5J01 - JenaLib

Asymmetric Unit (45, 45)

No.	Name	Evidence	Residues	Description
01	AC1	SOFTWARE	C A:358 , G A:359 , C A:377 , U A:419 , HOH A:622	binding site for residue MG A 501
02	AC2	SOFTWARE	U A:4 , HOH A:645 , HOH A:656 , HOH A:666 , HOH A:673 , HOH A:752	binding site for residue MG A 502
03	AC3	SOFTWARE	G A:3 , U A:4 , G A:5 , A A:376 , HOH A:615 , HOH A:641 , HOH A:725	binding site for residue MG A 503
04	AC4	SOFTWARE	HOH A:689 , HOH A:700 , HOH A:738 , HOH A:749 , HOH A:751	binding site for residue MG A 504
05	AC5	SOFTWARE	A A:355 , A A:356 , HOH A:647 , HOH A:680 , HOH A:708 , HOH A:711	binding site for residue MG A 505
06	AC6	SOFTWARE	U A:71 , C A:367 , C A:368 , HOH A:667 , HOH A:687 , HOH A:688 , HOH A:710	binding site for residue MG A 506
07	AC7	SOFTWARE	HOH A:604 , HOH A:619 , HOH A:665 , HOH A:697 , HOH A:702	binding site for residue MG A 507
08	AC8	SOFTWARE	A A:106 , G A:107 , HOH A:626 , HOH A:644 , HOH A:653 , HOH A:664	binding site for residue MG A 508
09	AC9	SOFTWARE	G A:104 , A A:105 , A A:106 , HOH A:603 , HOH A:670	binding site for residue MG A 509
10	AD1	SOFTWARE	G A:111 , HOH A:614 , HOH A:635 , HOH A:660 , HOH A:712 , HOH A:743	binding site for residue MG A 510
11	AD2	SOFTWARE	G A:136 , U A:225 , HOH A:624 , HOH A:636 , HOH A:638 , HOH A:642 , HOH A:681	binding site for residue MG A 511
12	AD3	SOFTWARE	G A:142 , HOH A:646 , HOH A:655 , HOH A:731	binding site for residue MG A 512
13	AD4	SOFTWARE	G A:142 , C A:145 , HOH A:606 , HOH A:607 , HOH A:661 , HOH A:676	binding site for residue MG A 513
14	AD5	SOFTWARE	C A:262 , HOH A:621 , HOH A:625 , HOH A:686 , HOH A:709 , HOH A:757	binding site for residue MG A 514
15	AD6	SOFTWARE	G A:294 , HOH A:613 , HOH A:649 , HOH A:730	binding site for residue MG A 515
16	AD7	SOFTWARE	U A:59 , HOH A:602 , HOH A:616 , HOH A:629 , HOH A:674 , HOH A:740 , HOH A:748	binding site for residue MG A 516
17	AD8	SOFTWARE	C A:6 , C A:7 , HOH A:608 , HOH A:717 , HOH A:719 , HOH A:722	binding site for residue MG A 517
18	AD9	SOFTWARE	U A:66 , A A:67 , HOH A:610 , HOH A:683 , HOH A:685 , HOH A:694	binding site for residue MG A 518
19	AE1	SOFTWARE	A A:154 , G A:155 , HOH A:618 , HOH A:628 , HOH A:659	binding site for residue MG A 519
20	AE2	SOFTWARE	G A:28 , HOH A:617 , HOH A:620 , HOH A:630 , HOH A:713 , HOH A:755	binding site for residue MG A 520
21	AE3	SOFTWARE	A A:318 , HOH A:605 , HOH A:714 , HOH A:735 , HOH A:753	binding site for residue MG A 521
22	AE4	SOFTWARE	HOH A:609 , HOH A:648 , HOH A:691 , HOH A:721 , HOH A:754 , HOH A:758	binding site for residue MG A 522
23	AE5	SOFTWARE	A A:73 , C A:74 , HOH A:611 , HOH A:662 , HOH A:682 , HOH A:701	binding site for residue MG A 523
24	AE6	SOFTWARE	U A:285 , HOH A:663 , HOH A:668 , HOH A:677 , HOH A:706	binding site for residue MG A 524
25	AE7	SOFTWARE	A A:67 , G A:68 , HOH A:632 , HOH A:651 , HOH A:652	binding site for residue MG A 525
26	AE8	SOFTWARE	C A:119 , G A:173 , A A:174 , G A:239 , HOH A:679	binding site for residue MG A 526
27	AE9	SOFTWARE	HOH A:728 , HOH A:729 , HOH A:737 , HOH A:741 , HOH A:744	binding site for residue MG A 527
28	AF1	SOFTWARE	A A:283 , HOH A:650 , HOH A:704 , HOH A:736	binding site for residue MG A 528
29	AF2	SOFTWARE	U A:258 , HOH A:637 , HOH A:715 , HOH A:718 , HOH A:720 , HOH A:747	binding site for residue MG A 529
30	AF3	SOFTWARE	G A:90 , G A:92 , HOH A:732 , HOH A:733 , HOH A:759	binding site for residue MG A 530
31	AF4	SOFTWARE	G A:275 , HOH A:658 , HOH A:671 , HOH A:693 , HOH A:756	binding site for residue MG A 531
32	AF5	SOFTWARE	HOH A:627 , HOH A:633 , HOH A:750 , HOH A:760	binding site for residue MG A 532
33	AF6	SOFTWARE	A A:183 , A A:184 , HOH A:692 , HOH A:696 , HOH A:699	binding site for residue MG A 533
34	AF7	SOFTWARE	HOH A:684 , HOH A:726 , HOH A:761 , HOH A:763 , HOH A:764 , HOH A:765	binding site for residue MG A 534
35	AF8	SOFTWARE	HOH A:639 , HOH A:716 , HOH A:723 , HOH A:739	binding site for residue MG A 535
36	AF9	SOFTWARE	A A:297 , HOH A:640 , HOH A:654 , HOH A:724 , HOH A:734 , HOH A:762	binding site for residue MG A 536
37	AG1	SOFTWARE	A A:333 , U A:334 , G A:335 , HOH A:631 , HOH A:675 , HOH A:698	binding site for residue MG A 537
38	AG2	SOFTWARE	U A:96 , G A:97 , HOH A:657	binding site for residue MG A 538
39	AG3	SOFTWARE	C A:82 , G A:84 , HOH A:612 , HOH A:745	binding site for residue MG A 539
40	AG4	SOFTWARE	A A:223 , A A:224 , HOH A:672	binding site for residue MG A 540
41	AG5	SOFTWARE	A A:137 , A A:151 , A A:224 , HOH A:695 , HOH A:703	binding site for residue MG A 541
42	AG6	SOFTWARE	U A:26 , U A:65 , HOH A:623 , HOH A:727 , HOH A:746	binding site for residue MG A 542
43	AG7	SOFTWARE	A A:283 , G A:284 , HOH A:650	binding site for residue NH4 A 543
44	AG8	SOFTWARE	C A:145 , U A:146 , HOH A:707	binding site for residue NH4 A 544
45	AG9	SOFTWARE	C A:86 , G A:87 , HOH A:705	binding site for residue NH4 A 545

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Asymmetric/Biological Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:414
                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                 5j01 A   1 GUGUGCCCGGCAUGGGUGCAGUCUAUAGGGUGAGAGUCCCGAACUGUGAAGGCAGAAGUAACAGUUAGCCUAACGCAACUGCGCCGUGGCGACAUGGCGUGGGAAGGAAGCGGACGGCAAACCUUCGGUCUGAGGAACACGAACUUCAUAUGAGGCUAGGUAUCAAUGGAUGAGUUUGCAUAACAAAACAAAGUCCUUUCUGCCAAAGUUGGUACAGAGUAAAUGAAGCAGAUUGAUGAAGGGAAAGACUGCAUUCUUACCCGGGGAGGUCUGGAAACAGAAGUCAGCAGAAGUCAUAGUACCCUGUUCGCAGGGGAAGGACGGAACAAGUAUGGCGUUCGCGCCUAAGCUUGAACCGCCGUAUACCGAACGGUACGUACGGUGGUGUGGCAGGGGCGCGCCCCCUAUGCCGAU 419
                                    10        20        30        40        50        60        70        80 ||     91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       405       415    
                                                                                                            82|                                                                                                                                                                                                                                                                                                                         400|              
                                                                                                             84                                                                                                                                                                                                                                                                                                                          405

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (0, 0)

Visualization

Interactive Views

Asymmetric/Biological Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		MG	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		NH4	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]
		AC3	[ RasMol ]	+environment [ RasMol ]
		AC4	[ RasMol ]	+environment [ RasMol ]
		AC5	[ RasMol ]	+environment [ RasMol ]
		AC6	[ RasMol ]	+environment [ RasMol ]
		AC7	[ RasMol ]	+environment [ RasMol ]
		AC8	[ RasMol ]	+environment [ RasMol ]
		AC9	[ RasMol ]	+environment [ RasMol ]
		AD1	[ RasMol ]	+environment [ RasMol ]
		AD2	[ RasMol ]	+environment [ RasMol ]
		AD3	[ RasMol ]	+environment [ RasMol ]
		AD4	[ RasMol ]	+environment [ RasMol ]
		AD5	[ RasMol ]	+environment [ RasMol ]
		AD6	[ RasMol ]	+environment [ RasMol ]
		AD7	[ RasMol ]	+environment [ RasMol ]
		AD8	[ RasMol ]	+environment [ RasMol ]
		AD9	[ RasMol ]	+environment [ RasMol ]
		AE1	[ RasMol ]	+environment [ RasMol ]
		AE2	[ RasMol ]	+environment [ RasMol ]
		AE3	[ RasMol ]	+environment [ RasMol ]
		AE4	[ RasMol ]	+environment [ RasMol ]
		AE5	[ RasMol ]	+environment [ RasMol ]
		AE6	[ RasMol ]	+environment [ RasMol ]
		AE7	[ RasMol ]	+environment [ RasMol ]
		AE8	[ RasMol ]	+environment [ RasMol ]
		AE9	[ RasMol ]	+environment [ RasMol ]
		AF1	[ RasMol ]	+environment [ RasMol ]
		AF2	[ RasMol ]	+environment [ RasMol ]
		AF3	[ RasMol ]	+environment [ RasMol ]
		AF4	[ RasMol ]	+environment [ RasMol ]
		AF5	[ RasMol ]	+environment [ RasMol ]
		AF6	[ RasMol ]	+environment [ RasMol ]
		AF7	[ RasMol ]	+environment [ RasMol ]
		AF8	[ RasMol ]	+environment [ RasMol ]
		AF9	[ RasMol ]	+environment [ RasMol ]
		AG1	[ RasMol ]	+environment [ RasMol ]
		AG2	[ RasMol ]	+environment [ RasMol ]
		AG3	[ RasMol ]	+environment [ RasMol ]
		AG4	[ RasMol ]	+environment [ RasMol ]
		AG5	[ RasMol ]	+environment [ RasMol ]
		AG6	[ RasMol ]	+environment [ RasMol ]
		AG7	[ RasMol ]	+environment [ RasMol ]
		AG8	[ RasMol ]	+environment [ RasMol ]
		AG9	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5j01)

Still Images

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	5j01
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (2, 45)

Sites (45, 45)