Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)NMR Structure - manually
(-)NMR Structure - model 1
(-)NMR Structure - model 1, sites
(-)NMR Structure - all models
collapse expand < >
Image NMR Structure - manually
NMR Structure - manually  (Jmol Viewer)
Image NMR Structure - model 1
NMR Structure - model 1  (Jmol Viewer)
Image NMR Structure - model 1, sites
NMR Structure - model 1, sites  (Jmol Viewer)
Image NMR Structure - all models
NMR Structure - all models  (Jmol Viewer)

(-) Description

Title :  SACCHARIDE-RNA RECOGNITION IN AN AMINOGLYCOSIDE ANTIBIOTIC-RNA APTAMER COMPLEX, NMR, 7 STRUCTURES
 
Authors :  L. Jiang, A. K. Suri, R. Fiala, D. J. Patel
Date :  12 Dec 96  (Deposition) - 16 Jun 97  (Release) - 24 Feb 09  (Revision)
Method :  SOLUTION NMR
Resolution :  NOT APPLICABLE
Chains :  NMR Structure  :  A  (7x)
Keywords :  Ribonucleic Acid, Rna (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  L. Jiang, A. K. Suri, R. Fiala, D. J. Patel
Saccharide-Rna Recognition In An Aminoglycoside Antibiotic-Rna Aptamer Complex.
Chem. Biol. V. 4 35 1997
PubMed-ID: 9070426  |  Reference-DOI: 10.1016/S1074-5521(97)90235-0
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3')
    ChainsA
    EngineeredYES
    SyntheticYES

 Structural Features

(-) Chains, Units

  
NMR Structure (7x)

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 3)

NMR Structure (3, 3)
No.NameCountTypeFull Name
1TOA1Ligand/Ion3-DEOXY-3-AMINO GLUCOSE
2TOB1Ligand/Ion1,3-DIAMINO-5,6-DIHYDROXYCYCLOHEXANE
3TOC1Ligand/Ion2,3,6-TRIDEOXY-2,6-DIAMINO GLUCOSE

(-) Sites  (3, 3)

NMR Structure (3, 3)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREA A:7 , G A:8 , C A:15 , A A:17 , C A:18 , TOB A:29BINDING SITE FOR RESIDUE TOA A 28
2AC2SOFTWAREU A:11 , U A:12 , G A:14 , C A:15 , TOB A:29BINDING SITE FOR RESIDUE TOC A 30
3AC3SOFTWAREG A:8 , G A:9 , U A:10 , U A:11 , TOA A:28 , TOC A:30BINDING SITE FOR RESIDUE TOB A 29

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1TOB)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1TOB)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1TOB)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1TOB)

(-) Exons   (0, 0)

(no "Exon" information available for 1TOB)

(-) Sequences/Alignments

NMR Structure
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:RNA  Length:27
                                                          
                  1tob A  1 GGCACGAGGUUUAGCUACACUCGUGCC 27
                                    10        20       

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 1TOB)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 1TOB)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1TOB)

(-) Gene Ontology  (0, 0)

NMR Structure(hide GO term definitions)
    (no "Gene Ontology" information available for 1TOB)

 Visualization

(-) Interactive Views

NMR Structure
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    TOA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    TOB  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    TOC  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1tob)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
Insightii
  RNA: ribbon; ligand: spacefill; 7 models
Midas
  RNA: ribbon, plates; ligand: dot surface; 7 models
Weblab
  RNA: ribbon; ligand: spacefill; labeling; model 1
  RNA: surface, molecular electrostatic potential coloring; ligand: sticks; model 1
  RNA: surface, molecular electrostatic potential coloring; ligand: surface, molecular electrostatic potential coloring; model 1
  RNA: ribbon, lines; ligand: spacefill; labeling; model 1
  RNA: ribbon, plates; ligand: spacefill; labeling; model 1
  RNA: ribbon, plates; ligand: spacefill; labeling; model 1; different view
Distance Plot
  representative atom O3*; model 1

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1tob
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP | HSSP
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1TOB)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1TOB)