4ZC7 - JenaLib

Asymmetric Unit

Asym. Unit - sites

Biological Unit 1

Biol. Unit 1 - sites

Biological Unit 2

collapse

expand

Asymmetric Unit (Jmol Viewer)

Asym. Unit - sites (Jmol Viewer)

Biological Unit 1 (Jmol Viewer)

Biol. Unit 1 - sites (Jmol Viewer)

Biological Unit 2 (Jmol Viewer)

Description

Title :   PAROMOMYCIN BOUND TO A LEISHMANIAL RIBOSOMAL A-SITE

Authors :   M. Shalev, H. Rozenberg, C. L. Jaffe, N. Adir, T. Baasov

Date :   15 Apr 15 (Deposition) - 26 Aug 15 (Release) - 07 Oct 15 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   3.04

Chains :   Asym. Unit : A,B,C,D
Biol. Unit 1: A,B  (1x)
Biol. Unit 2: C,D  (1x)

Keywords :   A-Site, Ribosome, Paromomycin, Leishmania, Rna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   M. Shalev, H. Rozenberg, B. Smolkin, A. Nasereddin, D. Kopelyanskiy, V. Belakhov, T. Schrepfer, J. Schacht, C. L. Jaffe, N. Adir, T. Baasov
Structural Basis For Selective Targeting Of Leishmanial Ribosomes: Aminoglycoside Derivatives As Promising Therapeutics.
Nucleic Acids Res. V. 43 8601 2015
PubMed-ID: 26264664 | Reference-DOI: 10.1093/NAR/GKV821

Compounds

Molecule 1 - RNA DUPLEX
	Chains	:	A, B, C, D
	Engineered	:	YES
	Organism Scientific	:	SYNTHETIC CONSTRUCT
	Organism Taxid	:	32630
	Synthetic	:	YES

Structural Features

Chains, Units

		1	2	3	4
Asymmetric Unit	:	A	B	C	D
Biological Unit 1 (1x)	:	A	B
Biological Unit 2 (1x)	:			C	D

Summary Information (see also Sequences/Alignments below)

Ligands, Modified Residues, Ions (1, 2)

Asymmetric Unit (1, 2)

No.	Name	Count	Type	Full Name
1	PAR	2	Ligand/Ion	PAROMOMYCIN

Biological Unit 1 (1, 1)

No.	Name	Count	Type	Full Name
1	PAR	1	Ligand/Ion	PAROMOMYCIN

Biological Unit 2 (1, 1)

No.	Name	Count	Type	Full Name
1	PAR	1	Ligand/Ion	PAROMOMYCIN

Sites (2, 2)

Asymmetric Unit (2, 2)

No.	Name	Evidence	Residues	Description
1	AC1	SOFTWARE	A A:16 , A A:17 , A A:18 , G A:19 , U A:20 , G B:28 , U B:29 , C B:30 , G B:31	binding site for residue PAR A 101
2	AC2	SOFTWARE	A C:16 , A C:17 , A C:18 , G C:19 , U C:20 , G D:28 , U D:29 , G D:31	binding site for residue PAR C 101

SS Bonds (0, 0)

(no "SS Bond" information available for 4ZC7)

Cis Peptide Bonds (0, 0)

(no "Cis Peptide Bond" information available for 4ZC7)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

(no "SAP(SNP)/Variant" information available for 4ZC7)

PROSITE Motifs (0, 0)

(no "PROSITE Motif" information available for 4ZC7)

Exons (0, 0)

(no "Exon" information available for 4ZC7)

Sequences/Alignments

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:21
                                                    
                  4zc7 A  3 GCGUCGUUCCGGAAAAGUCGC 23
                                    12        22

Chain B from PDB  Type:RNA  Length:20
                                                   
                  4zc7 B 26 GCGUCGUUCCGGAAAGUCGC 46
                                    35    ||  46
                                         40|    
                                          42

Chain C from PDB  Type:RNA  Length:21
                                                    
                  4zc7 C  3 GCGUCGUUCCGGAAAAGUCGC 23
                                    12        22

Chain D from PDB  Type:RNA  Length:20
                                                   
                  4zc7 D 26 GCGUCGUUCCGGAAAGUCGC 46
                                    35    ||  46
                                         40|    
                                          42

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (0, 0)

(no "SCOP Domain" information available for 4ZC7)

CATH Domains (0, 0)

(no "CATH Domain" information available for 4ZC7)

Pfam Domains (0, 0)

(no "Pfam Domain" information available for 4ZC7)

Gene Ontology (0, 0)

Asymmetric Unit(hide GO term definitions)

(no "Gene Ontology" information available for 4ZC7)

Visualization

Interactive Views

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		PAR	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4zc7)

Biological Units
	Complete Structure
		Biological Unit 1	[ Jena3D ]
		Biological Unit 2	[ Jena3D ]

Still Images

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym. Unit PNG format \| Asym. Unit - sites PNG format \| Biol. Unit 1 PNG format \| Biol. Unit 1 - sites PNG format \| Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	4zc7
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Analysis Tools

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT