Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  THE SECOND C-KIT DNA QUADRUPLEX CRYSTAL STRUCTURE
 
Authors :  D. Wei, S. Neidle
Date :  15 Oct 14  (Deposition) - 29 Oct 14  (Release) - 26 Nov 14  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.73
Chains :  Asym. Unit :  A,B
Biol. Unit 1:  B  (1x)
Biol. Unit 2:  A  (1x)
Keywords :  Dna G-Quadruplex, C/Kit, Dna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  D. Wei, S. Neidle
The Second C-Kit1 Dna Quadruplex Crystal Structure
To Be Published
PubMed: search

(-) Compounds

Molecule 1 - DNA (5'- D(*AP*GP*GP*GP*AP*GP*GP*GP*CP*GP*CP*TP*GP*GP*GP*AP*GP*GP*AP*GP*GP*G)- 3')
    Chains: B, A
    Engineered: YES
    Organism Common: HUMAN
    Organism Scientific: HOMO SAPIENS
    Organism Taxid: 9606
    Other Details: C-KIT1 DNA G-QUADRUPLEX
    Other Details - Source: THIS SEQUENCE OCCURS NATURALLY IN HUMANS.
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric Unit : AB
Biological Unit 1 (1x):  B
Biological Unit 2 (1x): A 

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 5)

Asymmetric Unit (1, 5)
No.NameCountTypeFull Name
1K5Ligand/IonPOTASSIUM ION
Biological Unit 1 (0, 0)
No.NameCountTypeFull Name
1K-1Ligand/IonPOTASSIUM ION
Biological Unit 2 (0, 0)
No.NameCountTypeFull Name
1K-1Ligand/IonPOTASSIUM ION

(-) Sites  (5, 5)

Asymmetric Unit (5, 5)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREDG A:2 , DG A:6 , DG A:10 , DG A:13 , K A:102 , DG B:2 , DG B:6 , DG B:10 , DG B:13 , K B:103binding site for residue K B 101
2AC2SOFTWAREDG B:3 , DG B:4 , DG B:7 , DG B:8 , DG B:14 , DG B:15 , DG B:20 , DG B:21 , DG B:22 , K B:103binding site for residue K B 102
3AC3SOFTWAREDG B:2 , DG B:3 , DG B:6 , DG B:7 , DG B:10 , DG B:13 , DG B:14 , DG B:21 , K B:101 , K B:102binding site for residue K B 103
4AC4SOFTWAREDG A:3 , DG A:4 , DG A:7 , DG A:8 , DG A:14 , DG A:15 , DG A:20 , DG A:21 , DG A:22 , K A:102binding site for residue K A 101
5AC5SOFTWAREDG A:2 , DG A:3 , DG A:6 , DG A:7 , DG A:10 , DG A:13 , DG A:14 , DG A:21 , K A:101 , K B:101binding site for residue K A 102

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4WO3)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 4WO3)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4WO3)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4WO3)

(-) Exons   (0, 0)

(no "Exon" information available for 4WO3)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:DNA  Length:22
                                                     
                  4wo3 A  1 AGGGAGGGCGCTGGGAGGAGGG 22
                                    10        20  


Chain B from PDB  Type:DNA  Length:22
                                                     
                  4wo3 B  1 AGGGAGGGCGCTGGGAGGAGGG 22
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4WO3)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4WO3)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4WO3)

(-) Gene Ontology  (0, 0)

Asymmetric Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 4WO3)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4wo3)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4wo3
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 4WO3)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 4WO3)