4Y1I - JenaLib

Asymmetric Unit (Jmol Viewer)

Asym. Unit - sites (Jmol Viewer)

Biological Unit 1 (Jmol Viewer)

Biol. Unit 1 - sites (Jmol Viewer)

Title :   LACTOCOCCUS LACTIS YYBP-YKOY MN RIBOSWITCH BOUND TO MN2+

Authors :   I. R. Price, A. Ke

Date :   07 Feb 15 (Deposition) - 08 Apr 15 (Release) - 20 Jul 16 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   2.85

Chains :   Asym. Unit : A,B
Biol. Unit 1: A,B  (2x)

Keywords :   Riboswitch, Manganese-Binding, Rna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   I. R. Price, A. Gaballa, F. Ding, J. D. Helmann, A. Ke
Mn(2+)-Sensing Mechanisms Of Yybp-Ykoy Orphan Riboswitches.
Mol. Cell V. 57 1110 2015
PubMed-ID: 25794619 | Reference-DOI: 10.1016/J.MOLCEL.2015.02.016

Molecule 1 - LACTOCOCCUS LACTIS YYBP-YKOY RIBOSWITCH
	Chains	:	A, B
	Engineered	:	YES
	Organism Scientific	:	LACTOCOCCUS LACTIS SUBSP. LACTIS
	Organism Taxid	:	1360
	Synthetic	:	YES

		1	2
Asymmetric Unit	:	A	B
Biological Unit 1 (2x)	:	A	B

Summary Information (see also Sequences/Alignments below)

Asymmetric Unit (4, 49)

No.	Name	Count	Type	Full Name
1	BA	19	Ligand/Ion	BARIUM ION
2	GTP	2	Ligand/Ion	GUANOSINE-5'-TRIPHOSPHATE
3	MG	25	Ligand/Ion	MAGNESIUM ION
4	MN	3	Ligand/Ion	MANGANESE (II) ION

Biological Unit 1 (1, 4)

No.	Name	Count	Type	Full Name
1	BA	-1	Ligand/Ion	BARIUM ION
2	GTP	4	Ligand/Ion	GUANOSINE-5'-TRIPHOSPHATE
3	MG	-1	Ligand/Ion	MAGNESIUM ION
4	MN	-1	Ligand/Ion	MANGANESE (II) ION

Asymmetric Unit (44, 44)

No.	Name	Evidence	Residues	Description
01	AC1	SOFTWARE	A A:3 , C A:101 , GTP A:226 , C B:101 , C B:102	binding site for residue GTP A 201
02	AC2	SOFTWARE	U A:64	binding site for residue MG A 203
03	AC3	SOFTWARE	A A:3 , HOH A:320	binding site for residue MG A 204
04	AC4	SOFTWARE	C A:31 , G A:62	binding site for residue MG A 205
05	AC5	SOFTWARE	G A:21 , A A:22	binding site for residue MG A 206
06	AC6	SOFTWARE	G A:8 , G A:9 , A A:10 , U A:39 , C A:45 , HOH A:310	binding site for residue MG A 207
07	AC7	SOFTWARE	C A:59 , C A:60 , U B:43 , G B:94	binding site for residue MG A 208
08	AC8	SOFTWARE	C A:45	binding site for residue MG A 209
09	AC9	SOFTWARE	U A:68	binding site for residue MG A 210
10	AD1	SOFTWARE	U A:100 , GTP A:226	binding site for residue MG A 211
11	AD2	SOFTWARE	G A:9 , U A:43 , G A:94 , HOH A:319	binding site for residue MG A 212
12	AD3	SOFTWARE	G A:35 , U A:36 , G A:61 , G A:62	binding site for residue BA A 213
13	AD4	SOFTWARE	G A:6 , HOH A:309	binding site for residue BA A 214
14	AD5	SOFTWARE	G A:51	binding site for residue BA A 215
15	AD6	SOFTWARE	G A:21	binding site for residue BA A 216
16	AD7	SOFTWARE	G A:21 , HOH A:321	binding site for residue BA A 217
17	AD8	SOFTWARE	A A:79	binding site for residue BA A 218
18	AD9	SOFTWARE	G A:8	binding site for residue BA A 220
19	AE1	SOFTWARE	U A:39 , C A:40	binding site for residue BA A 221
20	AE2	SOFTWARE	A A:13	binding site for residue BA A 222
21	AE3	SOFTWARE	G A:46	binding site for residue BA A 223
22	AE4	SOFTWARE	G A:9 , U A:39 , C A:40 , A A:41 , U A:44 , C A:45	binding site for residue MN A 224
23	AE5	SOFTWARE	G A:81 , HOH A:314	binding site for residue MN A 225
24	AE6	SOFTWARE	C A:101 , C A:102 , GTP A:201 , MG A:211 , A B:3 , C B:101	binding site for residue GTP A 226
25	AE7	SOFTWARE	A B:13 , HOH B:306 , HOH B:307 , HOH B:308	binding site for residue MG B 201
26	AE8	SOFTWARE	A B:71 , U B:84 , G B:85	binding site for residue MG B 202
27	AE9	SOFTWARE	G B:16 , HOH B:309 , HOH B:332	binding site for residue MG B 203
28	AF1	SOFTWARE	G B:48	binding site for residue MG B 204
29	AF2	SOFTWARE	A B:23 , A B:24	binding site for residue MG B 205
30	AF3	SOFTWARE	G B:8 , G B:9 , A B:10 , U B:39 , C B:45 , HOH B:311	binding site for residue MG B 206
31	AF4	SOFTWARE	U B:68	binding site for residue MG B 207
32	AF5	SOFTWARE	A B:33	binding site for residue MG B 208
33	AF6	SOFTWARE	HOH B:322	binding site for residue MG B 209
34	AF7	SOFTWARE	HOH B:325	binding site for residue MG B 210
35	AF8	SOFTWARE	C B:31 , G B:62	binding site for residue MG B 211
36	AF9	SOFTWARE	G B:8	binding site for residue MG B 212
37	AG1	SOFTWARE	A B:33	binding site for residue MG B 213
38	AG2	SOFTWARE	U B:43	binding site for residue MG B 214
39	AG3	SOFTWARE	G B:21	binding site for residue BA B 215
40	AG4	SOFTWARE	G B:35 , U B:36 , G B:61 , G B:62	binding site for residue BA B 217
41	AG5	SOFTWARE	HOH B:305	binding site for residue BA B 218
42	AG6	SOFTWARE	G B:8	binding site for residue BA B 219
43	AG7	SOFTWARE	G B:19 , G B:21	binding site for residue BA B 221
44	AG8	SOFTWARE	G B:9 , U B:39 , C B:40 , A B:41 , U B:44 , C B:45	binding site for residue MN B 223

(no "SS Bond" information available for 4Y1I)

(no "Cis Peptide Bond" information available for 4Y1I)

(no "SAP(SNP)/Variant" information available for 4Y1I)

(no "PROSITE Motif" information available for 4Y1I)

(no "Exon" information available for 4Y1I)

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:100
                                                                                                                                    
                 4y1i A   3 AAAGGGGAGUAGCGUCGGGAAACCGAAACAAAGUCGUCAAUUCGUGAGGAAACUCACCGGCUUUGUUGACAUACGAAAGUAUGUUUAGCAAGACCUUUCC 102
                                    12        22        32        42        52        62        72        82        92       102

Chain B from PDB  Type:RNA  Length:100
                                                                                                                                    
                 4y1i B   3 AAAGGGGAGUAGCGUCGGGAAACCGAAACAAAGUCGUCAAUUCGUGAGGAAACUCACCGGCUUUGUUGACAUACGAAAGUAUGUUUAGCAAGACCUUUCC 102
                                    12        22        32        42        52        62        72        82        92       102

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

(no "SCOP Domain" information available for 4Y1I)

(no "CATH Domain" information available for 4Y1I)

(no "Pfam Domain" information available for 4Y1I)

Asymmetric Unit(hide GO term definitions)

(no "Gene Ontology" information available for 4Y1I)

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
		BA	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		GTP	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		MG	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]
		MN	[ RasMol \| Jena3D ]	+environment [ RasMol \| Jena3D ]

	Sites
		AC1	[ RasMol ]	+environment [ RasMol ]
		AC2	[ RasMol ]	+environment [ RasMol ]
		AC3	[ RasMol ]	+environment [ RasMol ]
		AC4	[ RasMol ]	+environment [ RasMol ]
		AC5	[ RasMol ]	+environment [ RasMol ]
		AC6	[ RasMol ]	+environment [ RasMol ]
		AC7	[ RasMol ]	+environment [ RasMol ]
		AC8	[ RasMol ]	+environment [ RasMol ]
		AC9	[ RasMol ]	+environment [ RasMol ]
		AD1	[ RasMol ]	+environment [ RasMol ]
		AD2	[ RasMol ]	+environment [ RasMol ]
		AD3	[ RasMol ]	+environment [ RasMol ]
		AD4	[ RasMol ]	+environment [ RasMol ]
		AD5	[ RasMol ]	+environment [ RasMol ]
		AD6	[ RasMol ]	+environment [ RasMol ]
		AD7	[ RasMol ]	+environment [ RasMol ]
		AD8	[ RasMol ]	+environment [ RasMol ]
		AD9	[ RasMol ]	+environment [ RasMol ]
		AE1	[ RasMol ]	+environment [ RasMol ]
		AE2	[ RasMol ]	+environment [ RasMol ]
		AE3	[ RasMol ]	+environment [ RasMol ]
		AE4	[ RasMol ]	+environment [ RasMol ]
		AE5	[ RasMol ]	+environment [ RasMol ]
		AE6	[ RasMol ]	+environment [ RasMol ]
		AE7	[ RasMol ]	+environment [ RasMol ]
		AE8	[ RasMol ]	+environment [ RasMol ]
		AE9	[ RasMol ]	+environment [ RasMol ]
		AF1	[ RasMol ]	+environment [ RasMol ]
		AF2	[ RasMol ]	+environment [ RasMol ]
		AF3	[ RasMol ]	+environment [ RasMol ]
		AF4	[ RasMol ]	+environment [ RasMol ]
		AF5	[ RasMol ]	+environment [ RasMol ]
		AF6	[ RasMol ]	+environment [ RasMol ]
		AF7	[ RasMol ]	+environment [ RasMol ]
		AF8	[ RasMol ]	+environment [ RasMol ]
		AF9	[ RasMol ]	+environment [ RasMol ]
		AG1	[ RasMol ]	+environment [ RasMol ]
		AG2	[ RasMol ]	+environment [ RasMol ]
		AG3	[ RasMol ]	+environment [ RasMol ]
		AG4	[ RasMol ]	+environment [ RasMol ]
		AG5	[ RasMol ]	+environment [ RasMol ]
		AG6	[ RasMol ]	+environment [ RasMol ]
		AG7	[ RasMol ]	+environment [ RasMol ]
		AG8	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4y1i)

Biological Unit
	Complete Structure
		Biological Unit 1	[ Jena3D ]

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym. Unit PNG format \| Asym. Unit - sites PNG format \| Biol. Unit 1 PNG format \| Biol. Unit 1 - sites PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Access by PDB/NDB ID
	4y1i
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP \| HSSP
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	(no 'UniProt ID/Accession number' available) \|
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT

(no "Entries Sharing at Least One Protein Chain" available for 4Y1I)

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (4, 49)

Sites (44, 44)

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (0, 0)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File