5DWX - JenaLib

Title :   STRUCTURAL INSIGHTS INTO THE QUADRUPLEX-DUPLEX 3' INTERFACE FORMED FROM A TELOMERIC REPEAT - TLOOP

Authors :   G. N. Parkinson, I. Russo Krauss

Date :   23 Sep 15 (Deposition) - 20 Jan 16 (Release) - 10 Feb 16 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   2.71

Chains :   Asym./Biol. Unit : A,B

Keywords :   Telomere, Quadruplex, Junction, Duplex, Dna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   I. Russo Krauss, S. Ramaswamy, S. Neidle, S. Haider, G. N. Parkinson
Structural Insights Into The Quadruplex-Duplex 3' Interface Formed From A Telomeric Repeat: A Potential Molecular Target.
J. Am. Chem. Soc. V. 138 1226 2016
PubMed-ID: 26730610 | Reference-DOI: 10.1021/JACS.5B10492

Compounds

Molecule 1 - DNA (24-MER)
	Chains	:	A
	Engineered	:	YES
	Organism Scientific	:	SYNTHETIC CONSTRUCT
	Organism Taxid	:	32630
	Synthetic	:	YES

Molecule 2 - DNA COMPLEMENTARY STRAND
	Chains	:	B
	Engineered	:	YES
	Organism Scientific	:	SYNTHETIC CONSTRUCT
	Organism Taxid	:	32630
	Synthetic	:	YES

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (1, 3)

Sites (3, 3)

Asymmetric Unit (3, 3)

No.	Name	Evidence	Residues	Description
1	AC1	SOFTWARE	DG A:2 , DG A:3 , DG A:6 , DG A:7 , DG A:10 , DG A:11 , DG A:14 , DG A:15 , K A:102	binding site for residue K A 101
2	AC2	SOFTWARE	DG A:1 , DG A:2 , DG A:5 , DG A:6 , DG A:9 , DG A:10 , DG A:13 , DG A:14 , K A:101 , K A:103	binding site for residue K A 102
3	AC3	SOFTWARE	DG A:1 , DG A:5 , DG A:9 , DG A:13 , K A:102	binding site for residue K A 103

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Asymmetric/Biological Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:DNA  Length:20
                                                   
                  5dwx A  1 GGGTGGGTGGGTGGGTTAGC 20
                                    10        20

Chain B from PDB  Type:DNA  Length:4
                                   
                  5dwx B  5 GCTA  8

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (0, 0)

Visualization

Interactive Views

Asymmetric/Biological Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		K	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]
		AC3	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5dwx)

Still Images

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym./Biol. Unit PNG format \| Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	5dwx
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Analysis Tools

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT

Description