCTURE OF AFLATOXIN FORMAMIDOPYRIMIDINE ALPHA-ANOMER IN DUPLEX DNA 5'-D(*CP*TP*AP*TP*(FAG)P*AP*TP*TP*CP*A)-3', 5'-D(*TP*GP*AP*AP*TP*CP*AP*TP*AP*G)-3' DNA DNA, AFLATOXIN, FORMAMIDOPYRIMIDINE, ALPHA ANOMER
2kh4	nuc      NMR    	[1',2'-DIDEOXY[2-AMINO-5-([9-HYDROXY-AFLATOXINB2-8-YL]- FORMYL-AMINO)-6-OXO-1,6-IHYDRO-PYRIMIDIN-4-YLAMINO]- RIBOFURANOSE]-5-MONOPHOSPHATE GROUP C27 H28 N5 O15 P	AFLATOXIN FORMAMIDOPYRIMIDINE ALPHA ANOMER IN SINGLE STRAND DNA 5'-D(*CP*TP*(FAG)P*A)-3' DNA AFLATOXIN, FORMAMIDOPYRIMIDINE, ALPHA ANOMER, DNA
2mmf	nuc      NMR    	[1',2'-DIDEOXY[2-AMINO-5-([9-HYDROXY-AFLATOXINB2-8-YL]- FORMYL-AMINO)-6-OXO-1,6-IHYDRO-PYRIMIDIN-4-YLAMINO]- RIBOFURANOSE]-5-MONOPHOSPHATE GROUP C27 H28 N5 O15 P	SOLUTION STRUCTURE OF AGA MODIFIED DNA_(5'-D(*TP*GP*AP*AP*TP*CP*TP*TP*AP*G)-3'), DNA_(5'-D(*CP*TP*AP*AP*(FAG)P*AP*TP*TP*CP*A)-3') DNA AFLATOXIN B1, FAPY, FORMAMIDOPYRIMIDINE, INTERCALATION, DNA DNA ADDUCT, SEQUENCE DEPENDENCE, DNA
2mmq	nuc      NMR    	[1',2'-DIDEOXY[2-AMINO-5-([9-HYDROXY-AFLATOXINB2-8-YL]- FORMYL-AMINO)-6-OXO-1,6-IHYDRO-PYRIMIDIN-4-YLAMINO]- RIBOFURANOSE]-5-MONOPHOSPHATE GROUP C27 H28 N5 O15 P	SOLUTION STRUCTURE OF AGT FAPY MODIFIED DUPLEX DNA_(5'-D(*CP*TP*AP*AP*(FAG)P*TP*TP*TP*CP*A)-3'), DNA_(5'-D(*TP*GP*AP*AP*AP*CP*TP*TP*AP*G)-3') DNA AFLATOXIN B1, FAPY, FORMAMIDOPYRIMIDINE, INTERCALATION, DNA DEOXYRIBONUCLEIC ACID, HYDROGEN BOND, SEQUENCE DEPENDENCE,
2mmr	nuc      NMR    	[1',2'-DIDEOXY[2-AMINO-5-([9-HYDROXY-AFLATOXINB2-8-YL]- FORMYL-AMINO)-6-OXO-1,6-IHYDRO-PYRIMIDIN-4-YLAMINO]- RIBOFURANOSE]-5-MONOPHOSPHATE GROUP C27 H28 N5 O15 P	AGC FAPY MODIFIED DUPLEX MAJOR ISOMER DNA_(5'-D(*TP*GP*AP*AP*GP*CP*TP*TP*AP*G)-3'), DNA_(5'-D(*CP*TP*AP*AP*(FAG)P*CP*TP*TP*CP*A)-3') DNA AFLATOXIN B1, FAPY, FORMAMIDOPYRIMIDINE, INTERCALATION, DNA DEOXYRIBONUCLEIC ACID, HYDROGEN BOND, SEQUENCE DEPENDENCE, MAJOR ISOMER, DNA
2mms	nuc      NMR    	[1',2'-DIDEOXY[2-AMINO-5-([9-HYDROXY-AFLATOXINB2-8-YL]- FORMYL-AMINO)-6-OXO-1,6-IHYDRO-PYRIMIDIN-4-YLAMINO]- RIBOFURANOSE]-5-MONOPHOSPHATE GROUP C27 H28 N5 O15 P	AG(7-DEAZA)G FAPY MODIFIED DUPLEX DNA_(5'-D(*CP*TP*AP*AP*(FAG)P*(7GU)P*TP*TP*CP*A)- CHAIN: A, DNA_(5'-D(*TP*GP*AP*AP*CP*CP*TP*TP*AP*G)-3') DNA AFLATOXIN B1, FAPY, FORMAMIDOPYRIMIDINE, INTERCALATION, DNA DEOXYRIBONUCLEIC ACID, HYDROGEN BOND, SEQUENCE DEPENDENCE, DEAZA)G, DNA

FE2    FE (II) ION

Code	Class Resolution	Description
2et0	nuc      1.70	FE (II) ION 6(FE 2+)	THE STRUCTURE OF A THREE-WAY DNA JUNCTION IN COMPLEX WITH A SUPRAMOLECULAR HELICATE REVEALS A NEW TARGET FOR DRUGS 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, 3-WAY JUNCTION, DNA STRUCTURE RECOGNITION,
3fx8	nuc      2.44	FE (II) ION 4(FE 2+)	DISTINCT RECOGNITION OF THREE-WAY DNA JUNCTIONS BY A THIOESTER VARIANT OF A METALLO-SUPRAMOLECULAR CYLINDER ('HELICATE') (5'-D(*CP*GP*TP*AP*CP*G)-3' DNA SELF-ASSEMBLY, DNA-BASED NANOMATERIAL, DNA
3i1d	nuc      2.50	FE (II) ION 6(FE 2+)	DISTINCT RECOGNITION OF THREE-WAY DNA JUNCTIONS BY THE TWO E OF A METALLO-SUPRAMOLECULAR CYLINDER ('HELICATE') 5'-D(*CP*GP*TP*AP*CP*G)-3' DNA DRUG-DNA COMPLEX, 3-WAY JUNCTION, DNA STRUCTURE RECOGNITION,
4jiy	nuc      1.91	FE (II) ION 4(FE 2+)	RNA THREE-WAY JUNCTION STABILIZED BY A SUPRAMOLECULAR DI-IRO CYLINDER DRUG 5'-(CGUACG)-3' RNA RNA, THREE-WAY JUNCTION, DRUG-RNA COMPLEX, RNA STRUCTURE REC CYLINDER, SUPRAMOLECULE

FFD    (1R)-1,4-ANHYDRO-2-DEOXY-1-(3-FLUOROPHENYL)-5-O- PHOSPHONO-D-ERYTHRO-PENTITOL

Code	Class Resolution	Description
2pis	nuc      2.80	(1R)-1,4-ANHYDRO-2-DEOXY-1-(3-FLUOROPHENYL)-5-O- PHOSPHONO-D-ERYTHRO-PENTITOL 12(C11 H14 F O6 P)	EFFORTS TOWARD EXPANSION OF THE GENETIC ALPHABET: STRUCTURE AND REPLICATION OF UNNATURAL BASE PAIRS DNA (5'-D(*CP*GP*(CBR)P*GP*AP*AP*(FFD) P*TP*TP*CP*GP*CP*G)-3') DNA NUCLEIC ACID, DUPLEX, REPLICATION, UNNATURAL BASE, DNA

FFO    N-[4-({[(6S)-2-AMINO-5-FORMYL-4-OXO-3,4,5,6,7,8- HEXAHYDROPTERIDIN-6-YL]METHYL}AMINO)BENZOYL]-L- GLUTAMIC ACID

Code	Class Resolution	Description
3suh	nuc      2.65	N-[4-({[(6S)-2-AMINO-5-FORMYL-4-OXO-3,4,5,6,7,8- HEXAHYDROPTERIDIN-6-YL]METHYL}AMINO)BENZOYL]-L- GLUTAMIC ACID C20 H23 N7 O7	CRYSTAL STRUCTURE OF THF RIBOSWITCH, BOUND WITH 5-FORMYL-THF RIBOSWITCH RNA THREE-WAY JUNCTION, PSEUDOKNOT, GENE REGULATOR, THF, RNA
4lvv	nuc      2.10	N-[4-({[(6S)-2-AMINO-5-FORMYL-4-OXO-3,4,5,6,7,8- HEXAHYDROPTERIDIN-6-YL]METHYL}AMINO)BENZOYL]-L- GLUTAMIC ACID 2(C20 H23 N7 O7)	STRUCTURE OF THE THF RIBOSWITCH THF RIBOSWITCH RNA APTAMERS, NUCLEOTIDE, BACTERIAL PROTEINS, BASE SEQUENCE, BIN SITES, CALORIMETRY, FOLIC ACID, GENE EXPRESSION REGULATION, BACTERIAL, GUANINE, LEUCOVORIN, LIGANDS, MAGNESIUM, MOLECUL SEQUENCE DATA, NUCLEIC ACID CONFORMATION, POINT MUTATION, P BINDING, S-ADENOSYLMETHIONINE, STREPTOCOCCUS MUTANS, TERMIN REGIONS, GENETIC, TETRAHYDROFOLATES, THERMODYNAMICS, TRANSC THREE-WAY JUNCTION, PSEUDOKNOT, REGULATION, NCRNA, THF BIND MRNA, RNA

FLD    BIS-(N-ETHYLPYRIDINIUM-(3-METHOXYCARBAZOLE))HEXANE-1, 6-DIAMINE

Code	Class Resolution	Description
154d	nuc      2.50	BIS-(N-ETHYLPYRIDINIUM-(3-METHOXYCARBAZOLE))HEXANE-1, 6-DIAMINE C42 H48 N6 O2 4+	DNA DISTORTION IN BIS-INTERCALATED COMPLEXES DNA (5'-D(*(CBR)P*GP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED

FMN    FLAVIN MONONUCLEOTIDE

Code	Class Resolution	Description
1fmn	nuc      NMR    	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	SOLUTION STRUCTURE OF FMN-RNA APTAMER COMPLEX, NMR, 5 STRUCTURES RNA (5'-R(*GP*GP*CP*GP*UP*GP*UP*AP*GP*GP *AP*UP*AP*UP*GP*CP*UP*UP*CP*GP*GP*CP*AP*GP*AP*AP*GP *GP*AP*CP*AP*CP*GP*CP*C)-3') RNA FMN-RNA COMPLEX, FMN-ADENINE PAIRING, FMN INTERCALATION, BASE TRIPLE PLATFORM, BASE PAIR MISMATCHES
2yie	nuc      2.94	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	CRYSTAL STRUCTURE OF A F. NUCLEATUM FMN RIBOSWITCH BOUND TO FMN RIBOSWITCHFMN RIBOSWITCH: APTAMER DOMAIN, RESIDUES 2495-2544APTAMER DOMAIN, RESIDUES 2550-2601 RNA RNA
3f2q	nuc      2.95	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN FMN RIBOSWITCH RNA FMN RIBOSWITCH, TRANSCRIPTION, RNA
3f2t	nuc      3.00	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, IRIDIU SOAK. FMN RIBOSWITCH RNA FMN RIBOSWITCH, TRANSCRIPTION, RNA
3f2w	nuc      3.45	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, BA2+ S FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, BARIUM, RNA
3f2x	nuc      3.11	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, CS+ SO FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, CESIUM, RNA
3f2y	nuc      3.20	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, MN2+ S FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, MANGANESE, RNA
3f30	nuc      3.15	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, COBALT SOAK. FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, COBALT HEXAMINE, RNA
3f4e	nuc      3.05	FLAVIN MONONUCLEOTIDE C17 H21 N4 O9 P	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, SPLIT FMN RIBOSWITCH, FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, RNA

FOZ    N-[4-({[(6S)-2-AMINO-5-FORMYL-4-OXO-1,4,5,6,7,8- HEXAHYDROPTERIDIN-6-YL]METHYL}AMINO)BENZOYL]-L- GLUTAMIC ACID

Code	Class Resolution	Description
3sd3	nuc      1.95	N-[4-({[(6S)-2-AMINO-5-FORMYL-4-OXO-1,4,5,6,7,8- HEXAHYDROPTERIDIN-6-YL]METHYL}AMINO)BENZOYL]-L- GLUTAMIC ACID C20 H23 N7 O7	THE STRUCTURE OF THE TETRAHYDROFOLATE RIBOSWITCH CONTAINING MUTATION TETRAHYDROFOLATE RIBOSWITCH RNA TETRAHYDROFOLATE RNA RIBOSWITCH, RNA

G    GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1nyi	nuc      2.85	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	CROSSLINKED HAMMERHEAD RIBOZYME INITIAL STATE 5'- R(P*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP*GP*AP*GP*GP*CP*C)-3', 5'- R(*GP*CP*CP*GP*AP*AP*AP*CP*UP*CP*GP*UP*AP*AP*GP*AP*GP*UP*CP *AP*CP*CP*AP*C)-3' RNA HAMMERHEAD RIBOZYME CROSSLINK CONFORMATIONAL CHANGE, RNA
1y27	nuc      2.40	GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O8 P	G-RIBOSWITCH-GUANINE COMPLEX BACILLUS SUBTILIS XPT: SEQUENCE DATABASE RESIDUES 185-252 RNA G-RIBOSWITCH GUANINE RECOGNITION, RNA
5l00	nuc      1.25	GUANOSINE-5'-MONOPHOSPHATE 4(C10 H14 N5 O8 P)	SELF-COMPLIMENTARY RNA 15MER BINDING WITH GMP MONOMERS RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG) P*AP*CP*UP*UP*AP*AP*GP*UP*CP*GP*G)-3') RNA RNA

G0B    (1S,2R,3S,4R,6S)-4,6-BIS{[AMINO(IMINIO)METHYL]AMINO}-2- {[3-O-(2,6-BIS{[AMINO(IMINIO)METHYL]AMINO}-2,6- DIDEOXY-BETA-L-GLUCOPYRANOSYL)-BETA-D- ARABINOFURANOSYL]OXY}-3-HYDROXYCYCLOHEXYL 2,6- BIS{[AMINO(IMINIO)METHYL]AMINO}-2,6-DIDEOXY-BETA-L- GLUCOPYRANOSI

Code	Class Resolution	Description
2juk	nuc      NMR    	(1S,2R,3S,4R,6S)-4,6-BIS{[AMINO(IMINIO)METHYL]AMINO}-2- {[3-O-(2,6-BIS{[AMINO(IMINIO)METHYL]AMINO}-2,6- DIDEOXY-BETA-L-GLUCOPYRANOSYL)-BETA-D- ARABINOFURANOSYL]OXY}-3-HYDROXYCYCLOHEXYL 2,6- BIS{[AMINO(IMINIO)METHYL]AMINO}-2,6-DIDEOXY-BETA-L- GLUCOPYRANOSI C29 H64 N18 O13 6+	GUANIDINO NEOMYCIN B RECOGNITION OF AN HIV-1 RNA HELIX HIV-1 FRAMESHIFT SITE RNA RNA HIV-1, RNA-LIGAND INTERACTIONS, GUANIDINOGLYCOSIDES, NMR, RNA

G2L    3'-O-METHYOXYETHYL-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1xv6	nuc      NMR    	3'-O-METHYOXYETHYL-GUANOSINE-5'-MONOPHOSPHATE 4(C13 H20 N5 O9 P)	THE SOLUTION STRUCTURE OF 2',5'-LINKED 3'-O-(2- METHOXYETHYL)-RNA HAIRPIN 5'-R(*(C2L)P*(G2L)P*(C2L)P*(G2L)P*(A2L)P*(A2L) P*(U2L)P*(U2L)P*(C2L)P*(G2L)P*(C2L)P*(G2L))-2' RNA HAIRPIN, (2',5')-RNA, 3'-O-(2-METHOXYETHYL) RIBOSE

G2S    GUANOSINE-5'-DITHIOPHOSPHORATE

Code	Class Resolution	Description
1k8l	nuc      NMR    	GUANOSINE-5'-DITHIOPHOSPHORATE 2(C10 H14 N5 O5 P S2)	XBY6: AN ANALOG OF CK14 CONTAINING 6 DITHIOPHOSPHATE GROUPS FIRST STRAND OF CK14 DNA DUPLEX: DITHIOATED AT T10, C11, SECOND STRAND OF CK14 DNA DUPLEX: DITHIOATED AT G17, C22, C24, G27 DNA XBY6, CK14, CK1, PHOSPHORODITHIOATE, NF-KB, DNA

G31    3'-METHYL-2',3'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1d26	nuc      2.12	3'-METHYL-2',3'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O6 P	EFFECT OF A SINGLE 3'-METHYLENE PHOSPHONATE LINKAGE ON THE CONFORMATION OF AN A-DNA OCTAMER DOUBLE HELIX DNA (5'-D(*GP*CP*CP*CP*(G31)P*GP*GP*C)-3') DNA A-DNA, DOUBLE HELIX, MODIFIED

G36    O6-ETHYL-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
128d	nuc      2.50	O6-ETHYL-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C12 H18 N5 O7 P)	MOLECULAR STRUCTURE OF D(CGC[E6G]AATTCGCG) COMPLEXED WITH HOECHST 33258 DNA (5'-D(*CP*GP*CP*(G36) P*AP*AP*TP*TP*CP*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
130d	nuc      2.50	O6-ETHYL-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C12 H18 N5 O7 P)	MOLECULAR STRUCTURE OF D(CGC[E6G]AATTCGCG) COMPLEXED WITH HO 33342 DNA (5'-D(*CP*GP*CP*(G36)P*AP*AP*TP*TP*CP*GP*CP*G CHAIN: A, B DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED, DNA
144d	nuc      2.25	O6-ETHYL-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C12 H18 N5 O7 P)	MINOR GROOVE BINDING OF SN6999 TO AN ALKYLATED DNA: MOLECULAR STRUCTURE OF D(CGC[E6G]AATTCGCG)-SN6999 COMPLEX DNA (5'-D(*CP*GP*CP*(G36) P*AP*AP*TP*TP*CP*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
1d85	nuc      2.50	O6-ETHYL-2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE 2(C12 H18 N5 O7 P)	STRUCTURAL CONSEQUENCES OF A CARCINOGENIC ALKYLATION LESION ON DNA: EFFECT OF O6-ETHYL-GUANINE ON THE MOLECULAR STRUCTURE OF D(CGC[E6G]AATTCGCG)-NETROPSIN COMPLEX DNA (5'-D(*CP*GP*CP*(G36) P*AP*AP*TP*TP*CP*GP*CP*G)-3') DNA B-DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED

G38    3'-AMINO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
363d	nuc      2.00	3'-AMINO-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 18(C10 H15 N6 O6 P)	HIGH-RESOLUTION CRYSTAL STRUCTURE OF A FULLY MODIFIED N3'-> PHOSPHORAMIDATE DNA DODECAMER DUPLEX 5'-D(*(C42)P*(G38)P*(C42)P*(G38)P*(A43)P*(A43)P*( P*(NYM)P*(C42)P*(G38)P*(C42)P*DG)-3' DNA A-DNA, MODIFIED, DNA

G46    GUANOSINE-5'-MONOTHIOPHOSPHATE

Code	Class Resolution	Description
354d	nuc      1.50	GUANOSINE-5'-MONOTHIOPHOSPHATE C10 H14 N5 O7 P S	STRUCTURE OF LOOP E FROM E. COLI 5S RRNA RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*G)-3' CHAIN: A, RNA-DNA (5'-R(*GP*CP*GP*AP*GP*AP*GP*UP*AP*)-D(*DG R(*GP*C)-3') RNA U-RNA, DOUBLE HELIX, INTERNAL LOOP, OVERHANGING BASE, MISMAT

G47    N2-ETHANETHIOL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1cw9	nuc      1.55	N2-ETHANETHIOL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 4(C12 H18 N5 O7 P S)	DNA DECAMER WITH AN ENGINEERED CROSSLINK IN THE MINOR GROOVE 5'-D(*CP*CP*AP*GP*(G47)P*CP*CP*TP*GP*G)-3' DNA CROSSLINKED DOUBLE-HELICAL DNA, BASE-PAIR OPENING, PARTIAL B FLIPPING., DNA

G48    2'-O-METHYOXYETHYL-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
2m39	nuc      NMR    	2'-O-METHYOXYETHYL-GUANOSINE-5'-MONOPHOSPHATE 6(C13 H20 N5 O9 P)	THE SOLUTION STRUCTURE OF 3',5'-LINKED 2'-O-(2-METHOXYETHYL) DUPLEX RNA (5'-R(*(C5L)P*(G48)P*(C5L)P*(G48)P*(A44)P*(A4 P*(T39)P*(C5L)P*(G48)P*(C5L)P*DG)-3') RNA DUPLEX, (3',5')-RNA, 2'-O-(2-METHOXYETHYL) RIBOSE, RNA
468d	nuc      1.80	2'-O-METHYOXYETHYL-GUANOSINE-5'-MONOPHOSPHATE 8(C13 H20 N5 O9 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA
469d	nuc      1.70	2'-O-METHYOXYETHYL-GUANOSINE-5'-MONOPHOSPHATE 8(C13 H20 N5 O9 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RNA
470d	nuc      1.95	2'-O-METHYOXYETHYL-GUANOSINE-5'-MONOPHOSPHATE 8(C13 H20 N5 O9 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA
471d	nuc      2.70	2'-O-METHYOXYETHYL-GUANOSINE-5'-MONOPHOSPHATE 8(C13 H20 N5 O9 P)	CRYSTAL STRUCTURE AND IMPROVED ANTISENSE PROPERTIES OF 2'-O- METHOXYETHYL)-RNA RNA (5'-R(*(C43)P*(G48)P*(C43)P*(G48)P*(A44)P*(A4 P*(U36)P*(C43)P*(G48)P*(C43)P*(G48))-3') RNA 2'-O-(2-METHOXYETHYL) RIBOSE, RNA DODECAMER DUPLEX, RIBONUCL RNA

G49    N2-METHYL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1d33	nuc      1.50	N2-METHYL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	FORMALDEHYDE CROSS-LINKS DAUNORUBICIN AND DNA EFFICIENTLY: HPLC AND X-RAY DIFFRACTION STUDIES 5'-D(*CP*GP*CP*(G49)P*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
1qda	nuc      1.60	N2-METHYL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	CRYSTAL STRUCTURE OF EPIDOXORUBICIN-FORMALDEHYDE VIRTUAL CRO DNA 5' -D(CP*GP*CP*(G49)P*CP*GP)-3' DNA DOUBLE HELIX, DRUG-DNA COMPLEX, DNA
277d	nuc      1.80	N2-METHYL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	SUBSTITUTIONS AT C2' OF DAUNOSAMINE IN THE ANTICANCER DAUNORUBICIN ALTER ITS DNA-BINDING SEQUENCE SPECIFICITY 5'-D(*CP*GP*CP*(G49)P*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
278d	nuc      1.80	N2-METHYL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	SUBSTITUTIONS AT C2' OF DAUNOSAMINE IN THE ANTICANCER DAUNORUBICIN ALTER ITS DNA-BINDING SEQUENCE SPECIFICITY DNA (5'-D(*CP*GP*(G49)P*CP*CP*G)-3' DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIED
380d	nuc      2.00	N2-METHYL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE 2(C11 H16 N5 O7 P)	BINDING OF THE MODIFIED DAUNORUBICIN WP401 ADJACENT TO A T-G INDUCES THE REVERSE WATSON-CRICK CONFORMATION: CRYSTAL STRU THE WP401-TGGCCG AND WP401-CGG[BR5C]CG COMPLEXES DNA (5'-D(*CP*GP*(G49)P*(CBR)P*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, MODIFIED, DNA
381d	nuc      2.10	N2-METHYL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	BINDING OF THE MODIFIED DAUNORUBICIN WP401 ADJACENT TO A T-G INDUCES THE REVERSE WATSON-CRICK CONFORMATION: CRYSTAL STRU THE WP401-TGGCCG AND WP401-CGG[BR5C]CG COMPLEXES DNA (5'-D(*TP*GP*(G49)P*CP*CP*G)-3'), DNA (5'-D(*TP*GP*GP*CP*CP*G)-3') DNA RIGHT HANDED DNA, DOUBLE HELIX, COMPLEXED WITH DRUG, MODIFIE MISMATCHED, DNA
427d	nuc      1.10	N2-METHYL-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C11 H16 N5 O7 P	5'-D(*CP*GP*CP*(CH2-DM1)GP*CP*G)-3' DNA (5'-D(*CP*GP*CP*(G49)P*CP*G)-3') DNA DEOXYRIBONUCLEIC ACID, DRUG COMPLEX, FORMALDEHYDE CROSS- LINK, ATOMIC RESOLUTION, DOUBLE BACKBONE CONFORMATION, DNA

G6P    ALPHA-D-GLUCOSE-6-PHOSPHATE

Code	Class Resolution	Description
2h0z	nuc      2.70	ALPHA-D-GLUCOSE-6-PHOSPHATE C6 H13 O9 P	PRE-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME BOUND TO GLUCOSE-6-PHOSPHATE GLMS RIBOZYME RNA, GLMS RIBOZYME DEOXY RNA INHIBITOR RNA RNA, RIBOZYME, PSEUDOKNOT, HELIX
2ho7	nuc      2.90	ALPHA-D-GLUCOSE-6-PHOSPHATE C6 H13 O9 P	PRE-CLEAVAGE STATE OF THE THERMOANAEROBACTER TENGCONGENSIS GLMS RIBOZYME BOUND TO GLUCOSE-6-PHOSPHATE GLMS RIBOZYME RNA, GLMS RIBOZYME SUBSTRATE RNA RNA RNA; RIBOZYME; PSEUDOKNOT; HELIX
2z74	nuc      2.20	ALPHA-D-GLUCOSE-6-PHOSPHATE C6 H13 O9 P	T. TENGCONGENSIS GLMS RIBOZYME BOUND TO GLUCOSE-6-PHOSPHATE GLMS RIBOZYME RNA, GLMS RIBOZYME SUBSTRATE RNA DNA, RNA RIBOZYME, RIBOSWITCH, GLUCOSE-6-PHOSPHATE, GLUCOSAMINE-6- PHOSPHATE, DNA, RNA

GAI    GUANIDINE

Code	Class Resolution	Description
5ndh	nuc      1.81	GUANIDINE 4(C H5 N3)	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P2 RNA (5'-R(*GP*(CBV) P*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*GP*C)-3') RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMER, RNA
5ndi	nuc      2.57	GUANIDINE 4(C H5 N3)	THE STRUCTURE OF THE E.COLI GUANIDINE II RIBOSWITCH P1 STEM- RNA (5'- R(*UP*UP*UP*GP*CP*AP*GP*GP*AP*CP*GP*AP*CP*CP*UP*GP*(CBV)P*A 3') RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMER, RNA
5nef	nuc      1.91	GUANIDINE C H5 N3	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH GUANIDINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, RNA
5nom	nuc      1.93	GUANIDINE C H5 N3	THE STRUCTURE OF THE G. VIOLACEUS GUANIDINE II RIBOSWITCH P1 WITH GUANIDINE RNA (5'- R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP*AP*CP*CP*CP*CP*AP*(CBV)P*C CHAIN: A RNA GUANIDINE II RIBOSWITCH, STEM-LOOP, TETRA LOOP, DIMMER, RNA
5t83	nuc      2.71	GUANIDINE C H5 N3	STRUCTURE OF A GUANIDINE-I RIBOSWITCH FROM S. ACIDOPHILUS RNA (95-MER) RNA RIBOSWITCH, GUANIDINE, S-TURN, A-MINOR, RNA
5u3g	nuc      2.30	GUANIDINE C H5 N3	STRUCTURE OF THE DICKEYA DADANTII YKKC RIBOSWITCH BOUND TO G YKKC RIBOSWITCH RNA RIBOSWITCH, YKKC, GUANIDINE, GUANIDINIUM, RNA

GAO    GUANINE ARABINOSE-5'-PHOSPHATE

Code	Class Resolution	Description
1ho6	nuc      NMR    	GUANINE ARABINOSE-5'-PHOSPHATE C10 H14 N5 O8 P	CHIMERIC ARABINONUCLEIC ACID (ANA) HAIRPIN WITH ANA/RNA HYBRID STEM DNA/RNA (5'-R(*GP*GP*AP*C)-D(P*TP*TP*CP*G)- (P*(GAO)P*(UAR)P*(CAR)P*(CAR)-3') DNA, RNA ARABINONUCLEIC ACID, RNA, HAIRPIN, DNA
2kp3	nuc      NMR    	GUANINE ARABINOSE-5'-PHOSPHATE 3(C10 H14 N5 O8 P)	STRUCTURE OF ANA-RNA HYBRID DUPLEX RNA (5'-R(*CP*CP*AP*UP*UP*AP*UP*AP*GP*C)-3'), RNA (5'-R(*(GAO)P*(CAR)P*(UAR)P*(A5O)P*(UAR)P*(A5 P*(UAR)P*(GAO)P*(GAO))-3') RNA ANA, ARABINONUCLEIC ACID, NUCLEIC ACID STRUCTURE, NMR/MD/TI, DUPLEX, RNA

GCK    PHOSPHORIC ACID 9-(2-GUANIDINOETHOXY-3-(2-DEOXY-BETA- D-ERYTHROPENTOFURANOSYL))-3H-PYRIMIDO-[5,4-B][1,4]- BENZOOXAZIN-2-ONE]-5'-ESTER

Code	Class Resolution	Description
1kgk	nuc      1.00	PHOSPHORIC ACID 9-(2-GUANIDINOETHOXY-3-(2-DEOXY-BETA- D-ERYTHROPENTOFURANOSYL))-3H-PYRIMIDO-[5,4-B][1,4]- BENZOOXAZIN-2-ONE]-5'-ESTER 2(C18 H24 N6 O9 P 1+)	DIRECT OBSERVATION OF A CYTOSINE ANALOG THAT FORMS FIVE HYDROGEN BONDS TO GUANOSINE; GUANYL G-CLAMP 5'-D(*GP*(GCK)P*GP*TP*AP*TP*AP*CP*GP*C)-3' DNA A-FORM DOUBLE HELIX, CYTOSINE ANALOGUE, DNA

GDP    GUANOSINE-5'-DIPHOSPHATE

Code	Class Resolution	Description
1d4r	nuc      2.00	GUANOSINE-5'-DIPHOSPHATE 3(C10 H15 N5 O11 P2)	29-MER FRAGMENT OF HUMAN SRP RNA HELIX 6 29-MER OF MODIFIED SRP RNA HELIX 6: NON-NATIVE DUPLEX, 29-MER OF MODIFIED SRP RNA HELIX 6: NON-NATIVE DUPLEX RNA A-RNA HELIX, GGAG/GAGG BULGE, AC/CA TANDEM MISMATCH, GU WOBBLE BASE PAIRS, 2'3' -CYCLIC PHOSPHATE
1y27	nuc      2.40	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	G-RIBOSWITCH-GUANINE COMPLEX BACILLUS SUBTILIS XPT: SEQUENCE DATABASE RESIDUES 185-252 RNA G-RIBOSWITCH GUANINE RECOGNITION, RNA
3diy	nuc      2.71	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH LYSINE, MN2+ SOAK RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3owi	nuc      2.85	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF THE GLYCINE RIBOSWITCH BOUND TO GLYCINE DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oww	nuc      2.80	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF THE GLYCINE RIBOSWITCH BOUND TO GLYCINE DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3owz	nuc      2.95	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, SOAKED IN IRIDIUM DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION, GLYCINE RIBOSWITCH, RNA
3ox0	nuc      3.05	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, UNBOUND STATE DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxb	nuc      2.95	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH WITH SINGLE MUTATION DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxd	nuc      3.00	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH WITH TWO MUTATIONS DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxe	nuc      2.90	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, MN2+ SOAKED DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxj	nuc      3.20	GUANOSINE-5'-DIPHOSPHATE 2(C10 H15 N5 O11 P2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, SOAKED IN BA2+ DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxm	nuc      2.95	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, TL-ACETATE SOAKED DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3zd4	nuc      2.20	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	FULL-LENGTH HAMMERHEAD RIBOZYME WITH G12A SUBSTITUTION AT THE GENERAL BASE POSITION HAMMERHEAD RIBOZYME, ENZYME STRAND, HAMMERHEAD RIBOZYME, SUBSTRATE STRAND RNA RNA, GENERAL BASE CATALYSIS
3zd5	nuc      2.20	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	THE 2.2 A STRUCTURE OF A FULL-LENGTH CATALYTICALLY ACTIVE HAMMERHEAD RIBOZYME HAMMERHEAD RIBOZYME, ENZYME STRAND, HAMMERHEAD RIBOZYME, SUBSTRATE STRAND RNA CATALYTIC RNA, IN-LINE ATTACK, HAMMERHEAD RNA, STEM-LOOP INTERACTION, URIDINE TURN, A-FORM HELIX, RNA
3zp8	nuc      1.55	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	HIGH-RESOLUTION FULL-LENGTH HAMMERHEAD RIBOZYME HAMMERHEAD RIBOZYME, SUBSTRATE STRAND, HAMMERHEAD RIBOZYME, ENZYME STRAND RNA RNA, CATALYTIC RNA
4r4p	nuc      3.07	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF THE VS RIBOZYME-A756G MUTANT VS RIBOZYME RNA RNA NA, DIMER, RNA
4r4v	nuc      3.07	GUANOSINE-5'-DIPHOSPHATE C10 H15 N5 O11 P2	CRYSTAL STRUCTURE OF THE VS RIBOZYME - G638A MUTANT VS RIBOZYME RNA RNA NA, DIMER, RNA
4yb0	nuc      2.12	GUANOSINE-5'-DIPHOSPHATE 2(C10 H15 N5 O11 P2)	3',3'-CGAMP RIBOSWITCH BOUND WITH C-DI-GMP RNA (84-MER) RNA RIBOSWITCH, 3', 3'-CGAMP, SPINACH, RNA STRUCTURE, C-DI-GMP,

GE1    3,4-DIDEOXY-2,6-AMINO-ALPHA-D GALACTOPYRANOSE

Code	Class Resolution	Description
1byj	nuc      NMR    	3,4-DIDEOXY-2,6-AMINO-ALPHA-D GALACTOPYRANOSE C6 H14 N2 O2	GENTAMICIN C1A A-SITE COMPLEX RNA (16S RNA): DECODING REGION RNA COMPLEX (AMINOGLYCOSIDE/RIBOSOMAL RNA)

GE2    3,5-DIAMINO-CYCLOHEXANOL

Code	Class Resolution	Description
1byj	nuc      NMR    	3,5-DIAMINO-CYCLOHEXANOL C6 H14 N2 O	GENTAMICIN C1A A-SITE COMPLEX RNA (16S RNA): DECODING REGION RNA COMPLEX (AMINOGLYCOSIDE/RIBOSOMAL RNA)

GE3    5-METHYL-4-METHYLAMINO-TETRAHYDRO-PYRAN-2,3,5-TRIOL

Code	Class Resolution	Description
1byj	nuc      NMR    	5-METHYL-4-METHYLAMINO-TETRAHYDRO-PYRAN-2,3,5-TRIOL C7 H15 N O4	GENTAMICIN C1A A-SITE COMPLEX RNA (16S RNA): DECODING REGION RNA COMPLEX (AMINOGLYCOSIDE/RIBOSOMAL RNA)

GET    GENETICIN

Code	Class Resolution	Description
1mwl	nuc      2.40	GENETICIN 2(C20 H40 N4 O10)	CRYSTAL STRUCTURE OF GENETICIN BOUND TO THE EUBACTERIAL 16S SITE 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*G *UP*CP*GP*C)-3' RNA AMINOGLYCOSIDE ANTIBIOTIC, GENETICIN-A-SITE COMPLEX, 16S RIB RNA, BULGED ADENINES, UOU PAIRS, RNA
3td1	nuc      2.10	GENETICIN 2(C20 H40 N4 O10)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408G-MUTANT AND THE PRO CYTOPLASMIC RIBOSOMAL DECODING SITE IN COMPLEX WITH GENETIC RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP*(5BU) P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') RNA/ANTIBIOTIC DECODING, RIBOSOME, RNA-ANTIBIOTIC COMPLEX
4k32	nuc      2.50	GENETICIN 2(C20 H40 N4 O10)	CRYSTAL STRUCTURE OF GENETICIN BOUND TO THE LEISHMANIAL RRNA RNA (5'- R(*UP*UP*GP*CP*GP*UP*CP*GP*UP*UP*CP*CP*GP*GP*AP*AP*AP*AP*GP C)-3') RNA/ANTIBIOTIC RRNA DUPLEX, RIBOSOMAL A-SITE, AMINOGLYCOSIDE, LEISHMANIAL R RNA, RNA-ANTIBIOTIC COMPLEX
4p3s	nuc      2.30	GENETICIN 3(C20 H40 N4 O10)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408C-MUTANT RIBOSOMAL D SITE IN COMPLEX WITH GENETICIN 5'-R(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU) P*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3' RNA/ANTIBIOTIC RIBOSOME, ANTIBIOTIC-RESISTANCE, AMINOGLYCOSIDE, DECODING, R ANTIBIOTIC COMPLEX
4wcq	nuc      2.10	GENETICIN 2(C20 H40 N4 O10)	CRYSTAL STRUCTURE OF THE BACTERIAL A1408ME1A-MUTANT RIBOSOMA SITE IN COMPLEX WITH GENETICIN RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*(1MA) P*CP*GP*UP*CP*GP*AP*CP*GP*AP*AP*GP*UP*CP*GP*C)-3') RNA RIBOSOME, RNA, AMINOGLYCOSIDE, ANTIBIOTIC-RESISTANCE

GF0    2'-DEOXY-2'-FLUOROGUANOSINE

Code	Class Resolution	Description
5mcr	nuc      NMR    	2'-DEOXY-2'-FLUOROGUANOSINE C10 H12 F N5 O4	QUADRUPLEX WITH FLIPPED TETRAD FORMED BY AN ARTIFICIAL SEQUE ARTIFICIAL QUADRUPLEX WITH PROPELLER, DIAGONAL AN LOOP DNA G-QUADRUPLEX, DNA

GF2    2'-DEOXY-2'-FLUOROGUANOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
2kwg	nuc      NMR    	2'-DEOXY-2'-FLUOROGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 4(C10 H13 F N5 O7 P)	SOLUTION STRUCTURE OF A FULLY MODIFIED 2'-F/2'-OME SIRNA CON 5'-R(P*(A2M)P*(UFT)P*(OMG)P*(AF2)P*(A2M)P*(GF2)P* P*(AF2)P*(OMU)P*(GF2)P*(OMU)P*(AF2)P*(OMU)P*(UFT)P*(OMU)P*( P*(OMC)P*(CFZ)P*(OMC)P*(UFT)P*(OMU))-3', 5'-R(*(GF2)P*(OMG)P*(GF2)P*(OMU)P*(AF2)P*(A2M)P*( P*(OMU)P*(AF2)P*(OMC)P*(AF2)P*(OMU)P*(UFT)P*(OMC)P*(UFT)P*( P*(CFZ)P*(A2M)P*(UFT)P*(OMU)P*(UFT))-3' RNA SIRNA, 2'-FLUORO, 2'-O-METHYL, RNA
2m84	nuc      NMR    	2'-DEOXY-2'-FLUOROGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 4(C10 H13 F N5 O7 P)	STRUCTURE OF 2'F-RNA/2'F-ANA CHIMERIC DUPLEX 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA 2'F-RNA/2'F-ANA CHIMERIC DUPLEX, A-FORM, 12-MER, DICKERSON D DODECAMER, MODIFIED NUCLEOTIDES, DNA, RNA
2m8a	nuc      NMR    	2'-DEOXY-2'-FLUOROGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 8(C10 H13 F N5 O7 P)	2'F-ANA/2'F-RNA ALTERNATED SEQUENCES 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA A-FORM, 12-MER, DICKERSON DREW DODECAMER, MODIFIED NUCLEOTID RNA
3p4a	nuc      1.20	2'-DEOXY-2'-FLUOROGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 12(C10 H13 F N5 O7 P)	2'FLUORO MODIFIED RNA OCTAMER FA2U2 2'FLUORO MODIFIED RNA 8-MER RNA RNA, 2'-FLUORO-RNA, O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYGUANOSINE, 2'-FLUORO 2'- DEOXYADENOSINE, 2'-FLUORO 2'-DEOXYURIDINE, SIRNA
3p4d	nuc      1.85	2'-DEOXY-2'-FLUOROGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 4(C10 H13 F N5 O7 P)	ALTERNATINGLY MODIFIED 2'FLUORO RNA OCTAMER F/RC4G4 5'-R(*(CFZ)P*CP*(CFZ)P*CP*(GF2)P*GP*(GF2)P*G)-3' RNA RNA, 2'-FLUORO-RNA, O2'-MODIFICATION, OCTAMER, 2'-FLUORO 2'- DEOXYCYTIDINE, 2'-FLUORO 2'-DEOXYGUANOSINE, SIRNA
5mbr	nuc      NMR    	2'-DEOXY-2'-FLUOROGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 3(C10 H13 F N5 O7 P)	QUADRUPLEX WITH FLIPPED TETRAD FORMED BY A HUMAN TELOMERIC S G-QUADRUPLEX FORMED BY A HUMAN TELOMERIC SEQUENCE WITH 2'-FLUORO-2'-DEOXYRIBOGUANOSINE DNA G-QUADRUPLEX, DNA, HUMAN TELOMERE
5mcr	nuc      NMR    	2'-DEOXY-2'-FLUOROGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H13 F N5 O7 P)	QUADRUPLEX WITH FLIPPED TETRAD FORMED BY AN ARTIFICIAL SEQUE ARTIFICIAL QUADRUPLEX WITH PROPELLER, DIAGONAL AN LOOP DNA G-QUADRUPLEX, DNA

GFL    2-AMINO-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE

Code	Class Resolution	Description
1fc8	nuc      NMR    	2-AMINO-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE C10 H13 F N5 O7 P	NMR SOLUTION STRUCTURE OF A CHIMERIC OLIGONUCLEOTIDE HAIRPIN R(GGAC)D(TTCG)2'F-A(GTCC) 5'-R(*GP*GP*AP*CP)D(*TP*TP*CP*GP*(GFL)P*(TAF) P*(CFL)P*(CFL))-3' RNA/DNA CHIMERA 2'F-ARABINONUCLEIC ACID, RNA, DNA, HYBRID DUPLEX, HAIRPIN, RNA/DNA CHIMERA COMPLEX
2kp4	nuc      NMR    	2-AMINO-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE 3(C10 H13 F N5 O7 P)	STRUCTURE OF 2'F-ANA/RNA HYBRID DUPLEX DNA (5'-D(*(GFL)P*(CFL)P*(TAF)P*(A5L)P*(TAF)P*(A5 P*(TAF)P*(GFL)P*(GFL))-3'), RNA (5'-R(*CP*CP*AP*UP*UP*AP*UP*AP*GP*C)-3') DNA/RNA 2-DEOXY-2-FLUORO-D-ARABINOSE, FANA, NUCLEIC ACID STRUCTURE, NMR/MD/TI, HYBRID DUPLEX, DNA-RNA COMPLEX
2lsc	nuc      NMR    	2-AMINO-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE 8(C10 H13 F N5 O7 P)	SOLUTION STRUCTURE OF 2'F-ANA AND ANA SELF-COMPLEMENTARY DUP DNA (5'-D(*(CFL)P*(GFL)P*(CFL)P*(GFL)P*(A5O)P*(A5 P*(UAR)P*(CFL)P*(GFL)P*(CFL)P*(GFL))-3') DNA DNA, DICKERSON DREW DODECAMER
2m1g	nuc      NMR    	2-AMINO-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE 2(C10 H13 F N5 O7 P)	PARALLEL HUMAN TELOMERIC QUADRUPLEX CONTAINING 2'F-ANA SUBST 5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*(GFL)P*GP*GP*T)-3' DNA PARALLEL G-QUADRUPLEX, HUMAN TELOMERIC SEQUENCE, FLUORO-ARAB MOLECULAR INTERACTIONS, DNA
2m84	nuc      NMR    	2-AMINO-9-(2-DEOXY-2-FLUORO-5-O-PHOSPHONO-BETA-D- ARABINOFURANOSYL)-1,9-DIHYDRO-6H-PURIN-6-ONE 4(C10 H13 F N5 O7 P)	STRUCTURE OF 2'F-RNA/2'F-ANA CHIMERIC DUPLEX 2'F-RNA/2'F-ANA CHIMERIC DUPLEX DNA, RNA 2'F-RNA/2'F-ANA CHIMERIC DUPLEX, A-FORM, 12-MER, DICKERSON D DODECAMER, MODIFIED NUCLEOTIDES, DNA, RNA

GGT    TRIOXACARCIN A

Code	Class Resolution	Description
3c2j	nuc      1.78	TRIOXACARCIN A 2(C42 H52 O20)	CRYSTAL STRUCTURE ANALYSIS OF TRIOXACARCIN A COVALENTLY BOUN D(AACCGGTT) DNA (5'-D(*DAP*DAP*DCP*DCP*DGP*DGP*DTP*DT)-3') DNA DNA-DRUG COMPLEX, BASE FLIPPING, B-DNA, DNA

GIQ    3-METHYL-3H-IMIDAZO[4,5-F]QUINOLIN-2-AMINE

Code	Class Resolution	Description
2hkc	nuc      NMR    	3-METHYL-3H-IMIDAZO[4,5-F]QUINOLIN-2-AMINE C11 H10 N4	NMR STRUCTURE OF THE IQ-MODIFIED DODECAMER CTCGGC[IQ]GCCATC 5'-D(*GP*AP*TP*GP*GP*CP*GP*CP*CP*GP*AP*G)-3', 5'-D(*CP*TP*CP*GP*GP*CP*GP*CP*CP*AP*TP*C)-3' DNA NMR STRUCTURE, NAR1IQ3, RMD CALCULATIONS, ANNEAL, NOESY, COSY, REFINEMENT, IQ, ADDUCT, HCA, DNA
2z2g	nuc      NMR    	3-METHYL-3H-IMIDAZO[4,5-F]QUINOLIN-2-AMINE C11 H10 N4	NMR STRUCTURE OF THE IQ-MODIFIED DODECAMER CTC[IQ]GGCGCCATC DNA (5'- D(*DCP*DTP*DCP*DGP*DGP*DCP*DGP*DCP*DCP*DAP*DTP*DC)-3'), DNA (5'- D(*DGP*DAP*DTP*DGP*DGP*DCP*DGP*DCP*DCP*DGP*DAP*DG)-3') DNA NMR STRUCTURE, NAR1IQ1, RMD CALCULATIONS, NOESY, COSY, REFINEMENT, IQ, ADDUCT, DNA
2z2h	nuc      NMR    	3-METHYL-3H-IMIDAZO[4,5-F]QUINOLIN-2-AMINE C11 H10 N4	NMR STRUCTURE OF THE IQ-MODIFIED DODECAMER CTCG[IQ]GCGCCATC DNA (5'- D(*DGP*DAP*DTP*DGP*DGP*DCP*DGP*DCP*DCP*DGP*DAP*DG)-3'), DNA (5'- D(*DCP*DTP*DCP*DGP*DGP*DCP*DGP*DCP*DCP*DAP*DTP*DC)-3') DNA NMR, NAR1IQ2, RMD, NOESY, COSY, IQ, DNA

GLP    GLUCOSAMINE 6-PHOSPHATE

Code	Class Resolution	Description
2z75	nuc      1.70	GLUCOSAMINE 6-PHOSPHATE C6 H14 N O8 P	T. TENGCONGENSIS GLMS RIBOZYME BOUND TO GLUCOSAMINE-6- PHOSPHATE GLMS RIBOZYME SUBSTRATE RNA, GLMS RIBOZYME RNA DNA, RNA RIBOZYME, RIBOSWITCH, GLUCOSE-6-PHOSPHATE, GLUCOSAMINE-6- PHOSPHATE, DNA, RNA
3b4a	nuc      2.70	GLUCOSAMINE 6-PHOSPHATE C6 H14 N O8 P	T. TENGCONGENSIS GLMS RIBOZYME WITH G40A MUTATION, BOUND TO GLUCOSAMINE-6-PHOSPHATE GLMS RIBOZYME SUBSTRATE RNA, GLMS RIBOZYME RNA RNA RIBOZYME, RIBOSWITCH, GLUCOSAMINE-6-PHOSPHATE, RNA
3b4b	nuc      2.70	GLUCOSAMINE 6-PHOSPHATE C6 H14 N O8 P	T. TENGCONGENSIS GLMS RIBOZYME WITH G40A MUTATION, BOUND TO GLUCOSAMINE-6-PHOSPHATE AND A SUBSTRATE RNA WITH A 2'5'- PHOSPHODIESTER LINKAGE GLMS RIBOZYME SUBSTRATE WITH 2'5'-PHOSPHODIESTER LINKAGE, GLMS RIBOZYME RNA RNA RIBOZYME, RIBOSWITCH, GLUCOSAMINE-6-PHOSPHATE, RNA
3b4c	nuc      3.00	GLUCOSAMINE 6-PHOSPHATE C6 H14 N O8 P	T. TENGCONGENSIS GLMS RIBOZYME BOUND TO GLUCOSAMINE-6- PHOSPHATE AND A SUBSTRATE RNA WITH A 2'5'-PHOSPHODIESTER LINKAGE GLMS RIBOZYME SUBSTRATE WITH A 2'5'- PHOSPHODIESTER LINKAGE, GLMS RIBOZYME RNA RNA RIBOZYME, RIBOSWITCH, GLUCOSAMINE-6-PHOSPHATE, RNA

GLY    GLYCINE

Code	Class Resolution	Description
3owi	nuc      2.85	GLYCINE 2(C2 H5 N O2)	CRYSTAL STRUCTURE OF THE GLYCINE RIBOSWITCH BOUND TO GLYCINE DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oww	nuc      2.80	GLYCINE 2(C2 H5 N O2)	CRYSTAL STRUCTURE OF THE GLYCINE RIBOSWITCH BOUND TO GLYCINE DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3owz	nuc      2.95	GLYCINE 2(C2 H5 N O2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, SOAKED IN IRIDIUM DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION, GLYCINE RIBOSWITCH, RNA
3oxe	nuc      2.90	GLYCINE 2(C2 H5 N O2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, MN2+ SOAKED DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxj	nuc      3.20	GLYCINE 2(C2 H5 N O2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, SOAKED IN BA2+ DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
3oxm	nuc      2.95	GLYCINE 2(C2 H5 N O2)	CRYSTAL STRUCTURE OF GLYCINE RIBOSWITCH, TL-ACETATE SOAKED DOMAIN II OF GLYCINE RIBOSWITCH, DOMAIN II OF GLYCINE RIBOSWITCH RNA GENE EXPRESSION REGULATOR, GLYCINE RIBOSWITCH, RNA
4erl	nuc      3.00	GLYCINE C2 H5 N O2	CRYSTAL STRUCTURE OF THE LYSINE RIBOSWITCH BOUND TO A LYSINE DIPEPTIDE LYSINE RIBOSWITCH RNA: LYSINE RIBOSWITCH APTAMER DOMAIN TRANSCRIPTION RIBOSWITCH APTAMER DOMAIN, REGULATORY MRNA, TRANSCRIPTION

GMP    GUANOSINE

Code	Class Resolution	Description
2gbh	nuc      NMR    	GUANOSINE C10 H13 N5 O5	NMR STRUCTURE OF STEM REGION OF HELIX-35 OF 23S E.COLI RIBOSOMAL RNA (RESIDUES 736-760) 5'-R(*(GMP)P*GP*GP*CP*UP*AP*AP*UP*GP*(PSU) P*UP*GP*AP*AP*AP*AP*AP*UP*UP*AP*GP*CP*CP*C)-3' RNA NMR, RDC, RCSA, RNA
3skz	nuc      2.60	GUANOSINE 2(C10 H13 N5 O5)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND GUANOSINE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
4a4r	nuc      NMR    	GUANOSINE C10 H13 N5 O5	UNAC TETRALOOPS: TO WHAT EXTENT CAN THEY MIMIC GNRA TETRALOO 5'-R(*GMP*GP*AP*CP*CP*CP*GP*GP*CP*UP*AP*AP*CP*GP *CP*UP*GP*GP*GP*UP*CP*C)-3' RNA RNA, EVOLUTION, UMAC TETRALOOP

GMS    2'-DEOXYGUANOSINE-5'-MONOSELENOPHOSPHATE

Code	Class Resolution	Description
1vro	nuc      1.10	2'-DEOXYGUANOSINE-5'-MONOSELENOPHOSPHATE 2(C10 H14 N5 O6 P SE)	SELENIUM-ASSISTED NUCLEIC ACID CRYSTALLOGRAPHY: USE OF PHOSPHOROSELENOATES FOR MAD PHASING OF A DNA STRUCTURE 5'-D(*CP*(GMS)P*CP*GP*CP*G)-3' DNA LEFT-HANDED Z-DNA, PHOSPHOROSELENOATE, MULTIWAVELENGTH ANOMALOUS DISPERSION (MAD), COVALENT MODIFICATION OF OLIGONUCLEOTIDES, OLIGONUCLEOTIDE ANALOGUE, PHASING STRATEGY, SYNCHROTRON

GMU    2'-O-[(2-GUANIDINIUM)ETHYL]-5-METHYLURIDINE 5'- MONOPHOSPHATE

Code	Class Resolution	Description
1r3g	nuc      1.16	2'-O-[(2-GUANIDINIUM)ETHYL]-5-METHYLURIDINE 5'- MONOPHOSPHATE 2(C13 H24 N5 O9 P)	1.16A X-RAY STRUCTURE OF THE SYNTHETIC DNA FRAGMENT WITH THE INCORPORATED 2'-O-[(2-GUANIDINIUM)ETHYL]-5-METHYLURIDINE RESIDUES 5'-D(*GP*CP*GP*TP*AP*(GMU)P*AP*CP*GP*C)-3') DNA DNA

GN7    N7-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1gn7	nuc      NMR    	N7-2'-DEOXY-GUANOSINE-5'-MONOPHOSPHATE C10 H14 N5 O7 P	NMR STRUCTURE OF AN INTRAMOLECULAR DNA TRIPLEX CONTAINING AN N7-GLYCOSYLATED GUANINE, 8 STRUCTURES DNA (5'-D (*AP*GP*AP*GP*AP*GP*AP*AP*CP*CP*CP*CP*TP*TP*CP*TP*CP*TP* CP*TP*TP*AP*TP*AP*TP*CP*TP*GN7*TP*CP*TP*T)-3') DNA DEOXYRIBONUCLEIC ACID, TRIPLEX, N7-GUANINE, DNA

GND    2-AMINO-5-GUANIDINO-PENTANOIC ACID

Code	Class Resolution	Description
1nbk	nuc      NMR    	2-AMINO-5-GUANIDINO-PENTANOIC ACID 2(C6 H15 N4 O2 1+)	THE STRUCTURE OF RNA APTAMER FOR HIV TAT COMPLEXED WITH TWO ARGININAMIDE MOLECULES RNA APTAMER RNA RNA-LIGANDS COMPLEX, BASE TRIPLE, RNA APTAMER, HIV TAT

GNE    1,N2-ETHENOGUANINE

Code	Class Resolution	Description
2k1y	nuc      NMR    	1,N2-ETHENOGUANINE C12 H14 N5 O7 P	SOLUTION STRUCTURE OF DUPLEX DNA CONTAINING THE MUTAGENIC LESION: 1,N2-ETHENO-2'-DEOXYGUANINE 5'- D(*DGP*DCP*DAP*DTP*DGP*DCP*DGP*DTP*DAP*DCP*DG)-3', 5'-D(*DCP*DGP*DTP*DAP*DCP*(GNE) P*DCP*DAP*DTP*DGP*DC)-3' DNA DAMAGED DNA STRUCTURE, EXOCYCLIC DNA LESIONS, EXTRAHELICAL BASE, BER RECOGNITION
2ktp	nuc      NMR    	1,N2-ETHENOGUANINE C12 H14 N5 O7 P	STRUCTURE OF THE 1,N2-ETHENODEOXYGUANOSINE LESION OPPOSITE A DELETION IN DUPLEX DNA DNA (5'-D(*GP*GP*AP*TP*TP*CP*AP*TP*GP*CP*G)-3'), DNA (5'-D(*CP*GP*CP*AP*TP*(GNE)P*GP*AP*AP*TP*CP*C CHAIN: A DNA ETHENOGUANINE, ONE-BASE DELETION, DNA

GNG    2'-DEOXY-GUANOSINE

Code	Class Resolution	Description
3ds7	nuc      1.85	2'-DEOXY-GUANOSINE 2(C10 H13 N5 O4)	STRUCTURE OF AN RNA-2'-DEOXYGUANOSINE COMPLEX 67-MER RNA RNA, RNA-LIGAND COMPLEX, RIBOSWITCH
3ski	nuc      2.30	2'-DEOXY-GUANOSINE 2(C10 H13 N5 O4)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE RNA (68-MER), RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skl	nuc      2.90	2'-DEOXY-GUANOSINE 2(C10 H13 N5 O4)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, IRIDIUM HEXAMMINE SOAK RNA (66-MER) RNA THREE WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skr	nuc      3.10	2'-DEOXY-GUANOSINE 2(C10 H13 N5 O4)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, COBALT HEXAMMINE SOAK RNA (66-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skt	nuc      3.10	2'-DEOXY-GUANOSINE 2(C10 H13 N5 O4)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, MANGANESE SOAK RNA (66-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY-GUANOSINE, RNA
3skw	nuc      2.95	2'-DEOXY-GUANOSINE 2(C10 H13 N5 O4)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, CESIUM SOAK RNA (66-MER) RNA THREE-WAY RNA JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA

GOL    GLYCEROL

Code	Class Resolution	Description
2w89	nuc      2.00	GLYCEROL C3 H8 O3	CRYSTAL STRUCTURE OF THE E.COLI TRNAARG AMINOACYL STEM ISSOACCEPTOR RR-1660 AT 2.0 ANGSTROEM RESOLUTION 5'-R(*GP*CP*AP*UP*CP*CP*GP)-3': AMINOACYL STEM, RESIDUES 901-907, 5'-R(*CP*GP*GP*AP*UP*GP*CP)-3': AMINOACYL STEM, RESIDUES 966-972 RNA TRNA ACCEPTOR STEM, RNA, TRNAARG, HYDRATION, TRNA IDENTITY
3dvz	nuc      1.00	GLYCEROL C3 H8 O3	CRYSTAL STRUCTURE OF THE SARCIN/RICIN DOMAIN FROM E. COLI 23 SARCIN/RICIN DOMAIN FROM E. COLI 23 S RRNA RNA RNA, SARCIN RICIN LOOP
3dw4	nuc      0.97	GLYCEROL C3 H8 O3	CRYSTAL STRUCTURE OF THE SARCIN/RICIN DOMAIN FROM E. COLI 23 U2650-OCH3 MODIFIED SARCIN/RICIN DOMAIN FROM E. COLI 23 S RRNA RNA RNA, SARCIN RICIN LOOP
3dw6	nuc      1.00	GLYCEROL C3 H8 O3	CRYSTAL STRUCTURE OF THE SARCIN/RICIN DOMAIN FROM E. COLI 23 U2650-SECH3 MODIFIED SARCIN/RICIN DOMAIN FROM E. COLI 23 S RRNA RNA RNA, SARCIN RICIN LOOP
3glp	nuc      1.23	GLYCEROL C3 H8 O3	1.23 A RESOLUTION X-RAY STRUCTURE OF (GCUGCUGC)2 5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3' RNA STRETCHED U-U WOBBLE, RNA, MYOTONIC DYSTROPHY, CUG REPEATS
3r1e	nuc      0.97	GLYCEROL C3 H8 O3	CRYSTAL STRUCTURE OF GC(8BRG)GCGGC DUPLEX RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3') RNA CGG REPEATS, FRAGILE X MENTAL RETARDATION, 8-BROMOGUANOSINE,
3rg5	nuc      2.00	GLYCEROL 2(C3 H8 O3)	CRYSTAL STRUCTURE OF MOUSE TRNA(SEC) TRNA(SEC) RNA METAL BINDING BY RNA, RNA HYDRATION, STRUCTURAL FLEXIBILITY, TRNA FOLD, TRANSLATION, SERRS, SECS, PSTK, RNA
4l0a	nuc      1.70	GLYCEROL 3(C3 H8 O3)	X-RAY STRUCTURE OF AN ALL LNA QUADRUPLEX DNA/RNA (5'-R(*(TLN)P*(LCG)P*(LCG)P*(LCG)P*(TLN)) CHAIN: A, B, C, D, E, F, G, H DNA, RNA PARALLEL G-QUADRUPLEX, LOCKED NUCLEIC ACID (LNA), DNA, RNA
4nxh	nuc      1.16	GLYCEROL C3 H8 O3	2'-TRIFLUOROMETHYLTHIOURIDINE-MODIFIED E. COLI 23S RRNA SARC LOOP 23S RIBOSOMAL RNA SARCIN RICIN LOOP RNA HAIRPIN, STRUCTURAL, RNA
4rum	nuc      2.64	GLYCEROL C3 H8 O3	CRYSTAL STRUCTURE OF THE NICO TRANSITION-METAL RIBOSWITCH BO COBALT NICO RIBOSWITCH RNA RNA RNA HELIX, LIGAND SENSOR, COBALT AND NICKEL BINDING, RNA, RI
5d99	nuc      0.97	GLYCEROL C3 H8 O3	3DW4 REDETERMINED BY DIRECT METHODS STARTING FROM RANDOM PHA RNA (27-MER) HAIRPIN FROM SARCIN-RICIN DOMAIN OF 23S RRNA RNA AB INITIO DIRECT METHODS STRUCTURE DETERMINATION, HAIRPIN RN

GPN    2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-GUANINE

Code	Class Resolution	Description
176d	nuc      NMR    	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-GUANINE C11 H16 N7 O4 1+	NMR SOLUTION STRUCTURE OF A PEPTIDE NUCLEIC ACID COMPLEXED W DNA (5'-D(*GPN*APN*APN*CPN*TPN*CPN)-3'), RNA (5'-R(P*GP*AP*GP*UP*UP*C)-3') PEPTIDE NUCLEIC ACID/RNA RNA, PNA, DOUBLE HELIX, PEPTIDE NUCLEIC ACID-RNA COMPLEX
1nr8	nuc      1.66	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-GUANINE 2(C11 H16 N7 O4 1+)	THE CRYSTAL STRUCTURE OF A D-LYSINE-BASED CHIRAL PNA-DNA DUP 5'-D(P*AP*GP*TP*GP*AP*TP*CP*TP*AP*C)-3', H-((GPN)*(TPN)*(APN)*(GPN)*(A66)*(T66)*(C66)*(APN *(TPN))-NH2 DNA/PEPTIDE NUCLEIC ACID CHIRAL PEPTIDE NUCLEIC ACID, DOUBLE STRANDED HELIX, P-FORM, PEPTIDE NUCLEIC ACID COMPLEX
1pdt	nuc      NMR    	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-GUANINE 2(C11 H16 N7 O4 1+)	PD235, PNA-DNA DUPLEX, NMR, 8 STRUCTURES DNA (5'-D(*GP*AP*CP*AP*TP*AP*GP*C)-3', PEPTIDE NUCLEIC ACID (COOH-P(*G*C*T*A*T*G*T*C)-NH CHAIN: B PEPTIDE NUCLEIC ACID/DNA COMPLEX (PEPTIDE NUCLEIC ACID-DNA), NUCLEIC ACID COMPLEX, DU HYBRID, PEPTIDE NUCLEIC ACID-DNA COMPLEX
5eme	nuc      1.15	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-GUANINE 3(C11 H16 N7 O4 1+)	COMPLEX OF RNA R(GCAGCAGC) WITH ANTISENSE PNA P(CTGCTGC) ANTISENSE PNA STRAND, RNA (5'-R(*GP*CP*AP*GP*CP*AP*GP*C)-3') RNA CAG REPEATS, RNA/PNA, PNA ANTISENSE OLIGOMER, POLY-Q DIESEAS
5emf	nuc      1.14	2-AMINOETHYLGLYCINE-CARBONYLMETHYLENE-GUANINE 3(C11 H16 N7 O4 1+)	CRYSTAL STRUCTURE OF RNA R(GCUGCUGC) WITH ANTISENSE PNA P(GC RNA (5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'), ANTISENSE PNA P(GCAGCAGC) RNA CUG REPEATS, RNA/PNA DUPLEX, ANTISENSE PNA, MYOTONIC DYSTROP 1, RNA

GRB    8-BROMOGUANOSINE 5'-(DIHYDROGEN PHOSPHATE)

Code	Class Resolution	Description
3r1d	nuc      1.45	8-BROMOGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 5(C10 H13 BR N5 O8 P)	CRYSTAL STRUCTURE OF GC(8BRG)GCGGCGGC DUPLEX RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*GP*GP*C)-3 CHAIN: A, B, C, D, E RNA CGG REPEATS, FRAGILE X MENTAL RETARDATION, 8-BROMOGUANOSINE,
3r1e	nuc      0.97	8-BROMOGUANOSINE 5'-(DIHYDROGEN PHOSPHATE) 2(C10 H13 BR N5 O8 P)	CRYSTAL STRUCTURE OF GC(8BRG)GCGGC DUPLEX RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3') RNA CGG REPEATS, FRAGILE X MENTAL RETARDATION, 8-BROMOGUANOSINE,

GS    GUANOSINE-5'-THIO-MONOPHOSPHATE

Code	Class Resolution	Description
5j3f	nuc      NMR    	GUANOSINE-5'-THIO-MONOPHOSPHATE 2(C10 H14 N5 O6 P S)	NMR SOLUTION STRUCTURE OF [RP, RP]-PT DSDNA DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3'), DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3') DNA DNA, [RP, RP]-PT DSDNA
5j3i	nuc      NMR    	GUANOSINE-5'-THIO-MONOPHOSPHATE 2(C10 H14 N5 O6 P S)	NMR SOLUTION STRUCTURE OF [SP, SP]-PT DSDNA DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3') DNA DNA, [SP, SP]-PT DSDNA
8psh	nuc      NMR    	GUANOSINE-5'-THIO-MONOPHOSPHATE 3(C10 H14 N5 O6 P S)	HIGH RESOLUTION NMR STRUCTURE OF THE STEREOREGULAR (ALL-RP)- PHOSPHOROTHIOATE-DNA/RNA HYBRID D (G*PS*C*PS*G*PS*T*PS*C*PS*A*PS*G*PS*G)R(CCUGACGC), MINIMIZED AVERAGE STRUCTURE RNA (5'-R(*CP*CP*UP*GP*AP*CP*GP*C)-3'), DNA (5'-D(*DGP*(SC)P*(GS)P*(PST)P*(SC)P*(AS) P*(GS)P*(GS))-3') DNA-RNA HYBRID OLIGONUCLEOTIDE, DNA-RNA HYBRID, PHOSPHOROTHIOATE, THIONUCLEOTIDE, ANTISENSE

GSR    2'-DEOXY-N2-(R)STYRENE OXIDE GUANOSINE MONOPHOSPHATE

Code	Class Resolution	Description
1af1	nuc      NMR    	2'-DEOXY-N2-(R)STYRENE OXIDE GUANOSINE MONOPHOSPHATE C18 H22 N5 O8 P	THE SOLUTION NMR STRUCTURE OF AN R-STYRENE OXIDE ADDUCT AT THE N2 POSITION OF GUANINE OF AN 11 BASE-PAIR OLIGONUCLEOTIDE SEQUENCE CODING FOR AMINO ACIDS 11-13 OF THE PRODUCT OF THE N-RAS PROTOONCOGENE, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*GP*GP*CP*AP*GP*GSRP*TP*GP*GP*TP*G)- 3'), DNA (5'-D(*CP*AP*CP*CP*AP*CP*CP*TP*GP*CP*C)-3') DNA DNA DUPLEX, HUMAN N-RAS GENE, CODON 12 SEQUENCE, R-STYRENE OXIDE, MINOR GROOVE ADDUCT, DEOXYRIBONUCLEIC ACID

GSS    2'-DEOXY-N2-(S)STYRENE OXIDE GUANOSINE MONOPHOSPHATE

Code	Class Resolution	Description
1ap1	nuc      NMR    	2'-DEOXY-N2-(S)STYRENE OXIDE GUANOSINE MONOPHOSPHATE C18 H22 N5 O8 P	THE SOLUTION NMR STRUCTURE OF AN S-STYRENE OXIDE ADDUCT AT THE N2 POSITION OF GUANINE OF AN 11 BASE-PAIR OLIGONUCLEOTIDE SEQUENCE CODING FOR AMINO ACIDS 11-13 OF THE PRODUCT OF THE N-RAS PROTOONCOGENE, MINIMIZED AVERAGE STRUCTURE DNA (5'-D(*GP*GP*CP*AP*GSSP*GP*TP*GP*GP*TP*G)- 3'), DNA (5'-D(*CP*AP*CP*CP*AP*CP*CP*TP*GP*CP*C)-3') DNA DNA DUPLEX, HUMAN N-RAS GENE, CODON 12 SEQUENCE, S-STYRENE OXIDE, MINOR GROOVE ADDUCT, DEOXYRIBONUCLEIC ACID

GTP    GUANOSINE-5'-TRIPHOSPHATE

Code	Class Resolution	Description
1l2x	nuc      1.25	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	ATOMIC RESOLUTION CRYSTAL STRUCTURE OF A VIRAL RNA PSEUDOKNOT RNA PSEUDOKNOT RNA PSEUDOKNOT, FRAMESHIFTING, ATOMIC RESOLUTION, VIRAL RNA, METAL IONS, FLEXIBILITY
1l3d	nuc      2.85	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	LOW RESOLUTION CRYSTAL STRUCTURE OF A VIRAL RNA PSEUDOKNOT RNA PSEUDOKNOT RNA PSEUDOKNOT, FRAMESHIFTING, VIRAL RNA, FLEXIBILITY
1xjr	nuc      2.70	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	THE STRUCTURE OF A RIGOROUSLY CONSERVED RNA ELEMENT WITHIN THE SARS VIRUS GENOME S2M RNA RNA RNA, GNRA, 530-LIKE LOOP, S2M, STEM-LOOP, PURINE BULGE, SARS
2au4	nuc      NMR    	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CLASS I GTP APTAMER CLASS I RNA APTAMER TO GTP RNA RNA, APTAMER
2gdi	nuc      2.05	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THIAMINE PYROPHOSPHATE-SPECIFIC RIBOSWI COMPLEX WITH THIAMINE PYROPHOSPHATE TPP RIBOSWITCH: SENSING DOMAIN RNA RIBOSWITCH, THIAMINE PYROPHOSPHATE, RNA
2m58	nuc      NMR    	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	STRUCTURE OF 2'-5' AG1 LARIAT FORMING RIBOZYME IN ITS INACTI RNA (59-MER) RNA RNA, LARIAT, 2'-5' BRANCHING
2oeu	nuc      2.00	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	FULL-LENGTH HAMMERHEAD RIBOZYME WITH MN(II) BOUND HAMMERHEAD RIBOZYME, 5'-R(*GP*GP*CP*GP*UP*(OMC)P*CP*UP*GP*GP*(5BU) P*AP*UP*CP*CP*AP*AP*UP*CP*(DC))-3' RNA RIBOZYME, HAMMERHEAD RNA, STEM-LOOP INTERACTION, URIDINE TURN, A-FORM HELIX, MANGANESE, MN
2qus	nuc      2.40	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	HAMMERHEAD RIBOZYME G12A MUTANT PRE-CLEAVAGE HAMMERHEAD RIBOZYME RNA HAMMERHEAD RNA, HAMMERHEAD RIBOZYME, CATALYTIC RNA, SATELLIT RNA, RIBOZYME, RNA
2quw	nuc      2.20	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	HAMMERHEAD RIBOZYME G12A MUTANT AFTER CLEAVAGE HAMMERHEAD RIBOZYME, CLEAVED FRAGMENT, HAMMERHEAD RIBOZYME, CLEAVED FRAGMENT RNA HAMMERHEAD RIBOZYME, RIBOZYME, CATALYTIC RNA, RIBOZYME-PRODU COMPLEX, RNA
2yie	nuc      2.94	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF A F. NUCLEATUM FMN RIBOSWITCH BOUND TO FMN RIBOSWITCHFMN RIBOSWITCH: APTAMER DOMAIN, RESIDUES 2495-2544APTAMER DOMAIN, RESIDUES 2550-2601 RNA RNA
2yif	nuc      3.30	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF A F. NUCLEATUM FMN RIBOSWITCH - FREE STATE FMN RIBOSWITCH: APTAMER DOMAIN, RESIDUES 2495-2544, FMN RIBOSWITCH: APTAMER DOMAIN, RESIDUES 2550-2601 RNA RNA, TRANSLATION
3dir	nuc      2.90	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTALLIZATION OF THE THERMOTOGA MARITIMA LYSINE RIBOSWITCH N6-1-IMINOETHYL-L-LYSINE RNA (174-MER) RNA RIBOSWITCH, LYSINE, RNA
3e5c	nuc      2.25	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE SMK BOX (SAM-III) RIBOSWITCH WITH SAM SMK BOX (SAM-III) RIBOSWITCH RNA SAM RIBOSWITCH SMK SAM-III TRANSLATION REGULATION SD, RNA
3e5e	nuc      2.90	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURES OF THE SMK BOX (SAM-III) RIBOSWITCH WITH SAH SMK BOX (SAM-III) RIBOSWITCH FOR RNA RNA SMK SAM RIBOSWITCH SHINE-DELGARNO TRANSLATION REGULATION, RNA
3e5f	nuc      2.70	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURES OF THE SMK BOX (SAM-III) RIBOSWITCH WITH SE-SAM SMK BOX (SAM-III) RIBOSWITCH FOR RNA RNA SMK SAM RIBOSWITCH SHINE-DELGARNO TRANSLATION REGULATION, RNA
3f2q	nuc      2.95	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN FMN RIBOSWITCH RNA FMN RIBOSWITCH, TRANSCRIPTION, RNA
3f2t	nuc      3.00	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, IRIDIU SOAK. FMN RIBOSWITCH RNA FMN RIBOSWITCH, TRANSCRIPTION, RNA
3f2w	nuc      3.45	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, BA2+ S FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, BARIUM, RNA
3f2x	nuc      3.11	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, CS+ SO FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, CESIUM, RNA
3f2y	nuc      3.20	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, MN2+ S FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, MANGANESE, RNA
3f30	nuc      3.15	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE FMN RIBOSWITCH BOUND TO FMN, COBALT SOAK. FMN RIBOSWITCH RNA FMN, RIBOSWITCH, TRANSCRIPTION, COBALT HEXAMINE, RNA
3p22	nuc      2.50	GUANOSINE-5'-TRIPHOSPHATE 4(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE ENE, A VIRAL RNA STABILITY ELEMENT, COMPLEX WITH A9 RNA OLIGO(A)9 RNA, CORE ENE HAIRPIN FROM KSHV PAN RNA: HAIRPIN FROM KSHV PAN RNA RNA MAJOR GROOVE TRIPLE HELIX, VIRAL NON-CODING RNA, STABILITY E NUCLEUS, RNA
3q3z	nuc      2.51	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	STRUCTURE OF A C-DI-GMP-II RIBOSWITCH FROM C. ACETOBUTYLICUM C-DI-GMP C-DI-GMP-II RIBOSWITCH RNA RIBOSWITCH, C-DI-GMP, RNA
3ski	nuc      2.30	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE RNA (68-MER), RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skl	nuc      2.90	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, IRIDIUM HEXAMMINE SOAK RNA (66-MER) RNA THREE WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skr	nuc      3.10	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, COBALT HEXAMMINE SOAK RNA (66-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, DEOXYGUANOSINE, RNA
3skt	nuc      3.10	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, MANGANESE SOAK RNA (66-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY-GUANOSINE, RNA
3skw	nuc      2.95	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE, CESIUM SOAK RNA (66-MER) RNA THREE-WAY RNA JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
3skz	nuc      2.60	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND GUANOSINE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
3slm	nuc      2.70	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND DEOXYGUANOSINE-5'-MONOPHOSPHATE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
3slq	nuc      2.50	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE 2'- DEOXYGUANOSINE RIBOSWITCH BOUND GUANOSINE-5'-MONOPHOSPHATE RNA (68-MER) RNA THREE-WAY JUNCTION, RIBOSWITCH, 2'-DEOXY GUANOSINE, RNA
437d	nuc      1.60	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF AN RNA PSEUDOKNOT FROM BEET WESTERN YEL INVOLVED IN RIBOSOMAL FRAMESHIFTING RNA PSEUDOKNOT RNA PSEUDOKNOT, RNA, TRIPLEX, VIRAL FRAMESHIFTING
4ena	nuc      2.85	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF FLUORIDE RIBOSWITCH, SOAKED IN CS+ FLUORIDE RIBOSWITCH RNA PSEUDOKNOT, RNA
4enb	nuc      2.30	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF FLUORIDE RIBOSWITCH, BOUND TO IRIDIUM FLUORIDE RIBOSWITCH RNA PSEUDOKNOT, RNA
4gxy	nuc      3.05	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	RNA STRUCTURE ADENOSYLCOBALAMIN RIBOSWITCH RNA RNA, RIBOSWITCH, ADENOSYLCOBALAMIN
4jf2	nuc      2.28	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	STRUCTURE OF A CLASS II PREQ1 RIBOSWITCH REVEALS LIGAND RECO A NEW FOLD PREQ1-II RIBOSWITCH RNA RIBOSWITCH, H-TYPE PSEUDOKNOT, RNA
4jrc	nuc      2.67	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	DISTAL STEM I REGION FROM G. KAUSTOPHILUS GLYQS T BOX RNA DISTAL STEM I REGION OF THE GLYQS T BOX LEADER RN CHAIN: A, B RNA T BOX RNA, REGULATORY RNA LEADER SEQUENCE, TRNA BINDING, RNA
4mgn	nuc      3.20	GUANOSINE-5'-TRIPHOSPHATE 4(C10 H16 N5 O14 P3)	CO-CRYSTAL STRUCTURE OF THE G. KAUSTOPHILUS GLYQS T BOX RIBO STEM I IN COMPLEX WITH TRNA TRNA-GLYCINE, GLYQS T BOX RIBOSWITCH RNA RNA-RNA COMPLEX, BASE STACKING, T-LOOP, RNA BINDING, RNA
4nya	nuc      2.65	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE E. COLI THIM RIBOSWITCH IN COMPLEX (AZIDOMETHYL)-2-METHYLPYRIMIDIN-4-AMINE THIM TPP RIBOSWITCH RNA FRAGMENT-BASED DRUG DISCOVERY, RIBOSWITCH, RNA
4plx	nuc      3.10	GUANOSINE-5'-TRIPHOSPHATE 3(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE TRIPLE-HELICAL STABILITY ELEMENT AT END OF MALAT1 CORE ENE HAIRPIN AND A-RICH TRACT FROM MALAT1 RNA TRIPLE HELIX, RNA STABILITY ELEMENT, MALAT1, LONG NONCODING
4qjd	nuc      3.10	GUANOSINE-5'-TRIPHOSPHATE 4(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF TWISTER WITH THE NUCLEOTIDE 5'- TO THE SITE DISORDERED AT 3.1 A RESOLUTION TWISTER RNA SEQUENCE, TWISTER RNA SEQUENCE RNA SELF-CLEAVING RIBOZYME, 2' DEOXY SUBSITUTION, NUCLEOTIDE 5 (
4qjh	nuc      3.88	GUANOSINE-5'-TRIPHOSPHATE 3(C10 H16 N5 O14 P3)	CRYSTAL STRUCTURE OF THE TWISTER RIBOZYME WITH THE NUCLEOTID THE CLEAVAGE SITE ORDERED AT 4.1 A RESOLUTION TWISTER RIBOZYME, TWISTER RIBOZYME RNA SMALL SELF-CLEAVING RIBOZYME, RNA
4qk8	nuc      3.05	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	THERMOANAEROBACTER PSEUDETHANOLICUS C-DI-AMP RIBOSWITCH C-DI-AMP RIBOSWITCH RNA C-DI-AMP RIBOSWITCH, RNA
4qka	nuc      3.20	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	C-DI-AMP RIBOSWITCH FROM THERMOANAEROBACTER PSEUDETHANOLICUS HEXAMINE SOAK C-DI-AMP RIBOSWITCH RNA C-DI-AMP RIBOSWITCH, RNA
4rum	nuc      2.64	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF THE NICO TRANSITION-METAL RIBOSWITCH BO COBALT NICO RIBOSWITCH RNA RNA RNA HELIX, LIGAND SENSOR, COBALT AND NICKEL BINDING, RNA, RI
4rzd	nuc      2.75	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	CRYSTAL STRUCTURE OF A PREQ1 RIBOSWITCH PREQ1-III RIBOSWITCH (CLASS 3) RNA THREE-WAY HELICAL JUNCTION, HL(OUT)-TYPE PSEUDOKNOT, TRANSLA REGULATION, RNA
4wfl	nuc      2.49	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	STRUCTURE OF THE COMPLETE BACTERIAL SRP ALU DOMAIN RNA: RESIDUES 3-81,RESIDUES 3-81 RNA NON-CODING, RNA, SRP RNA, ELONGATION ARREST
4wfm	nuc      3.10	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	STRUCTURE OF THE COMPLETE BACTERIAL SRP ALU DOMAIN BACILLUS SUBTILIS SMALL CYTOPLASMIC RNA (SCRNA),R CHAIN: A, B RNA NON-CODING, RNA, SRP RNA, ELONGATION ARREST
4y1i	nuc      2.85	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	LACTOCOCCUS LACTIS YYBP-YKOY MN RIBOSWITCH BOUND TO MN2+ LACTOCOCCUS LACTIS YYBP-YKOY RIBOSWITCH RNA RIBOSWITCH, MANGANESE-BINDING, RNA
4y1j	nuc      2.24	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	LACTOCOCCUS LACTIS YYBP-YKOY MN RIBOSWITCH A41U BINDING SITE PRESENCE OF MN2+ YYBP-YKOY RIBOSWITCH RNA RIBOSWITCH, MANGANESE-BINDING, MUTANT, RNA
4y1m	nuc      3.00	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	AN ESCHERICHIA COLI YYBP-YKOY MN RIBOSWITCH IN THE MN2+-FREE E. COLI YYBP-YKOY RIBOSWITCH RNA RIBOSWITCH, MANGANESE, FREE STATE, RNA
4yaz	nuc      2.00	GUANOSINE-5'-TRIPHOSPHATE 2(C10 H16 N5 O14 P3)	3',3'-CGAMP RIBOSWITCH BOUND WITH 3',3'-CGAMP RNA (84-MER) RNA RIBOSWITCH, 3', 3'-CGAMP, SPINACH, RNA STRUCTURE, C-DI-GMP,
5d5l	nuc      2.50	GUANOSINE-5'-TRIPHOSPHATE 4(C10 H16 N5 O14 P3)	PREQ1-II RIBOSWITCH WITH AN ENGINEERED G-U WOBBLE PAIR BOUND PREQ1-II RIBOSWITCH RNA GU WOBBLE, PSEUDOKNOT, SHINE-DALGARNO SEQUENCE, RNA
5fjc	nuc      1.71	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	SAM-I RIBOSWITCH BEARING THE H. MARISMORTUI KT-7 VARIANT C- SAM-I RIBOSWITCH: SAM BINDING DOMAIN RNA RNA, KINK TURN, RNA MOTIF, SAM-I RIBOSWITCH
5lwj	nuc      NMR    	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	SOLUTION NMR STRUCTURE OF THE GTP BINDING CLASS II RNA APTAM COMPLEX CONTAINING A PROTONATED ADENINE NUCLEOTIDE WITH A H SHIFTED PKA. GTP CLASS II RNA (34-MER) RNA RNA STRUCTURE, APTAMER, PROTONATED ADENINE, GTP, RNA
5u3g	nuc      2.30	GUANOSINE-5'-TRIPHOSPHATE C10 H16 N5 O14 P3	STRUCTURE OF THE DICKEYA DADANTII YKKC RIBOSWITCH BOUND TO G YKKC RIBOSWITCH RNA RIBOSWITCH, YKKC, GUANIDINE, GUANIDINIUM, RNA

H2U    5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE

Code	Class Resolution	Description
1ehz	nuc      1.93	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 2(C9 H15 N2 O9 P)	THE CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRNA AT 1.93 A TRANSFER RNA (PHE) RNA TRNA, YEAST, PHENYLALANINE, RNA
1evv	nuc      2.00	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 2(C9 H15 N2 O9 P)	CRYSTAL STRUCTURE OF YEAST PHENYLALANINE TRANSFER RNA AT 2.0 RESOLUTION PHENYLALANINE TRANSFER RNA RNA TRANSFER RNA, PHENYLALANINE, PHE-TRNA, YEAST, AMINO-ACID TRA RNA
1fcw	nuc      17.00	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 10(C9 H15 N2 O9 P)	TRNA POSITIONS DURING THE ELONGATION CYCLE TRNAPHE RIBOSOME RIBOSOME, TRNA BINDING SITES, PROTEIN SYNTHESIS, ELONGATION
1fir	nuc      3.30	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 3(C9 H15 N2 O9 P)	CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA(LYS3) RNA MAMMALIAN TRANSFERT RIBONUCLEIC ACID, HIV-1 PRIMER TRNA, AMI TRANSPORT, CANONICAL TRNA STRUCTURE, CANONICAL ANTICODON, FRAMESHIFTING, CODON/ANTICODON MIMICRY, MODIFIED BASES, RNA
1ipl	nuc      model  	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 4(C9 H15 N2 O9 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, TRNAS BOUND TO A AND P SITES, 5'- R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*U P*UP*UP*UP*U)-3' RIBONUCLEIC ACID TRANSLOCATION, LARGE RIBOSOMAL RNA, SMALL RIBOSOMAL RNA, TRNA, MRNA
1ipx	nuc      model  	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 2(C9 H15 N2 O9 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRANSFER RNA BOUND TO P SITE, TRANSFER RNA BOUND TO R SITE RIBONUCLEIC ACID TRNA-TRNA INTERACTION
1ipz	nuc      model  	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 2(C9 H15 N2 O9 P)	RIBOSOMAL RNAS AND PROTEINS AS WELL AS FACTORS TRANSFER RNA BOUND TO P SITE, TRANSFER RNA BOUND TO R SITE RIBONUCLEIC ACID NONCOGNATE TRNA-TRNA INTERACTION
1k7n	nuc      model  	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 4(C9 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 2) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7o	nuc      model  	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 4(C9 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 3) P-SITE TRNA, A-SITE TRNA, MRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7p	nuc      model  	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 4(C9 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 4) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1k7r	nuc      model  	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 4(C9 H15 N2 O9 P)	THE INTERACTION BETWEEN MRNA AND TRNA (MODEL 1) MRNA, P-SITE TRNA, A-SITE TRNA RIBONUCLEIC ACID INTERACTION, MRNA, TRNA
1ks1	nuc      model  	5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE 2(C9 H15 N2 O9 P)	A MODEL FOR A FIVE-PRIME STACKED TRNA PHENYLALANINE TRANSFER RNA RIBONUCLEIC ACID FIVE-PRIME STACK, TRNA
1nrt	nuc