Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  THE CRYSTAL STRUCTURE OF OME SUBSTITUTED TWISTER RIBOZYME
 
Authors :  A. Ren, D. J. Patel, R. Micura, K. R. Rajashankar
Date :  19 Sep 15  (Deposition) - 28 Oct 15  (Release) - 27 Jan 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.64
Chains :  Asym./Biol. Unit :  A
Keywords :  Ome, Twister, Rna, Ribozyme (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  M. Kosutic, S. Neuner, A. Ren, S. Flur, C. Wunderlich, E. Mairhofer, N. Vusurovic, J. Seikowski, K. Breuker, C. Hobartner, D. J. Patel, C. Kreutz, R. Micura
A Mini-Twister Variant And Impact Of Residues/Cations On Th Phosphodiester Cleavage Of This Ribozyme Class.
Angew. Chem. Int. Ed. Engl. V. 54 15128 2015
PubMed-ID: 26473980  |  Reference-DOI: 10.1002/ANIE.201506601

(-) Compounds

Molecule 1 - RNA (54-MER)
    Chains: A
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1
Asymmetric/Biological Unit : A

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 10)

Asymmetric/Biological Unit (3, 10)
No.NameCountTypeFull Name
1K1Ligand/IonPOTASSIUM ION
2MG8Ligand/IonMAGNESIUM ION
3OMU1Mod. NucleotideO2'-METHYLURIDINE 5'-MONOPHOSPHATE

(-) Sites  (9, 9)

Asymmetric Unit (9, 9)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREA A:6 , A A:7 , U A:8 , HOH A:206 , HOH A:210 , HOH A:218binding site for residue MG A 101
2AC2SOFTWAREA A:42 , A A:43 , HOH A:203 , HOH A:204 , HOH A:207 , HOH A:214binding site for residue MG A 102
3AC3SOFTWAREU A:30 , A A:35 , HOH A:212binding site for residue MG A 103
4AC4SOFTWAREG A:27 , HOH A:202 , HOH A:209 , HOH A:215 , HOH A:217 , HOH A:220binding site for residue MG A 104
5AC5SOFTWAREG A:51 , G A:52 , HOH A:211 , HOH A:216 , HOH A:219binding site for residue MG A 105
6AC6SOFTWAREU A:30 , C A:31 , C A:32 , HOH A:208binding site for residue MG A 106
7AC7SOFTWAREA A:7 , U A:8binding site for residue MG A 107
8AC8SOFTWAREU A:41 , A A:55binding site for residue MG A 108
9AC9SOFTWAREU A:24binding site for residue K A 109

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5DUN)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5DUN)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5DUN)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5DUN)

(-) Exons   (0, 0)

(no "Exon" information available for 5DUN)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:RNA  Length:54
                                                                                     
                  5dun A  1 UUUUxAAUGAAGCCACAGGCUGUGAGGGUCCUAAGCCCCUAAUUCAGAAGGGAA 55
                                |   10        21        31        41        51    
                                |            19|                                  
                                5-OMU         21
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5DUN)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5DUN)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5DUN)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 5DUN)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    OMU  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5dun)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5dun
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 5DUN)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5DUN)