Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE SPINACH RNA APTAMER IN COMPLEX WITH DFHBI, BARIUM IONS
 
Authors :  K. D. Warner, M. C. Chen, W. Song, R. L. Strack, A. Thorn, S. R. Jaffrey, A. D'Amare
Date :  18 Jun 14  (Deposition) - 23 Jul 14  (Release) - 01 Oct 14  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.80
Chains :  Asym./Biol. Unit :  X,Y
Keywords :  Aptamer, Fluorescence, G-Quadruplex, Rna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  K. D. Warner, M. C. Chen, W. Song, R. L. Strack, A. Thorn, S. R. Jaffrey, A. R. Ferre-D'Amare
Structural Basis For Activity Of Highly Efficient Rna Mimic Of Green Fluorescent Protein.
Nat. Struct. Mol. Biol. V. 21 658 2014
PubMed-ID: 25026079  |  Reference-DOI: 10.1038/NSMB.2865

(-) Compounds

Molecule 1 - SPINACH RNA APTAMER, BIMOLECULAR CONSTRUCT
    Chains: X
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 2 - SPINACH RNA APTAMER, BIMOLECULAR CONSTRUCT
    Chains: Y
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : XY

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (5, 18)

Asymmetric/Biological Unit (5, 18)
No.NameCountTypeFull Name
138E1Ligand/Ion(5Z)-5-(3,5-DIFLUORO-4-HYDROXYBENZYLIDENE)-2,3-DIMETHYL-3,5-DIHYDRO-4H-IMIDAZOL-4-ONE
2BA1Ligand/IonBARIUM ION
3CCC2Mod. NucleotideCYTIDINE-5'-PHOSPHATE-2',3'-CYCLIC PHOSPHATE
4K10Ligand/IonPOTASSIUM ION
5SUC4Ligand/IonSUCROSE

(-) Sites  (17, 17)

Asymmetric Unit (17, 17)
No.NameEvidenceResiduesDescription
01AC1SOFTWAREG X:29 , G X:30 , G Y:74 , A Y:75binding site for residue SUC X 101
02AC2SOFTWAREG X:25 , G X:26 , G X:29 , G X:30 , G Y:65 , G Y:68 , G Y:70 , G Y:72binding site for residue K X 102
03AC3SOFTWAREG X:40 , HOH X:201 , HOH Y:201binding site for residue K X 103
04AC4SOFTWAREA X:23 , HOH X:203 , HOH X:204 , HOH Y:205binding site for residue K X 104
05AC5SOFTWAREG X:14 , A X:15 , A X:16 , A X:17 , U X:18binding site for residue K X 105
06AC6SOFTWAREG X:25 , G X:26 , 38E Y:107 , HOH Y:203 , HOH Y:208binding site for residue K X 106
07AC7SOFTWAREG X:19 , G X:20 , A Y:67 , C Y:80 , G Y:81binding site for residue SUC X 107
08AC8SOFTWAREG X:20 , U Y:78binding site for residue BA X 108
09AC9SOFTWAREG X:25 , G X:29 , G Y:68 , G Y:72 , U Y:73 , G Y:74binding site for residue K X 109
10AD1SOFTWAREG X:26 , U Y:61 , U Y:62 , HOH Y:203 , HOH Y:204binding site for residue K X 110
11AD2SOFTWAREG X:1 , G Y:49 , U Y:94binding site for residue CCC Y 101
12AD3SOFTWAREC X:28 , A Y:75 , G Y:76 , C Y:77binding site for residue SUC Y 102
13AD4SOFTWAREG X:6 , C X:33 , A Y:64 , G Y:65 , A Y:69 , A Y:84 , C Y:85 , K Y:105 , 38E Y:107binding site for residue SUC Y 103
14AD5SOFTWAREU Y:86 , G Y:87binding site for residue K Y 104
15AD6SOFTWAREA Y:84 , SUC Y:103binding site for residue K Y 105
16AD7SOFTWAREG Y:56binding site for residue K Y 106
17AD8SOFTWAREG X:26 , G X:31 , K X:106 , HOH X:206 , HOH X:207 , U Y:61 , A Y:64 , G Y:65 , A Y:69 , G Y:70 , SUC Y:103 , HOH Y:203 , HOH Y:208binding site for residue 38E Y 107

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4TS0)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 4TS0)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4TS0)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4TS0)

(-) Exons   (0, 0)

(no "Exon" information available for 4TS0)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain X from PDB  Type:RNA  Length:44
                                                                            
                 4ts0 X   1 GACGCGACCGAAUGAAAUGGUGAAGGACGGGUCCAGCCGGCUGx  44
                                    10        20        30        40   |
                                                                      44-CCC


Chain Y from PDB  Type:RNA  Length:47
                                                                               
                 4ts0 Y  49 GCAGCCGGCUUGUUGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUx 101
                                    58        68        78        88     ||
                                                                        94|
                                                                        101-CCC
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4TS0)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4TS0)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4TS0)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 4TS0)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    38E  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    BA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    CCC  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    SUC  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
    AD1  [ RasMol ]  +environment [ RasMol ]
    AD2  [ RasMol ]  +environment [ RasMol ]
    AD3  [ RasMol ]  +environment [ RasMol ]
    AD4  [ RasMol ]  +environment [ RasMol ]
    AD5  [ RasMol ]  +environment [ RasMol ]
    AD6  [ RasMol ]  +environment [ RasMol ]
    AD7  [ RasMol ]  +environment [ RasMol ]
    AD8  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4ts0)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4ts0
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 4TS0)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 4TS0)