5DWW - JenaLib

Title :   STRUCTURAL INSIGHTS INTO THE QUADRUPLEX-DUPLEX 3' INTERFACE FORMED FROM A TELOMERIC REPEAT - TTLOOP

Authors :   I. Russo Krauss, G. N. Parkinson

Date :   23 Sep 15 (Deposition) - 20 Jan 16 (Release) - 10 Feb 16 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   2.79

Chains :   Asym. Unit : A,B,C,D,E,F,G,H
Biol. Unit 1: A,B  (1x)
Biol. Unit 2: C,D  (1x)
Biol. Unit 3: E,F  (1x)
Biol. Unit 4: G,H  (1x)
Biol. Unit 5: E,F  (1x)

Keywords :   Telomere, Quadruplex, Junction, Duplex, Dna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   I. Russo Krauss, S. Ramaswamy, S. Neidle, S. Haider, G. N. Parkinson
Structural Insights Into The Quadruplex-Duplex 3' Interface Formed From A Telomeric Repeat: A Potential Molecular Target.
J. Am. Chem. Soc. V. 138 1226 2016
PubMed-ID: 26730610 | Reference-DOI: 10.1021/JACS.5B10492

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (1, 10)

Asymmetric Unit (1, 10)

No.	Name	Count	Type	Full Name
1	K	10	Ligand/Ion	POTASSIUM ION

Biological Unit 1 (0, 0)

No.	Name	Count	Type	Full Name
1	K	-1	Ligand/Ion	POTASSIUM ION

Biological Unit 2 (0, 0)

No.	Name	Count	Type	Full Name
1	K	-1	Ligand/Ion	POTASSIUM ION

Biological Unit 3 (0, 0)

No.	Name	Count	Type	Full Name
1	K	-1	Ligand/Ion	POTASSIUM ION

Biological Unit 4 (0, 0)

No.	Name	Count	Type	Full Name
1	K	-1	Ligand/Ion	POTASSIUM ION

Biological Unit 5 (0, 0)

No.	Name	Count	Type	Full Name
1	K	-1	Ligand/Ion	POTASSIUM ION

Sites (10, 10)

Asymmetric Unit (10, 10)

No.	Name	Evidence	Residues	Description
01	AC1	SOFTWARE	DG A:1 , DG A:5 , DG A:9 , DG A:14 , K A:103 , DG C:1 , DG C:5 , DG C:9 , DG C:14 , K C:102	binding site for residue K A 101
02	AC2	SOFTWARE	DG A:2 , DG A:3 , DG A:6 , DG A:7 , DG A:10 , DG A:11 , DG A:15 , DG A:16 , K A:103	binding site for residue K A 102
03	AC3	SOFTWARE	DG A:1 , DG A:2 , DG A:5 , DG A:6 , DG A:9 , DG A:10 , DG A:14 , DG A:15 , K A:101 , K A:102	binding site for residue K A 103
04	AC4	SOFTWARE	DG C:2 , DG C:3 , DG C:6 , DG C:7 , DG C:10 , DG C:11 , DG C:15 , DG C:16 , K C:102	binding site for residue K C 101
05	AC5	SOFTWARE	K A:101 , DG C:1 , DG C:2 , DG C:5 , DG C:6 , DG C:9 , DG C:10 , DG C:14 , DG C:15 , K C:101	binding site for residue K C 102
06	AC6	SOFTWARE	DG E:2 , DG E:3 , DG E:6 , DG E:7 , DG E:10 , DG E:11 , DG E:15 , DG E:16 , K E:102	binding site for residue K E 101
07	AC7	SOFTWARE	DG E:1 , DG E:2 , DG E:5 , DG E:6 , DG E:9 , DG E:10 , DG E:14 , DG E:15 , K E:101 , K E:103	binding site for residue K E 102
08	AC8	SOFTWARE	DG E:1 , DG E:5 , DG E:9 , DG E:14 , K E:102 , DG G:1 , DG G:5 , DG G:9 , DG G:14 , K G:102	binding site for residue K E 103
09	AC9	SOFTWARE	DG G:2 , DG G:3 , DG G:6 , DG G:7 , DG G:10 , DG G:11 , DG G:15 , DG G:16 , K G:102	binding site for residue K G 101
10	AD1	SOFTWARE	K E:103 , DG G:1 , DG G:2 , DG G:5 , DG G:6 , DG G:9 , DG G:10 , DG G:14 , DG G:15 , K G:101	binding site for residue K G 102

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:DNA  Length:25
                                                        
                  5dww A  1 GGGTGGGTGGGTTGGGTTAGCGTTA 25
                                    10        20

Chain B from PDB  Type:DNA  Length:8
                                       
                  5dww B  1 TAACGCTA  8

Chain C from PDB  Type:DNA  Length:25
                                                        
                  5dww C  1 GGGTGGGTGGGTTGGGTTAGCGTTA 25
                                    10        20

Chain D from PDB  Type:DNA  Length:8
                                       
                  5dww D  1 TAACGCTA  8

Chain E from PDB  Type:DNA  Length:25
                                                        
                  5dww E  1 GGGTGGGTGGGTTGGGTTAGCGTTA 25
                                    10        20

Chain F from PDB  Type:DNA  Length:7
                                      
                  5dww F  2 AACGCTA  8

Chain G from PDB  Type:DNA  Length:25
                                                        
                  5dww G  1 GGGTGGGTGGGTTGGGTTAGCGTTA 25
                                    10        20

Chain H from PDB  Type:DNA  Length:8
                                       
                  5dww H  1 TAACGCTA  8

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (0, 0)

Visualization

Interactive Views

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		K	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]
		AC3	[ RasMol ]	+environment [ RasMol ]
		AC4	[ RasMol ]	+environment [ RasMol ]
		AC5	[ RasMol ]	+environment [ RasMol ]
		AC6	[ RasMol ]	+environment [ RasMol ]
		AC7	[ RasMol ]	+environment [ RasMol ]
		AC8	[ RasMol ]	+environment [ RasMol ]
		AC9	[ RasMol ]	+environment [ RasMol ]
		AD1	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5dww)

Biological Units
	Complete Structure
		Biological Unit 1	[ Jena3D ]
		Biological Unit 2	[ Jena3D ]
		Biological Unit 3	[ Jena3D ]
		Biological Unit 4	[ Jena3D ]
		Biological Unit 5	[ Jena3D ]

Still Images

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym. Unit PNG format \| Asym. Unit - sites PNG format \| Biol. Unit 1 PNG format \| Biol. Unit 1 - sites PNG format \| Biol. Unit 2 PNG format \| Biol. Unit 3 PNG format \| Biol. Unit 4 PNG format \| Biol. Unit 5 PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	5dww
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Analysis Tools

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT

Description