Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  STRUCTURE OF THE DNA BINDING DOMAINS OF NFAT, FOS AND JUN BOUND TO DNA
 
Authors :  L. Chen, J. N. M. Glover, P. G. Hogan, A. Rao, S. C. Harrison
Date :  08 Dec 97  (Deposition) - 27 May 98  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.70
Chains :  Asym./Biol. Unit :  A,B,F,J,N
Keywords :  Transcription Factor, Nfat, Nf-At, Ap-1, Fos-Jun, Quaternary Protein-Dna Complex, Transcription Synergy, Combinatorial Gene Regulation, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  L. Chen, J. N. Glover, P. G. Hogan, A. Rao, S. C. Harrison
Structure Of The Dna-Binding Domains From Nfat, Fos And Jun Bound Specifically To Dna.
Nature V. 392 42 1998
PubMed-ID: 9510247  |  Reference-DOI: 10.1038/32100
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - DNA (5'- D(*DTP*DTP*DGP*DGP*DAP*DAP*DAP*DAP*DTP*DTP*DTP*DGP*DTP*DTP* DTP*DCP*DAP*DTP*DAP*DG)-3')
    ChainsA
    EngineeredYES
    SyntheticYES
 
Molecule 2 - DNA (5'- D(*DAP*DAP*DCP*DTP*DAP*DTP*DGP*DAP*DAP*DAP*DCP*DAP*DAP*DAP* DTP*DTP*DTP*DTP*DCP*DC)-3')
    ChainsB
    EngineeredYES
    SyntheticYES
 
Molecule 3 - NUCLEAR FACTOR OF ACTIVATED T CELLS
    CellT-LYMPHOCYTE
    ChainsN
    EngineeredYES
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPLM1
    Expression System StrainBL21 (DE3)
    Expression System Taxid469008
    GeneNFAT1
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SynonymNFAT
 
Molecule 4 - AP-1 FRAGMENT FOS
    ChainsF
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    FragmentFOS
    MutationYES
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SynonymFOS
 
Molecule 5 - AP-1 FRAGMENT JUN
    ChainsJ
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    FragmentJUN
    MutationYES
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SynonymJUN

 Structural Features

(-) Chains, Units

  12345
Asymmetric/Biological Unit ABFJN

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1A02)

(-) Sites  (0, 0)

(no "Site" information available for 1A02)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1A02)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1A02)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (2, 2)

Asymmetric/Biological Unit (2, 2)
  dbSNPPDB
No.SourceVariant IDVariantUniProt IDStatusIDChainVariant
1UniProtVAR_012070T297MJUN_HUMANPolymorphism9989JT307M
2UniProtVAR_051783H446RNFAC2_HUMANPolymorphism12479626NH446R

  SNP/SAP Summary Statistics (UniProtKB/Swiss-Prot)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1BZIP_BASICPS00036 Basic-leucine zipper (bZIP) domain signature.FOS_HUMAN143-157  1F:143-157
JUN_HUMAN257-272  1J:267-282

(-) Exons   (10, 10)

Asymmetric/Biological Unit (10, 10)
 ENSEMBLUniProtKBPDB
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength
1.1ENST000003035621ENSE00001304961chr14:75745531-75745826296FOS_HUMAN1-47470--
1.2ENST000003035622ENSE00001152033chr14:75746580-75746831252FOS_HUMAN48-131840--
1.3ENST000003035623ENSE00001152027chr14:75747263-75747370108FOS_HUMAN132-167361F:140-16728
1.4ENST000003035624ENSE00001129865chr14:75747486-757489321447FOS_HUMAN168-3802131F:168-19225

2.1ENST000003712221ENSE00001454665chr1:59249785-592464653321JUN_HUMAN1-6796791J:267-31852

3.2ENST000003960092ENSE00001455518chr20:50159258-50158909350NFAC2_HUMAN1-44440--
3.3ENST000003960093ENSE00000662713chr20:50140649-501396201030NFAC2_HUMAN44-3873440--
3.4ENST000003960094ENSE00000662712chr20:50133494-50133323172NFAC2_HUMAN387-444581N:399-44446
3.5ENST000003960095ENSE00000662711chr20:50092197-50091995203NFAC2_HUMAN445-512681N:445-51268
3.6ENST000003960096ENSE00000662710chr20:50090689-50090517173NFAC2_HUMAN512-570591N:512-57059
3.7ENST000003960097ENSE00000662709chr20:50071225-50071085141NFAC2_HUMAN570-617481N:570-61748
3.8ENST000003960098ENSE00000662708chr20:50052298-5005224356NFAC2_HUMAN617-635191N:617-63519
3.9ENST000003960099ENSE00000662707chr20:50051851-50051725127NFAC2_HUMAN636-678431N:636-67843
3.10ENST0000039600910ENSE00001455516chr20:50049293-50048604690NFAC2_HUMAN678-9082311N:678-6781
3.12cENST0000039600912cENSE00001955202chr20:50007988-500034944495NFAC2_HUMAN908-925180--

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:DNA  Length:20
                                                     
                1a02 A 4001 TTGGAAAATTTGTTTCATAG 4020
                                  4010      4020

Chain B from PDB  Type:DNA  Length:20
                                                     
                1a02 B 5001 AACTATGAAACAAATTTTCC 5020
                                  5010      5020

Chain F from PDB  Type:PROTEIN  Length:53
 aligned with FOS_HUMAN | P01100 from UniProtKB/Swiss-Prot  Length:380

    Alignment length:53
                                   149       159       169       179       189   
           FOS_HUMAN    140 RRIRRERNKMAAAKCRNRRRELTDTLQAETDQLEDEKSALQTEIANLLKEKEK  192
               SCOP domains d1a02f_ F: C-fos                                      SCOP domains
               CATH domains 1a02F00 F:140-192  [code=1.20.5.170, no name defined] CATH domains
               Pfam domains ----------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------- SAPs(SNPs)
                    PROSITE ---BZIP_BASIC     ----------------------------------- PROSITE
               Transcript 1 Exon 1.3  PDB: F:140-167    Exon 1.4  PDB: F:168-192  Transcript 1
                1a02 F  140 RRIRRERNKMAAAKSRNRRRELTDTLQAETDQLEDEKSALQTEIANLLKEKEK  192
                                   149       159       169       179       189   

Chain J from PDB  Type:PROTEIN  Length:52
 aligned with JUN_HUMAN | P05412 from UniProtKB/Swiss-Prot  Length:331

    Alignment length:52
                                   266       276       286       296       306  
           JUN_HUMAN    257 RKRMRNRIAASKCRKRKLERIARLEEKVKTLKAQNSELASTANMLREQVAQL  308
               SCOP domains d1a02j_ J: C-jun                                     SCOP domains
               CATH domains 1a02J00 J:267-318                                    CATH domains
               Pfam domains ---------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------M----------- SAPs(SNPs)
                    PROSITE BZIP_BASIC      ------------------------------------ PROSITE
               Transcript 2 Exon 2.1  PDB: J:267-318 UniProt: 1-679 [INCOMPLETE] Transcript 2
                1a02 J  267 RKRMRNRIAASKSRKRKLERIARLEEKVKTLKAQNSELASTANMLREQVAQL  318
                                   276       286       296       306       316  

Chain N from PDB  Type:PROTEIN  Length:280
 aligned with NFAC2_HUMAN | Q13469 from UniProtKB/Swiss-Prot  Length:925

    Alignment length:280
                                   408       418       428       438       448       458       468       478       488       498       508       518       528       538       548       558       568       578       588       598       608       618       628       638       648       658       668       678
         NFAC2_HUMAN    399 WPLSSQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHIPESSGRIVSLQTASNPIECSQRSAHELPMVERQDTDSCLVYGGQQMILTGQNFTSESKVVFTEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRTPVKVNFYVINGKRKRSQPQHFTYHPV  678
               SCOP domains d1a02n2 N:399-576 T-cell transcription factor NFAT1 (NFATC), DNA-binding domain                                                                                                   d1a02n1 N:577-678 T-cell transcription factor NFAT1 (NFATC2)                                           SCOP domains
               CATH domains 1a02N01 N:399-569  [code=2.60.40.340, no name defined]                                                                                                                     1a02N02 N:570-678 Immunoglobulins                                                                             CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...........eeeee...........................eeee........eeeeeeee............eeeee...........eee.....eeeeee......eee...eeeee.hhhhhh.............eeeeeeeeeee.....eeeeeee...ee.hhhhhhhh.eeeee....ee.....eeeeeee......eeeeeee.....eeeeeee.eeeeeee..eeeee............eeeeeeeee...ee...eeeeee.. Sec.struct. author
                 SAPs(SNPs) -----------------------------------------------R---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
           Transcript 3 (1) Exon 3.4  PDB: N:399-444 UniProt: 387-444     Exon 3.5  PDB: N:445-512 UniProt: 445-512                           ---------------------------------------------------------Exon 3.7  PDB: N:570-617 UniProt: 570-617       ------------------------------------------------------------3 Transcript 3 (1)
           Transcript 3 (2) -----------------------------------------------------------------------------------------------------------------Exon 3.6  PDB: N:512-570 UniProt: 512-570                  ----------------------------------------------Exon 3.8           Exon 3.9  PDB: N:636-678 UniProt: 636-678   Transcript 3 (2)
                1a02 N  399 WPLSSQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHIPESSGRIVSLQTASNPIECSQRSAHELPMVERQDTDSCLVYGGQQMILTGQNFTSESKVVFTEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRTPVKVNFYVINGKRKRSQPQHFTYHPV  678
                                   408       418       428       438       448       458       468       478       488       498       508       518       528       538       548       558       568       578       588       598       608       618       628       638       648       658       668       678

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (4, 4)

Asymmetric/Biological Unit

(-) CATH Domains  (3, 4)

Asymmetric/Biological Unit
(-)
Class: Mainly Beta (13760)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1A02)

(-) Gene Ontology  (136, 193)

Asymmetric/Biological Unit(hide GO term definitions)
Chain F   (FOS_HUMAN | P01100)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0070412    R-SMAD binding    Interacting selectively and non-covalently with a receptor-regulated SMAD signaling protein.
    GO:0000978    RNA polymerase II core promoter proximal region sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
    GO:0000979    RNA polymerase II core promoter sequence-specific DNA binding    Interacting selectively and non-covalently with the regulatory region composed of the transcription start site and binding sites for transcription factors of the RNA polymerase II basal transcription machinery.
    GO:0003682    chromatin binding    Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase.
    GO:0003690    double-stranded DNA binding    Interacting selectively and non-covalently with double-stranded DNA.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0046982    protein heterodimerization activity    Interacting selectively and non-covalently with a nonidentical protein to form a heterodimer.
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0000982    transcription factor activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to modulate transcription by RNAP II.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0008134    transcription factor binding    Interacting selectively and non-covalently with a transcription factor, any protein required to initiate or regulate transcription.
    GO:0044212    transcription regulatory region DNA binding    Interacting selectively and non-covalently with a DNA region that regulates the transcription of a region of DNA, which may be a gene, cistron, or operon. Binding may occur as a sequence specific interaction or as an interaction observed only once a factor has been recruited to the DNA by other factors.
    GO:0001077    transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to activate or increase the frequency, rate or extent of transcription from the RNAP II promoter.
biological process
    GO:0006306    DNA methylation    The covalent transfer of a methyl group to either N-6 of adenine or C-5 or N-4 of cytosine.
    GO:0038095    Fc-epsilon receptor signaling pathway    A series of molecular signals initiated by the binding of the Fc portion of immunoglobulin E (IgE) to an Fc-epsilon receptor on the surface of a signal-receiving cell, and ending with regulation of a downstream cellular process, e.g. transcription. The Fc portion of an immunoglobulin is its C-terminal constant region.
    GO:0060395    SMAD protein signal transduction    The cascade of processes by which a signal interacts with a receptor, causing a change in the activity of a SMAD protein, and ultimately effecting a change in the functioning of the cell.
    GO:0007568    aging    A developmental process that is a deterioration and loss of function over time. Aging includes loss of functions such as resistance to disease, homeostasis, and fertility, as well as wear and tear. Aging includes cellular senescence, but is more inclusive. May precede death and may succeed developmental maturation (GO:0021700).
    GO:0071277    cellular response to calcium ion    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a calcium ion stimulus.
    GO:0031668    cellular response to extracellular stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an extracellular stimulus.
    GO:0032870    cellular response to hormone stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a hormone stimulus.
    GO:0034614    cellular response to reactive oxygen species    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a reactive oxygen species stimulus. Reactive oxygen species include singlet oxygen, superoxide, and oxygen free radicals.
    GO:0001661    conditioned taste aversion    A conditioned aversion to a specific chemical compound as a result of that compound being coupled with a noxious stimulus.
    GO:0007565    female pregnancy    The set of physiological processes that allow an embryo or foetus to develop within the body of a female animal. It covers the time from fertilization of a female ovum by a male spermatozoon until birth.
    GO:0006954    inflammatory response    The immediate defensive reaction (by vertebrate tissue) to infection or injury caused by chemical or physical agents. The process is characterized by local vasodilation, extravasation of plasma into intercellular spaces and accumulation of white blood cells and macrophages.
    GO:0007399    nervous system development    The process whose specific outcome is the progression of nervous tissue over time, from its formation to its mature state.
    GO:0045672    positive regulation of osteoclast differentiation    Any process that activates or increases the frequency, rate or extent of osteoclast differentiation.
    GO:1902895    positive regulation of pri-miRNA transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of pri-miRNA transcription from RNA polymerase II promoter.
    GO:0045944    positive regulation of transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0045893    positive regulation of transcription, DNA-templated    Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0051090    regulation of sequence-specific DNA binding transcription factor activity    Any process that modulates the frequency, rate or extent of the activity of a transcription factor, any factor involved in the initiation or regulation of transcription.
    GO:0006357    regulation of transcription from RNA polymerase II promoter    Any process that modulates the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0051591    response to cAMP    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a cAMP (cyclic AMP, adenosine 3',5'-cyclophosphate) stimulus.
    GO:0009409    response to cold    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a cold stimulus, a temperature stimulus below the optimal temperature for that organism.
    GO:0051412    response to corticosterone    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a corticosterone stimulus. Corticosterone is a 21 carbon steroid hormone of the corticosteroid type, produced in the cortex of the adrenal glands. In many species, corticosterone is the principal glucocorticoid, involved in regulation of fuel metabolism, immune reactions, and stress responses.
    GO:0034097    response to cytokine    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a cytokine stimulus.
    GO:0042493    response to drug    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a drug stimulus. A drug is a substance used in the diagnosis, treatment or prevention of a disease.
    GO:0009629    response to gravity    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a gravitational stimulus.
    GO:0035902    response to immobilization stress    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of being rendered immobile.
    GO:0009416    response to light stimulus    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a light stimulus, electromagnetic radiation of wavelengths classified as infrared, visible or ultraviolet light.
    GO:0032496    response to lipopolysaccharide    Any process that results in a change in state or activity of an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a lipopolysaccharide stimulus; lipopolysaccharide is a major component of the cell wall of gram-negative bacteria.
    GO:0009612    response to mechanical stimulus    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a mechanical stimulus.
    GO:0035994    response to muscle stretch    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a myofibril being extended beyond its slack length.
    GO:0014070    response to organic cyclic compound    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic cyclic compound stimulus.
    GO:0032570    response to progesterone    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a progesterone stimulus.
    GO:0009636    response to toxic substance    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a toxic stimulus.
    GO:0035914    skeletal muscle cell differentiation    The process in which a relatively unspecialized cell acquires specialized features of a skeletal muscle cell, a somatic cell located in skeletal muscle.
    GO:0030431    sleep    Any process in which an organism enters and maintains a periodic, readily reversible state of reduced awareness and metabolic activity. Usually accompanied by physical relaxation, the onset of sleep in humans and other mammals is marked by a change in the electrical activity of the brain.
    GO:0006366    transcription from RNA polymerase II promoter    The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
    GO:0007179    transforming growth factor beta receptor signaling pathway    A series of molecular signals initiated by the binding of an extracellular ligand to a transforming growth factor beta receptor on the surface of a target cell, and ending with regulation of a downstream cellular process, e.g. transcription.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.
    GO:0005783    endoplasmic reticulum    The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached).
    GO:0016020    membrane    A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.
    GO:0043005    neuron projection    A prolongation or process extending from a nerve cell, e.g. an axon or dendrite.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
    GO:0005667    transcription factor complex    A protein complex that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription.

Chain J   (JUN_HUMAN | P05412)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0005096    GTPase activator activity    Binds to and increases the activity of a GTPase, an enzyme that catalyzes the hydrolysis of GTP.
    GO:0071837    HMG box domain binding    Interacting selectively and non-covalently with an HMG box domain, a protein domain that consists of three helices in an irregular array. HMG-box domains are found in one or more copies in HMG-box proteins, which form a large, diverse family involved in the regulation of DNA-dependent processes such as transcription, replication, and strand repair, all of which require the bending and unwinding of chromatin.
    GO:0070412    R-SMAD binding    Interacting selectively and non-covalently with a receptor-regulated SMAD signaling protein.
    GO:0001102    RNA polymerase II activating transcription factor binding    Interacting selectively and non-covalently with an RNA polymerase II transcription activating factor, a protein involved in positive regulation of transcription.
    GO:0000978    RNA polymerase II core promoter proximal region sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
    GO:0000980    RNA polymerase II distal enhancer sequence-specific DNA binding    Interacting selectively and non-covalently with a RNA polymerase II (Pol II) distal enhancer. In mammalian cells, enhancers are distal sequences that increase the utilization of some promoters, and can function in either orientation and in any location (upstream or downstream) relative to the core promoter.
    GO:0000981    RNA polymerase II transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription by RNA polymerase II. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0033613    activating transcription factor binding    Interacting selectively and non-covalently with an activating transcription factor, any protein whose activity is required to initiate or upregulate transcription.
    GO:0035497    cAMP response element binding    Interacting selectively and non-covalently with the cyclic AMP response element (CRE), a short palindrome-containing sequence found in the promoters of genes whose expression is regulated in response to cyclic AMP.
    GO:0003682    chromatin binding    Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase.
    GO:0003690    double-stranded DNA binding    Interacting selectively and non-covalently with double-stranded DNA.
    GO:0019899    enzyme binding    Interacting selectively and non-covalently with any enzyme.
    GO:0042802    identical protein binding    Interacting selectively and non-covalently with an identical protein or proteins.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0046982    protein heterodimerization activity    Interacting selectively and non-covalently with a nonidentical protein to form a heterodimer.
    GO:0042803    protein homodimerization activity    Interacting selectively and non-covalently with an identical protein to form a homodimer.
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003713    transcription coactivator activity    Interacting selectively and non-covalently with a activating transcription factor and also with the basal transcription machinery in order to increase the frequency, rate or extent of transcription. Cofactors generally do not bind the template nucleic acid, but rather mediate protein-protein interactions between activating transcription factors and the basal transcription machinery.
    GO:0000982    transcription factor activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to modulate transcription by RNAP II.
    GO:0003705    transcription factor activity, RNA polymerase II distal enhancer sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in a distal enhancer region for RNA polymerase II (RNAP II) in order to modulate transcription by RNAP II.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0008134    transcription factor binding    Interacting selectively and non-covalently with a transcription factor, any protein required to initiate or regulate transcription.
    GO:0044212    transcription regulatory region DNA binding    Interacting selectively and non-covalently with a DNA region that regulates the transcription of a region of DNA, which may be a gene, cistron, or operon. Binding may occur as a sequence specific interaction or as an interaction observed only once a factor has been recruited to the DNA by other factors.
    GO:0001077    transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to activate or increase the frequency, rate or extent of transcription from the RNAP II promoter.
    GO:0001190    transcriptional activator activity, RNA polymerase II transcription factor binding    Interacting selectively and non-covalently with an RNA polymerase II transcription factor, which may be a single protein or a complex, in order to increase the frequency, rate or extent of transcription from an RNA polymerase II promoter. A protein binding transcription factor may or may not also interact with the template nucleic acid (either DNA or RNA) as well.
biological process
    GO:0038095    Fc-epsilon receptor signaling pathway    A series of molecular signals initiated by the binding of the Fc portion of immunoglobulin E (IgE) to an Fc-epsilon receptor on the surface of a signal-receiving cell, and ending with regulation of a downstream cellular process, e.g. transcription. The Fc portion of an immunoglobulin is its C-terminal constant region.
    GO:0007265    Ras protein signal transduction    A series of molecular signals within the cell that are mediated by a member of the Ras superfamily of proteins switching to a GTP-bound active state.
    GO:0007184    SMAD protein import into nucleus    The directed movement of a SMAD proteins from the cytoplasm into the nucleus. Pathway-restricted SMAD proteins and common-partner SMAD proteins are involved in the transforming growth factor beta receptor signaling pathways.
    GO:0060395    SMAD protein signal transduction    The cascade of processes by which a signal interacts with a receptor, causing a change in the activity of a SMAD protein, and ultimately effecting a change in the functioning of the cell.
    GO:0007568    aging    A developmental process that is a deterioration and loss of function over time. Aging includes loss of functions such as resistance to disease, homeostasis, and fertility, as well as wear and tear. Aging includes cellular senescence, but is more inclusive. May precede death and may succeed developmental maturation (GO:0021700).
    GO:0001525    angiogenesis    Blood vessel formation when new vessels emerge from the proliferation of pre-existing blood vessels.
    GO:0031103    axon regeneration    The regrowth of axons following their loss or damage.
    GO:0009987    cellular process    Any process that is carried out at the cellular level, but not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level.
    GO:0071277    cellular response to calcium ion    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a calcium ion stimulus.
    GO:0032870    cellular response to hormone stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a hormone stimulus.
    GO:0051365    cellular response to potassium ion starvation    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of potassium ions.
    GO:0007623    circadian rhythm    Any biological process in an organism that recurs with a regularity of approximately 24 hours.
    GO:0061029    eyelid development in camera-type eye    The progression of the eyelid in a camera-type eye from its formation to the mature state. The eyelid is a membranous cover that helps protect and lubricate the eye.
    GO:0035026    leading edge cell differentiation    The process in which relatively unspecialized cells acquire specialized structural and/or functional features of leading edge cells, cells at the front of a migrating epithelial sheet.
    GO:0007612    learning    Any process in an organism in which a relatively long-lasting adaptive behavioral change occurs as the result of experience.
    GO:0001889    liver development    The process whose specific outcome is the progression of the liver over time, from its formation to the mature structure. The liver is an exocrine gland which secretes bile and functions in metabolism of protein and carbohydrate and fat, synthesizes substances involved in the clotting of the blood, synthesizes vitamin A, detoxifies poisonous substances, stores glycogen, and breaks down worn-out erythrocytes.
    GO:0051899    membrane depolarization    The process in which membrane potential decreases with respect to its steady-state potential, usually from negative potential to a more positive potential. For example, the initial depolarization during the rising phase of an action potential is in the direction from the negative steady-state resting potential towards the positive membrane potential that will be the peak of the action potential.
    GO:0001774    microglial cell activation    The change in morphology and behavior of a microglial cell resulting from exposure to a cytokine, chemokine, cellular ligand, or soluble factor.
    GO:0030224    monocyte differentiation    The process in which a relatively unspecialized myeloid precursor cell acquires the specialized features of a monocyte.
    GO:0043922    negative regulation by host of viral transcription    Any process in which a host organism stops, prevents, or reduces the frequency, rate or extent of viral transcription.
    GO:0043392    negative regulation of DNA binding    Any process that stops or reduces the frequency, rate or extent of DNA binding. DNA binding is any process in which a gene product interacts selectively with DNA (deoxyribonucleic acid).
    GO:0043066    negative regulation of apoptotic process    Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process.
    GO:0008285    negative regulation of cell proliferation    Any process that stops, prevents or reduces the rate or extent of cell proliferation.
    GO:0043524    negative regulation of neuron apoptotic process    Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process in neurons.
    GO:0031953    negative regulation of protein autophosphorylation    Any process that stops, prevents or decreases the rate of the phosphorylation by a protein of one or more of its own residues.
    GO:1990441    negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress    Any process that stops, prevents, or reduces the frequency, rate or extent of transcription from an RNA polymerase II promoter as a result of an endoplasmic reticulum stress.
    GO:0045892    negative regulation of transcription, DNA-templated    Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0003151    outflow tract morphogenesis    The process in which the anatomical structures of the outflow tract are generated and organized. The outflow tract is the portion of the heart through which blood flows into the arteries.
    GO:0043923    positive regulation by host of viral transcription    Any process in which a host organism activates or increases the frequency, rate or extent of viral transcription, the synthesis of either RNA on a template of DNA or DNA on a template of RNA.
    GO:0045740    positive regulation of DNA replication    Any process that activates or increases the frequency, rate or extent of DNA replication.
    GO:2000144    positive regulation of DNA-templated transcription, initiation    Any process that activates or increases the frequency, rate or extent of DNA-templated transcription initiation.
    GO:0070374    positive regulation of ERK1 and ERK2 cascade    Any process that activates or increases the frequency, rate or extent of signal transduction mediated by the ERK1 and ERK2 cascade.
    GO:0043547    positive regulation of GTPase activity    Any process that activates or increases the activity of a GTPase.
    GO:0043065    positive regulation of apoptotic process    Any process that activates or increases the frequency, rate or extent of cell death by apoptotic process.
    GO:0045597    positive regulation of cell differentiation    Any process that activates or increases the frequency, rate or extent of cell differentiation.
    GO:0008284    positive regulation of cell proliferation    Any process that activates or increases the rate or extent of cell proliferation.
    GO:0001938    positive regulation of endothelial cell proliferation    Any process that activates or increases the rate or extent of endothelial cell proliferation.
    GO:0010634    positive regulation of epithelial cell migration    Any process that activates or increases the frequency, rate or extent of epithelial cell migration.
    GO:0048146    positive regulation of fibroblast proliferation    Any process that activates or increases the frequency, rate or extent of multiplication or reproduction of fibroblast cells.
    GO:0045657    positive regulation of monocyte differentiation    Any process that activates or increases the frequency, rate or extent of monocyte differentiation.
    GO:0043525    positive regulation of neuron apoptotic process    Any process that activates or increases the frequency, rate or extent of cell death of neurons by apoptotic process.
    GO:1902895    positive regulation of pri-miRNA transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of pri-miRNA transcription from RNA polymerase II promoter.
    GO:0048661    positive regulation of smooth muscle cell proliferation    Any process that activates or increases the rate or extent of smooth muscle cell proliferation.
    GO:0045944    positive regulation of transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0045893    positive regulation of transcription, DNA-templated    Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0051726    regulation of cell cycle    Any process that modulates the rate or extent of progression through the cell cycle.
    GO:0010941    regulation of cell death    Any process that modulates the rate or frequency of cell death. Cell death is the specific activation or halting of processes within a cell so that its vital functions markedly cease, rather than simply deteriorating gradually over time, which culminates in cell death.
    GO:0042127    regulation of cell proliferation    Any process that modulates the frequency, rate or extent of cell proliferation.
    GO:0051090    regulation of sequence-specific DNA binding transcription factor activity    Any process that modulates the frequency, rate or extent of the activity of a transcription factor, any factor involved in the initiation or regulation of transcription.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0001836    release of cytochrome c from mitochondria    The process that results in the movement of cytochrome c from the mitochondrial intermembrane space into the cytosol, which is part of the apoptotic signaling pathway and leads to caspase activation.
    GO:0051591    response to cAMP    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a cAMP (cyclic AMP, adenosine 3',5'-cyclophosphate) stimulus.
    GO:0034097    response to cytokine    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a cytokine stimulus.
    GO:0042493    response to drug    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a drug stimulus. A drug is a substance used in the diagnosis, treatment or prevention of a disease.
    GO:0042542    response to hydrogen peroxide    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a hydrogen peroxide (H2O2) stimulus.
    GO:0032496    response to lipopolysaccharide    Any process that results in a change in state or activity of an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a lipopolysaccharide stimulus; lipopolysaccharide is a major component of the cell wall of gram-negative bacteria.
    GO:0009612    response to mechanical stimulus    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a mechanical stimulus.
    GO:0035994    response to muscle stretch    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a myofibril being extended beyond its slack length.
    GO:0014070    response to organic cyclic compound    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic cyclic compound stimulus.
    GO:0010033    response to organic substance    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic substance stimulus.
    GO:0009314    response to radiation    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an electromagnetic radiation stimulus. Electromagnetic radiation is a propagating wave in space with electric and magnetic components. These components oscillate at right angles to each other and to the direction of propagation.
    GO:0006366    transcription from RNA polymerase II promoter    The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
    GO:0007179    transforming growth factor beta receptor signaling pathway    A series of molecular signals initiated by the binding of an extracellular ligand to a transforming growth factor beta receptor on the surface of a target cell, and ending with regulation of a downstream cellular process, e.g. transcription.
cellular component
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.
    GO:0000790    nuclear chromatin    The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome in the nucleus.
    GO:0000228    nuclear chromosome    A chromosome that encodes the nuclear genome and is found in the nucleus of a eukaryotic cell during the cell cycle phases when the nucleus is intact.
    GO:0005719    nuclear euchromatin    The dispersed less dense form of chromatin in the interphase nucleus. It exists in at least two forms, a some being in the form of transcriptionally active chromatin which is the least condensed, while the rest is inactive euchromatin which is more condensed than active chromatin but less condensed than heterochromatin.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
    GO:0005667    transcription factor complex    A protein complex that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription.
    GO:0017053    transcriptional repressor complex    A protein complex that possesses activity that prevents or downregulates transcription.

Chain N   (NFAC2_HUMAN | Q13469)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0000978    RNA polymerase II core promoter proximal region sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
    GO:0003682    chromatin binding    Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0008134    transcription factor binding    Interacting selectively and non-covalently with a transcription factor, any protein required to initiate or regulate transcription.
    GO:0044212    transcription regulatory region DNA binding    Interacting selectively and non-covalently with a DNA region that regulates the transcription of a region of DNA, which may be a gene, cistron, or operon. Binding may occur as a sequence specific interaction or as an interaction observed only once a factor has been recruited to the DNA by other factors.
    GO:0001077    transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to activate or increase the frequency, rate or extent of transcription from the RNAP II promoter.
    GO:0001078    transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to stop, prevent, or reduce the frequency, rate or extent of transcription from an RNA polymerase II promoter.
biological process
    GO:0050853    B cell receptor signaling pathway    A series of molecular signals initiated by the cross-linking of an antigen receptor on a B cell.
    GO:0038095    Fc-epsilon receptor signaling pathway    A series of molecular signals initiated by the binding of the Fc portion of immunoglobulin E (IgE) to an Fc-epsilon receptor on the surface of a signal-receiving cell, and ending with regulation of a downstream cellular process, e.g. transcription. The Fc portion of an immunoglobulin is its C-terminal constant region.
    GO:0033173    calcineurin-NFAT signaling cascade    Any intracellular signal transduction in which the signal is passed on within the cell by activation of a member of the NFAT protein family as a consequence of NFAT dephosphorylation by Ca(2+)-activated calcineurin. The cascade begins with calcium-dependent activation of the phosphatase calcineurin. Calcineurin dephosphorylates multiple phosphoserine residues on NFAT, resulting in the translocation of NFAT to the nucleus. The cascade ends with regulation of transcription by NFAT. The calcineurin-NFAT cascade lies downstream of many cell surface receptors, including G-protein coupled receptors (GPCRs) and receptor tyrosine kinases (RTKs) that signal to mobilize calcium ions (Ca2+).
    GO:0016477    cell migration    The controlled self-propelled movement of a cell from one site to a destination guided by molecular cues. Cell migration is a central process in the development and maintenance of multicellular organisms.
    GO:0006974    cellular response to DNA damage stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism.
    GO:0001816    cytokine production    The appearance of a cytokine due to biosynthesis or secretion following a cellular stimulus, resulting in an increase in its intracellular or extracellular levels.
    GO:0014904    myotube cell development    The process aimed at the progression of a myotube cell over time, from initial commitment of the cell to a specific fate, to the fully functional differentiated cell. Myotubes are multinucleated cells that are formed when proliferating myoblasts exit the cell cycle, differentiate and fuse.
    GO:0000122    negative regulation of transcription from RNA polymerase II promoter    Any process that stops, prevents, or reduces the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0030890    positive regulation of B cell proliferation    Any process that activates or increases the rate or extent of B cell proliferation.
    GO:0010628    positive regulation of gene expression    Any process that increases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form.
    GO:1901741    positive regulation of myoblast fusion    Any process that activates or increases the frequency, rate or extent of myoblast fusion.
    GO:0045944    positive regulation of transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0045893    positive regulation of transcription, DNA-templated    Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0042493    response to drug    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a drug stimulus. A drug is a substance used in the diagnosis, treatment or prevention of a disease.
    GO:0006366    transcription from RNA polymerase II promoter    The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0015629    actin cytoskeleton    The part of the cytoskeleton (the internal framework of a cell) composed of actin and associated proteins. Includes actin cytoskeleton-associated complexes.
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.
    GO:0030529    intracellular ribonucleoprotein complex    An intracellular macromolecular complex containing both protein and RNA molecules.
    GO:0044798    nuclear transcription factor complex    A protein complex, located in the nucleus, that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
    GO:0005886    plasma membrane    The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins.
    GO:0005667    transcription factor complex    A protein complex that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1a02)
 
  Sites
(no "Sites" information available for 1a02)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1a02)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1a02
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  FOS_HUMAN | P01100
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
  JUN_HUMAN | P05412
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
  NFAC2_HUMAN | Q13469
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  0026
    Age Related InformationGenAge
  0041
    Age Related InformationGenAge
  0050
    Age Related InformationGenAge
  0172
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  FOS_HUMAN | P01100
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  JUN_HUMAN | P05412
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  NFAC2_HUMAN | Q13469
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        FOS_HUMAN | P011001fos 1s9k
        JUN_HUMAN | P054121fos 1jnm 1jun 1s9k 1t2k 5t01
        NFAC2_HUMAN | Q134691owr 1p7h 1pzu 1s9k 2as5 2o93 3qrf

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1A02)