4Y1N - JenaLib

Title :   OCEANOBACILLUS IHEYENSIS GROUP II INTRON DOMAIN 1 WITH IRIDIUM HEXAMINE

Authors :   C. Zhao, K. R. Rajashankar, M. Marcia, A. M. Pyle

Date :   08 Feb 15 (Deposition) - 14 Oct 15 (Release) - 02 Dec 15 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   3.00

Chains :   Asym. Unit : A,B
Biol. Unit 1: A  (1x)
Biol. Unit 2: B  (1x)

Keywords :   Group Ii Intron, Domain 1, Rna, Iridium Hexamine, Transferase (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   C. Zhao, K. R. Rajashankar, M. Marcia, A. M. Pyle
Crystal Structure Of Group Ii Intron Domain 1 Reveals A Template For Rna Assembly.
Nat. Chem. Biol. V. 11 967 2015
PubMed-ID: 26502156 | Reference-DOI: 10.1038/NCHEMBIO.1949

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (3, 37)

Sites (36, 36)

Asymmetric Unit (36, 36)

No.	Name	Evidence	Residues	Description
01	AC1	SOFTWARE	C A:8 , G A:9 , G A:10 , U A:259	binding site for residue IRI A 401
02	AC2	SOFTWARE	C A:70 , G A:113 , G A:114	binding site for residue IRI A 402
03	AC3	SOFTWARE	A A:25 , U A:26 , A A:27 , G A:28 , G A:29 , G A:41 , IRI A:405	binding site for residue IRI A 403
04	AC4	SOFTWARE	A A:12 , U A:13 , G A:14 , G A:15 , G A:16 , U A:255 , U A:256	binding site for residue IRI A 404
05	AC5	SOFTWARE	G A:30 , A A:35 , G A:36 , IRI A:403	binding site for residue IRI A 405
06	AC6	SOFTWARE	G A:36 , U A:37	binding site for residue IRI A 406
07	AC7	SOFTWARE	C A:38 , C A:39 , G A:243 , G A:244 , IRI A:408	binding site for residue IRI A 407
08	AC8	SOFTWARE	A A:241 , G A:242 , G A:243 , G A:244 , IRI A:407	binding site for residue IRI A 408
09	AC9	SOFTWARE	C A:40 , G A:41	binding site for residue IRI A 409
10	AD1	SOFTWARE	C A:119 , A A:120 , G A:173 , G A:239 , A A:240	binding site for residue IRI A 410
11	AD2	SOFTWARE	G A:264 , G A:265 , G A:266	binding site for residue IRI A 411
12	AD3	SOFTWARE	U A:31 , G A:32 , G A:34	binding site for residue IRI A 412
13	AD4	SOFTWARE	A A:163 , U A:164 , C A:165 , U A:211 , G A:212 , G A:213 , U A:214	binding site for residue IRI A 413
14	AD5	SOFTWARE	U A:66 , A A:67	binding site for residue MG A 414
15	AD6	SOFTWARE	A A:67 , G A:68	binding site for residue MG A 415
16	AD7	SOFTWARE	G A:153 , A A:154 , G A:155	binding site for residue MG A 416
17	AD8	SOFTWARE	A A:167 , U B:31 , G B:32 , G B:34	binding site for residue IRI B 401
18	AD9	SOFTWARE	A B:12 , G B:14 , G B:15 , G B:16 , U B:255 , U B:256	binding site for residue IRI B 402
19	AE1	SOFTWARE	C B:8 , G B:9 , G B:10 , U B:259 , A B:260	binding site for residue IRI B 403
20	AE2	SOFTWARE	C B:38 , C B:39 , G B:243 , G B:244 , IRI B:405	binding site for residue IRI B 404
21	AE3	SOFTWARE	A B:241 , G B:242 , G B:243 , G B:244 , IRI B:404	binding site for residue IRI B 405
22	AE4	SOFTWARE	C A:23 , C B:76 , A B:77	binding site for residue IRI B 406
23	AE5	SOFTWARE	G B:79 , G B:80 , G B:81 , A B:99 , A B:100 , U B:101 , C B:102	binding site for residue IRI B 407
24	AE6	SOFTWARE	A B:163 , U B:164 , G B:212 , G B:213 , U B:214	binding site for residue IRI B 408
25	AE7	SOFTWARE	A B:159 , G B:160 , U B:211	binding site for residue IRI B 409
26	AE8	SOFTWARE	G B:264 , G B:265 , G B:266	binding site for residue IRI B 410
27	AE9	SOFTWARE	U B:31 , G B:32 , A B:35	binding site for residue IRI B 411
28	AF1	SOFTWARE	A B:49 , G B:52 , C B:53 , A B:54 , G B:169 , G B:170	binding site for residue IRI B 412
29	AF2	SOFTWARE	G B:64 , U B:66 , A B:120 , IRI B:414	binding site for residue IRI B 413
30	AF3	SOFTWARE	C B:119 , A B:120 , G B:173 , A B:174 , G B:239 , A B:240 , IRI B:413	binding site for residue IRI B 414
31	AF4	SOFTWARE	G B:142 , A B:144 , C B:145 , U B:146	binding site for residue IRI B 415
32	AF5	SOFTWARE	U B:65 , U B:66 , A B:120 , MG B:417	binding site for residue MG B 416
33	AF6	SOFTWARE	A B:67 , G B:68 , MG B:416	binding site for residue MG B 417
34	AF7	SOFTWARE	A B:25	binding site for residue MG B 418
35	AF8	SOFTWARE	G B:114	binding site for residue MG B 419
36	AF9	SOFTWARE	A B:154 , G B:155	binding site for residue MG B 420

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:249
                                                                                                                                                                                                                                                                                         
                 4y1n A   6 CCCGGCAUGGGUGCAGUCUAUAGGGUGAGAGUCCCGAACUGUGAAGGCAGAAGUAACAGUUAGCCUAACGCAAGGGUGUCCGUGGAAACAUGGAAUCUGAAGCGGACGGCAAACCUUCGGUCUGAGGAAUUCAUAUGAGGCUAGGUAUCAAUGGAUGAGUUUGCAUAACAAAACAAAGUCCUUUCUGCCAAAGUUGGUACAGAGUAAAUGAAGCAGAUUGAAGGGAAAGACUGCAUUCUUCCGGGGAUC 270
                                    15        25        35        45        55        65        75        85        95       109       119       129       146       156       166       176       186       196       206       216       226       239       249       259|        
                                                                                                                           103|                           138|                                                                                     234|                  259|        
                                                                                                                            108                            146                                                                                      238                   262

Chain B from PDB  Type:RNA  Length:259
                                                                                                                                                                                                                                                                                                   
                 4y1n B  -3 UUAUCCCGGCAUGGGUGCAGUCUAUAGGGUGAGAGUCCCGAACUGUGAAGGCAGAAGUAACAGUUAGCCUAACGCAAGGGUUCCGUGGAAACAUGGAAUCUGAAGCGGACGGCAAACCUUCGGUCUGAGGAACACGAACUUCAUAUGAGGCUAGGUAUCAAUGGAUGAGUUUGCAUAACAAAACAAAGUCCUUUCUGCCAAGUUGGUACAGAGUAAAUGAAGCAGAUUUGAAGGGAAAGACUGCAUUCUUACGGGGAUC 270
                               ||   11        21        31        41        51        61        71        81||      92       102||     116       126       136       146       156       166       176       186       196       206|      217       227       239       249       259||       
                               0|                                                                          82|                103|                                                                                               206|                        235|                   260|       
                                6                                                                           84                 108                                                                                                208                         238                    263

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (0, 0)

Visualization

Interactive Views

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		IRI	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		K	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		MG	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]
		AC3	[ RasMol ]	+environment [ RasMol ]
		AC4	[ RasMol ]	+environment [ RasMol ]
		AC5	[ RasMol ]	+environment [ RasMol ]
		AC6	[ RasMol ]	+environment [ RasMol ]
		AC7	[ RasMol ]	+environment [ RasMol ]
		AC8	[ RasMol ]	+environment [ RasMol ]
		AC9	[ RasMol ]	+environment [ RasMol ]
		AD1	[ RasMol ]	+environment [ RasMol ]
		AD2	[ RasMol ]	+environment [ RasMol ]
		AD3	[ RasMol ]	+environment [ RasMol ]
		AD4	[ RasMol ]	+environment [ RasMol ]
		AD5	[ RasMol ]	+environment [ RasMol ]
		AD6	[ RasMol ]	+environment [ RasMol ]
		AD7	[ RasMol ]	+environment [ RasMol ]
		AD8	[ RasMol ]	+environment [ RasMol ]
		AD9	[ RasMol ]	+environment [ RasMol ]
		AE1	[ RasMol ]	+environment [ RasMol ]
		AE2	[ RasMol ]	+environment [ RasMol ]
		AE3	[ RasMol ]	+environment [ RasMol ]
		AE4	[ RasMol ]	+environment [ RasMol ]
		AE5	[ RasMol ]	+environment [ RasMol ]
		AE6	[ RasMol ]	+environment [ RasMol ]
		AE7	[ RasMol ]	+environment [ RasMol ]
		AE8	[ RasMol ]	+environment [ RasMol ]
		AE9	[ RasMol ]	+environment [ RasMol ]
		AF1	[ RasMol ]	+environment [ RasMol ]
		AF2	[ RasMol ]	+environment [ RasMol ]
		AF3	[ RasMol ]	+environment [ RasMol ]
		AF4	[ RasMol ]	+environment [ RasMol ]
		AF5	[ RasMol ]	+environment [ RasMol ]
		AF6	[ RasMol ]	+environment [ RasMol ]
		AF7	[ RasMol ]	+environment [ RasMol ]
		AF8	[ RasMol ]	+environment [ RasMol ]
		AF9	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4y1n)

Biological Units
	Complete Structure
		Biological Unit 1	[ Jena3D ]
		Biological Unit 2	[ Jena3D ]

Still Images

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	4y1n
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Description