4P95 - JenaLib

Title :   SPECIATION OF A GROUP I INTRON INTO A LARIAT CAPPING RIBOZYME (CIRCULARLY PERMUTATED RIBOZYME)

Authors :   M. Meyer, H. Nielsen, V. Olieric, P. Roblin, S. D. Johansen, E. Westhof, B. Masquida

Date :   02 Apr 14 (Deposition) - 28 May 14 (Release) - 01 Oct 14 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   2.50

Chains :   Asym./Biol. Unit : A

Keywords :   Catalytic Rna, Lariat-Capping Ribozyme, Branching Reaction, Lariat Fold, Rna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   M. Meyer, H. Nielsen, V. Olieric, P. Roblin, S. D. Johansen, E. Westhof B. Masquida
Speciation Of A Group I Intron Into A Lariat Capping Ribozyme.
Proc. Natl. Acad. Sci. Usa V. 111 7659 2014
PubMed-ID: 24821772 | Reference-DOI: 10.1073/PNAS.1322248111

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (3, 5)

Sites (5, 5)

Asymmetric Unit (5, 5)

No.	Name	Evidence	Residues	Description
1	AC1	SOFTWARE	G A:295 , C A:303 , A A:553 , U A:554 , C A:558 , A A:559 , NA A:605	binding site for residue MES A 601
2	AC2	SOFTWARE	G A:325 , HOH A:793 , HOH A:794 , HOH A:795 , HOH A:796 , HOH A:797	binding site for residue MG A 602
3	AC3	SOFTWARE	HOH A:798 , HOH A:799 , HOH A:800 , HOH A:801 , HOH A:802 , HOH A:803	binding site for residue MG A 603
4	AC4	SOFTWARE	HOH A:710 , HOH A:718 , HOH A:719 , HOH A:720 , HOH A:804 , HOH A:805	binding site for residue MG A 604
5	AC5	SOFTWARE	C A:1 , U A:3 , C A:334 , A A:553 , MES A:601	binding site for residue NA A 605

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Asymmetric/Biological Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:189
                                                                                                                                                                                                                             
                 4p95 A   1 CAUCCGGUAUCCCAAGACAAUCUCGGGUUGGGUUGGGAAGUAUCAUGGCUAAUCACCAUGAUGCAAUCGGGUUGAACACUUAAUUGGGUUAAAACGGUGGGGGACGAUCCCGUAACAUCCGUCCUAACGGCGACAGACUGCACGGCCCUGCCUCAGGUGUGUCCAAUGAACAGUCGUUCCGAAAGGAAG 576
                                    10        20 ||    223       233       243       253       263       273       283       293       303       313       323       333       343   ||  547       557       567         
                                                22|                                                                                                                                347|                                  
                                                216                                                                                                                                 542

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (0, 0)

Visualization

Interactive Views

Asymmetric/Biological Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		MES	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		MG	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		NA	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]
		AC3	[ RasMol ]	+environment [ RasMol ]
		AC4	[ RasMol ]	+environment [ RasMol ]
		AC5	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4p95)

Still Images

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym./Biol. Unit PNG format \| Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	4p95
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Analysis Tools

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT

Description