Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF 9DB1* DEOXYRIBOZYME (COBALT HEXAMMINE SOAKED CRYSTALS)
 
Authors :  A. Ponce-Salvatierra, C. Hoebartner, V. Pena
Date :  15 Jul 15  (Deposition) - 13 Jan 16  (Release) - 20 Jan 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.99
Chains :  Asym./Biol. Unit :  D,Y
Keywords :  Deoxyribozyme, Rna-Ligase, Catalytic Dna, Dna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  A. Ponce-Salvatierra, K. Wawrzyniak-Turek, U. Steuerwald, C. Hobartner, V. Pena
Crystal Structure Of A Dna Catalyst.
Nature V. 529 231 2016
PubMed-ID: 26735012  |  Reference-DOI: 10.1038/NATURE16471

(-) Compounds

Molecule 1 - RNA (5'-R(P*GP*CP*AP*CP*UP*AP*GP*AP*UP*CP*GP*GP*AP*UP*G)- 3')
    Chains: D
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 2 - DNA (44-MER)
    Chains: Y
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : DY

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 6)

Asymmetric/Biological Unit (2, 6)
No.NameCountTypeFull Name
1CO4Ligand/IonCOBALT (II) ION
2MG2Ligand/IonMAGNESIUM ION

(-) Sites  (6, 6)

Asymmetric Unit (6, 6)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREA D:-1 , G D:1binding site for residue CO D 101
2AC2SOFTWAREG D:-6 , U D:8 , G D:9binding site for residue CO D 102
3AC3SOFTWAREDA Y:39binding site for residue CO Y 101
4AC4SOFTWAREDG Y:8 , DG Y:25binding site for residue CO Y 102
5AC5SOFTWAREDA Y:15binding site for residue MG Y 103
6AC6SOFTWAREDT Y:14 , DA Y:15binding site for residue MG Y 104

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5CKI)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5CKI)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5CKI)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5CKI)

(-) Exons   (0, 0)

(no "Exon" information available for 5CKI)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain D from PDB  Type:RNA  Length:15
                                              
                  5cki D -6 GCACUAGAUCGGAUG  9
                                 ||  4     
                                -1|        
                                  1        


Chain Y from PDB  Type:DNA  Length:44
                                                                           
                  5cki Y  1 ATCCGATGGATCATACGGTCGGAGGGGTTTGCCGTTTAAGTGCC 44
                                    10        20        30        40
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5CKI)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5CKI)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5CKI)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 5CKI)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5cki)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5cki
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 5CKI)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5CKI)