4YB0 - JenaLib

Title :   3',3'-CGAMP RIBOSWITCH BOUND WITH C-DI-GMP

Authors :   A. M. Ren, D. J. Patel, R. K. Rajashankar

Date :   18 Feb 15 (Deposition) - 15 Apr 15 (Release) - 22 Apr 15 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   2.12

Chains :   Asym. Unit : A,R
Biol. Unit 1: R  (1x)
Biol. Unit 2: A  (1x)

Keywords :   Riboswitch, 3', 3'-Cgamp, Spinach, Rna Structure, C-Di-Gmp, Rna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   A. Ren, X. C. Wang, C. A. Kellenberger, K. R. Rajashankar, R. A. Jones, M. C. Hammond, D. J. Patel
Structural Basis For Molecular Discrimination By A 3', 3'-Cgamp Sensing Riboswitch.
Cell Rep V. 11 1 2015
PubMed-ID: 25818298 | Reference-DOI: 10.1016/J.CELREP.2015.03.004

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (4, 11)

Asymmetric Unit (4, 11)

No.	Name	Count	Type	Full Name
1	C2E	2	Ligand/Ion	9,9'-[(2R,3R,3AS,5S,7AR,9R,10R,10AS,12S,14AR)-3,5,10,12-TETRAHYDROXY-5,12-DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3,2-D:3',2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-2,9-DIYL]BIS(2-AMINO-1,9-DIHYDRO-6H-PURIN-6-ONE)
2	GDP	2	Ligand/Ion	GUANOSINE-5'-DIPHOSPHATE
3	K	2	Ligand/Ion	POTASSIUM ION
4	MG	5	Ligand/Ion	MAGNESIUM ION

Biological Unit 1 (2, 2)

No.	Name	Count	Type	Full Name
1	C2E	1	Ligand/Ion	9,9'-[(2R,3R,3AS,5S,7AR,9R,10R,10AS,12S,14AR)-3,5,10,12-TETRAHYDROXY-5,12-DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3,2-D:3',2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-2,9-DIYL]BIS(2-AMINO-1,9-DIHYDRO-6H-PURIN-6-ONE)
2	GDP	1	Ligand/Ion	GUANOSINE-5'-DIPHOSPHATE
3	K	-1	Ligand/Ion	POTASSIUM ION
4	MG	-1	Ligand/Ion	MAGNESIUM ION

Biological Unit 2 (2, 2)

No.	Name	Count	Type	Full Name
1	C2E	1	Ligand/Ion	9,9'-[(2R,3R,3AS,5S,7AR,9R,10R,10AS,12S,14AR)-3,5,10,12-TETRAHYDROXY-5,12-DIOXIDOOCTAHYDRO-2H,7H-DIFURO[3,2-D:3',2'-J][1,3,7,9,2,8]TETRAOXADIPHOSPHACYCLODODECINE-2,9-DIYL]BIS(2-AMINO-1,9-DIHYDRO-6H-PURIN-6-ONE)
2	GDP	1	Ligand/Ion	GUANOSINE-5'-DIPHOSPHATE
3	K	-1	Ligand/Ion	POTASSIUM ION
4	MG	-1	Ligand/Ion	MAGNESIUM ION

Sites (11, 11)

Asymmetric Unit (11, 11)

No.	Name	Evidence	Residues	Description
01	AC1	SOFTWARE	G R:2 , C R:84	binding site for residue GDP R 101
02	AC2	SOFTWARE	G R:8 , A R:11 , A R:12 , A R:14 , G R:40 , A R:41 , A R:42 , C R:75 , C R:76 , MG R:105	binding site for residue C2E R 102
03	AC3	SOFTWARE	G R:26 , G R:28 , HOH R:205 , HOH R:208 , HOH R:214 , HOH R:226	binding site for residue MG R 103
04	AC4	SOFTWARE	A R:11 , A R:12	binding site for residue MG R 104
05	AC5	SOFTWARE	G R:8 , A R:41 , A R:42 , C2E R:102 , HOH R:213	binding site for residue MG R 105
06	AC6	SOFTWARE	A R:48 , G R:50 , G R:51 , A R:65 , HOH R:211 , HOH R:217	binding site for residue K R 106
07	AC7	SOFTWARE	G R:34 , G R:35 , G R:36 , HOH R:216 , HOH R:221 , HOH R:223	binding site for residue K R 107
08	AC8	SOFTWARE	G A:8 , A A:9 , A A:11 , A A:12 , A A:14 , G A:40 , A A:41 , A A:42 , C A:75 , C A:76 , MG A:104	binding site for residue C2E A 102
09	AC9	SOFTWARE	G A:26 , G A:28 , HOH A:202 , HOH A:203 , HOH A:208	binding site for residue MG A 103
10	AD1	SOFTWARE	A A:41 , A A:42 , C2E A:102 , HOH A:215	binding site for residue MG A 104
11	AD2	SOFTWARE	U A:3 , A A:82 , U A:83 , C A:84	binding site for GDP A 101

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:83
                                                                                                                  
                  4yb0 A  2 GUACACGACAAUACUAAACCAUCCGCGAGGAUGGGGCGGAAAGCCUAAGGGUCUCCCUGAGACAGCCGGGCUGCCGAAAUAUC 84
                                    11        21        31        41        51        61        71        81

Chain R from PDB  Type:RNA  Length:83
                                                                                                                  
                  4yb0 R  2 GUACACGACAAUACUAAACCAUCCGCGAGGAUGGGGCGGAAAGCCUAAGGGUCUCCCUGAGACAGCCGGGCUGCCGAAAUAUC 84
                                    11        21        31        41        51        61        71        81

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (0, 0)

Visualization

Interactive Views

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		C2E	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		GDP	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		K	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		MG	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]
		AC3	[ RasMol ]	+environment [ RasMol ]
		AC4	[ RasMol ]	+environment [ RasMol ]
		AC5	[ RasMol ]	+environment [ RasMol ]
		AC6	[ RasMol ]	+environment [ RasMol ]
		AC7	[ RasMol ]	+environment [ RasMol ]
		AC8	[ RasMol ]	+environment [ RasMol ]
		AC9	[ RasMol ]	+environment [ RasMol ]
		AD1	[ RasMol ]	+environment [ RasMol ]
		AD2	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4yb0)

Biological Units
	Complete Structure
		Biological Unit 1	[ Jena3D ]
		Biological Unit 2	[ Jena3D ]

Still Images

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym. Unit PNG format \| Asym. Unit - sites PNG format \| Biol. Unit 1 PNG format \| Biol. Unit 1 - sites PNG format \| Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	4yb0
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Analysis Tools

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT

Description