Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE BACTERIAL RIBOSOMAL DECODING SITE IN COMPLEX WITH 4'-DEOXY-4'-FLUORO NEAMINE ANALOG (EQUATORIAL 4'-F)
 
Authors :  J. Kondo, S. Hanessian, H. Kanazawa
Date :  09 Jun 15  (Deposition) - 22 Jun 16  (Release) - 22 Jun 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.10
Chains :  Asym. Unit :  A,B,C,D
Biol. Unit 1:  A,B  (1x)
Biol. Unit 2:  C,D  (1x)
Keywords :  Rna, Antibiotic, Rna-Antibiotic Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  J. Kondo, S. Hanessian, H. Kanazawa
Crystal Structure Of The Bacterial Ribosomal Decoding Site In Complex With 4'-Deoxy-4'-Fluoro Neamine Analog (Equatorial 4'-F)
To Be Published
PubMed: search

(-) Compounds

Molecule 1 - RNA (5'- D(P*UP*UP*GP*CP*GP*UP*CP*AP*CP*GP*CP*CP*GP*GP*CP*GP*AP*AP*GP*UP*CP*GP *C)-3')
    Chains: A, B, C, D
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric Unit : ABCD
Biological Unit 1 (1x): AB  
Biological Unit 2 (1x):   CD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 1)

Asymmetric Unit (1, 1)
No.NameCountTypeFull Name
1S811Ligand/Ion(1R,2R,3S,4R,6S)-4,6-DIAMINO-2,3-DIHYDROXYCYCLOHEXYL 2,6-DIAMINO-2,4,6-TRIDEOXY-4-FLUORO-ALPHA-D-GLUCOPYRANOSIDE
Biological Unit 1 (1, 1)
No.NameCountTypeFull Name
1S811Ligand/Ion(1R,2R,3S,4R,6S)-4,6-DIAMINO-2,3-DIHYDROXYCYCLOHEXYL 2,6-DIAMINO-2,4,6-TRIDEOXY-4-FLUORO-ALPHA-D-GLUCOPYRANOSIDE
Biological Unit 2 (0, 0)
No.NameCountTypeFull Name
1S81-1Ligand/Ion(1R,2R,3S,4R,6S)-4,6-DIAMINO-2,3-DIHYDROXYCYCLOHEXYL 2,6-DIAMINO-2,4,6-TRIDEOXY-4-FLUORO-ALPHA-D-GLUCOPYRANOSIDE

(-) Sites  (1, 1)

Asymmetric Unit (1, 1)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREG A:5 , U A:6 , C A:7 , A A:8 , C A:9 , G B:39 , A B:40 , A B:41 , G B:42 , U B:43 , C B:44 , HOH B:402 , U D:71binding site for residue S81 B 301

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5BXK)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5BXK)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5BXK)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5BXK)

(-) Exons   (0, 0)

(no "Exon" information available for 5BXK)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:RNA  Length:22
                                                     
                  5bxk A  2 UGCGUCACGCCGGCGAAGUCGC 23
                                    11        21  


Chain B from PDB  Type:RNA  Length:22
                                                     
                  5bxk B 25 UGCGUCACGCCGGCGAAGUCGC 46
                                    34        44  


Chain C from PDB  Type:RNA  Length:23
                                                      
                  5bxk C 47 UUGCGUCACGCCGGCGAAGUCGC 69
                                    56        66   


Chain D from PDB  Type:RNA  Length:23
                                                      
                  5bxk D 70 UUGCGUCACGCCGGCGAAGUCGC 92
                                    79        89
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5BXK)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5BXK)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5BXK)

(-) Gene Ontology  (0, 0)

Asymmetric Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 5BXK)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    S81  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5bxk)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5bxk
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 5BXK)

(-) Related Entries Specified in the PDB File

5bws