Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  THE STRUCTURE OF NATIVE PISTOL RIBOZYME, BOUND TO IRIDIUM
 
Authors :  A. Ren, D. Patel
Date :  26 May 16  (Deposition) - 13 Jul 16  (Release) - 31 Aug 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.68
Chains :  Asym./Biol. Unit :  A,B
Keywords :  Ribozyme, Rna Structure, Pistol, Rna-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  A. Ren, N. Vusurovic, J. Gebetsberger, P. Gao, M. Juen, C. Kreutz, R. Micura, D. J. Patel
Pistol Ribozyme Adopts A Pseudoknot Fold Facilitating Site-Specific In-Line Cleavage.
Nat. Chem. Biol. V. 12 702 2016
PubMed-ID: 27398999  |  Reference-DOI: 10.1038/NCHEMBIO.2125

(-) Compounds

Molecule 1 - RNA 47-MER
    Chains: A
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 2 - DNA/RNA 11-MER
    Chains: B
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 7)

Asymmetric/Biological Unit (2, 7)
No.NameCountTypeFull Name
1IRI2Ligand/IonIRIDIUM HEXAMMINE ION
2MG5Ligand/IonMAGNESIUM ION

(-) Sites  (7, 7)

Asymmetric Unit (7, 7)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREG A:5 , U A:7 , A A:8 , G A:9 , G A:10 , G A:11 , C A:34binding site for residue IRI A 101
2AC2SOFTWAREC A:41 , G A:42 , HOH A:201 , HOH A:202 , HOH A:204 , HOH A:205binding site for residue MG A 102
3AC3SOFTWAREG A:33 , HOH A:203 , HOH A:208 , HOH A:211binding site for residue MG A 103
4AC4SOFTWAREU A:37 , A A:38 , HOH A:209 , HOH A:212binding site for residue MG A 104
5AC5SOFTWAREA A:23 , HOH A:207 , HOH A:210 , HOH A:213binding site for residue MG A 105
6AC6SOFTWAREG B:52 , DG B:53 , MG B:102binding site for residue IRI B 101
7AC7SOFTWAREDG B:53 , IRI B:101 , HOH B:201 , HOH B:202binding site for residue MG B 102

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5K7D)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5K7D)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5K7D)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5K7D)

(-) Exons   (0, 0)

(no "Exon" information available for 5K7D)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:RNA  Length:47
                                                                              
                  5k7d A  1 CGUGGUUAGGGCCACGUUAAAUAGUUGCUUAAGCCCUAAGCGUUGAU 47
                                    10        20        30        40       


Chain B from PDB  Type:DNA/RNA  Length:11
                                          
                  5k7d B 48 AUCAGGUGCAA 58
                                    57
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5K7D)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5K7D)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5K7D)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 5K7D)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    IRI  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5k7d)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5k7d
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 5K7D)

(-) Related Entries Specified in the PDB File

5k7c 5k7e