Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  OCEANOBACILLUS IHEYENSIS GROUP II INTRON DOMAIN 1
 
Authors :  C. Zhao, K. R. Rajashankar, M. Marcia, A. M. Pyle
Date :  08 Feb 15  (Deposition) - 14 Oct 15  (Release) - 02 Dec 15  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.95
Chains :  Asym. Unit :  A,B
Biol. Unit 1:  A  (1x)
Biol. Unit 2:  B  (1x)
Keywords :  Group Ii Intron, Domain 1, Rna, Transferase (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  C. Zhao, K. R. Rajashankar, M. Marcia, A. M. Pyle
Crystal Structure Of Group Ii Intron Domain 1 Reveals A Template For Rna Assembly.
Nat. Chem. Biol. V. 11 967 2015
PubMed-ID: 26502156  |  Reference-DOI: 10.1038/NCHEMBIO.1949

(-) Compounds

Molecule 1 - GROUP II INTRON, DOMAIN 1
    Chains: A, B
    Engineered: YES
    Organism Scientific: OCEANOBACILLUS IHEYENSIS HTE831
    Organism Taxid: 221109
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric Unit : AB
Biological Unit 1 (1x): A 
Biological Unit 2 (1x):  B

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 21)

Asymmetric Unit (2, 21)
No.NameCountTypeFull Name
1K2Ligand/IonPOTASSIUM ION
2MG19Ligand/IonMAGNESIUM ION
Biological Unit 1 (0, 0)
No.NameCountTypeFull Name
1K-1Ligand/IonPOTASSIUM ION
2MG-1Ligand/IonMAGNESIUM ION
Biological Unit 2 (0, 0)
No.NameCountTypeFull Name
1K-1Ligand/IonPOTASSIUM ION
2MG-1Ligand/IonMAGNESIUM ION

(-) Sites  (18, 18)

Asymmetric Unit (18, 18)
No.NameEvidenceResiduesDescription
01AC1SOFTWAREG A:136binding site for residue MG A 400
02AC2SOFTWAREU A:66 , A A:67binding site for residue MG A 402
03AC3SOFTWAREA A:67 , G A:68 , C A:116binding site for residue MG A 403
04AC4SOFTWAREG A:239 , A A:240binding site for residue MG A 404
05AC5SOFTWAREA A:154 , G A:155 , U A:221binding site for residue MG A 405
06AC6SOFTWAREG A:136 , C A:145binding site for residue MG A 406
07AC7SOFTWAREG B:28binding site for residue MG B 400
08AC8SOFTWAREU B:66 , A B:67binding site for residue MG B 401
09AC9SOFTWAREA B:67 , G B:68binding site for residue MG B 402
10AD1SOFTWAREG B:133binding site for residue MG B 403
11AD2SOFTWAREG B:135 , G B:136binding site for residue MG B 404
12AD3SOFTWAREA B:154 , G B:155 , G B:156binding site for residue MG B 405
13AD4SOFTWAREC B:201 , U B:202binding site for residue MG B 406
14AD5SOFTWAREG B:156 , A B:181binding site for residue MG B 407
15AD6SOFTWAREG B:15 , U B:255binding site for residue MG B 408
16AD7SOFTWAREA A:223 , U B:221 , A B:222binding site for residue MG B 409
17AD8SOFTWAREG B:58binding site for residue MG B 410
18AD9SOFTWAREG B:32binding site for residue MG B 411

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4Y1O)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 4Y1O)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4Y1O)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4Y1O)

(-) Exons   (0, 0)

(no "Exon" information available for 4Y1O)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:RNA  Length:258
                                                                                                                                                                                                                                                                                                  
                 4y1o A  -3 UUAUCCCGGCAUGGGUGCAGUCUAUAGGGUGAGAGUCCCGAACUGUGAAGGCAGAAGUAACAGUUAGCCUAACGCAAGGGUUCCGUGGAAACAUGGAAUCGAAGCGGACGGCAAACCUUCGGUCUGAGGAACACGAACUUCAUAUGAGGCUAGGUAUCAAUGGAUGAGUUUGCAUAACAAAACAAAGUCCUUUCUGCCAGUUGGUACAGAGUAAAUGAAGCAGAUUGAAGGGAAAGACUGCAUUCUUACCCGGGGAUC 270
                               ||   11        21        31        41        51        61        71        81||      92       102|      117       127       137       147       157       167       177       187       197       209       219       229    || 242       252       262        
                               0|                                                                          82|               102|                                                                                               206|                      234|                                
                                6                                                                           84                108                                                                                                209                       238                                


Chain B from PDB  Type:RNA  Length:256
                                                                                                                                                                                                                                                                                                
                 4y1o B  -4 GUUACCCGGCAUGGGUGCAGUCUAUAGGGUGAGAGUCCCGAACUGUGAAGGCAGAAGUAACAGUUAGCCUAACGCAAGGGUGUCCGUGGAAACAUGGAAGAAGCGGACGGCAAACCUUCGGUCUGAGGAAACGAACUUCAUAGAGGCUAGGUAUCAAUGGAUGAGUUUGCAUAACAAAACAAAGUCCUUUCUGCCAAAGUUGGUACAGAGUAAAUGAAGCAGAUUGAAGGGAAAGACUGCAUUCUUACCGGGGAUC 270
                               ||   11        21        31        41        51        61        71        81        91       108       118       128       138|      149 ||    160       170       180       190       200       210       220       230   ||  243       253      |264      
                              -1|                                                                                           100|                           138|        151|                                                                              234|                   260|        
                                6                                                                                            108                            140         153                                                                               238                    262
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4Y1O)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4Y1O)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4Y1O)

(-) Gene Ontology  (0, 0)

Asymmetric Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 4Y1O)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
    AD1  [ RasMol ]  +environment [ RasMol ]
    AD2  [ RasMol ]  +environment [ RasMol ]
    AD3  [ RasMol ]  +environment [ RasMol ]
    AD4  [ RasMol ]  +environment [ RasMol ]
    AD5  [ RasMol ]  +environment [ RasMol ]
    AD6  [ RasMol ]  +environment [ RasMol ]
    AD7  [ RasMol ]  +environment [ RasMol ]
    AD8  [ RasMol ]  +environment [ RasMol ]
    AD9  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4y1o)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4y1o
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 4Y1O)

(-) Related Entries Specified in the PDB File

4y1n