Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  PROTELOMERASE TELA MUTANT R255A COMPLEXED WITH CTTG HAIRPIN DNA
 
Authors :  K. Shi, H. Aihara
Date :  09 May 12  (Deposition) - 13 Jun 12  (Release) - 29 Aug 12  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.50
Chains :  Asym./Biol. Unit :  A,C
Keywords :  Recombination-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  W. M. Huang, J. Dagloria, H. Fox, Q. Ruan, J. Tillou, K. Shi, H. Aihara, J. Aron, S. Casjens
Linear Chromosome-Generating System Of Agrobacterium Tumefaciens C58: Protelomerase Generates And Protects Hairpin Ends.
J. Biol. Chem. V. 287 25551 2012
PubMed-ID: 22582388  |  Reference-DOI: 10.1074/JBC.M112.369488

(-) Compounds

Molecule 1 - PROTELOMERASE
    Chains: A
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Fragment: UNP RESIDUES 102-421
    Gene: TELA, ATU2523
    Mutation: YES
    Organism Scientific: AGROBACTERIUM TUMEFACIENS
    Organism Taxid: 176299
    Strain: C58/ATCC 33970
 
Molecule 2 - DNA HAIRPIN
    Chains: C
    Engineered: YES
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : AC

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 4F41)

(-) Sites  (0, 0)

(no "Site" information available for 4F41)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4F41)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 4F41)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4F41)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4F41)

(-) Exons   (0, 0)

(no "Exon" information available for 4F41)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:319
                                                                                                                                                                                                                                                                                                                                                               
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ......hhhhhhhhhh.........hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh...hhhhhh...hhhhhhhhhhhhhhhhhhhhhh.ee..hhhhhhhhhhhhhhh.hhhhhhhhhhhhhh.hhhhhhhh...eeeee..eeeeeeeee.................eeee...hhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhh............hhhhhhhhhhhhhhh.....hhhhhhhhhh.......hhhhhh..eehhhhhhhhhh.. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 4f41 A 103 YPKTGVATSIVEKIERAEFNTAGRKPTVLLRIADFIAAMNGMDAKQDMQALWDAEIAIMNGRAQTTIISYITKYRNAIREAFGDDHPMLKIATGDAAMYDEARRVKMEKIANKHGALITFENYRQVLKICEDCLKSSDPLMIGIGLIGMTGRAPYEVFTQAEFSPAPYGKGVSKWSILFNGQAKTKQGEGTKFGITYEIPVLTRSETVLAAYKRLRESGQGKLWHGMSIDDFSSETRLLLRDTVFNLFEDVWPKEELPKPYGLRHLYAEVAYHNFAPPHVTKNSYFAAILGHNNNDLETSLSYMTYTLPEDRDNALARL 421
                                   112       122       132       142       152       162       172       182       192       202       212       222       232       242       252       262       272       282       292       302       312       322       332       342       352       362       372       382       392       402       412         


Chain C from PDB  Type:DNA  Length:32
                                                                
                 4f41 C   1 CATAATAACAATATCTTGATATTGTTATTATG  32
                                    10        20        30
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4F41)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4F41)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4F41)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 4F41)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 4f41)
 
  Sites
(no "Sites" information available for 4f41)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4f41)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4f41
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  Q7CWV1_AGRFC | Q7CWV1
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/TrEMBL
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  Q7CWV1_AGRFC | Q7CWV1
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/TrEMBL
        Q7CWV1_AGRFC | Q7CWV1: 4dwp 4e0g 4e0j 4e0p 4e0y 4e0z 4e10 4f43

(-) Related Entries Specified in the PDB File

4f43