4CRX | PD0047 - JenaLib

Biol.Unit 1 - manually (Jmol Viewer)

Asymmetric Unit (Jmol Viewer)

Asym. Unit - sites (Jmol Viewer)

Biological Unit 1 (Jmol Viewer)

Biol. Unit 1 - sites (Jmol Viewer)

Title :   ASYMMETRIC DNA-BENDING IN THE CRE-LOXP SITE-SPECIFIC RECOMBINATION SYNAPSE

Authors :   F. Guo, D. N. Gopaul, G. D. Van Duyne

Date :   20 Apr 99 (Deposition) - 14 Jun 99 (Release) - 24 Feb 09 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   2.20

Chains :   Asym. Unit : A,B,C,D
Biol. Unit 1: A,B,C,D  (2x)

Keywords :   Cre Recombinase, Dna Bending, Recombination, Protein-Dna Interaction, Protein/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   F. Guo, D. N. Gopaul, G. D. Van Duyne
Asymmetric Dna Bending In The Cre-Loxp Site-Specific Recombination Synapse.
Proc. Natl. Acad. Sci. Usa V. 96 7143 1999
PubMed-ID: 10377382 | Reference-DOI: 10.1073/PNAS.96.13.7143
(for further references see the PDB file header)

Molecule 1 - DNA (35 NUCLEOTIDE CRE RECOGINITION SITE)
	Chains	:	C, D
	Engineered	:	YES
	Synthetic	:	YES

Molecule 2 - PROTEIN (CRE RECOMBINASE)
	Atcc	:	25404-B1
	Chains	:	A, B
	Collection	:	25404-B1
	Engineered	:	YES
	Expression System	:	ESCHERICHIA COLI BL21(DE3)
	Expression System Plasmid	:	PET21A
	Expression System Strain	:	BL21(DE3)
	Expression System Taxid	:	469008
	Mutation	:	YES
	Organism Scientific	:	ENTEROBACTERIA PHAGE P1
	Organism Taxid	:	10678

		1	2	3	4
Asymmetric Unit	:	A	B	C	D
Biological Unit 1 (2x)	:	A	B	C	D

Summary Information (see also Sequences/Alignments below)

(no "Ligand,Modified Residues,Ions" information available for 4CRX)

Asymmetric Unit (2, 2)

No.	Name	Evidence	Residues	Description
1	CAA	AUTHOR	LYS A:173 , HIS A:289 , ARG A:292 , TRP A:315 , TYR A:324	CATALYTIC SITE
2	CAB	AUTHOR	LYS B:173 , HIS B:289 , ARG B:292 , TRP B:315 , TYR B:324	CATALYTIC SITE

(no "SS Bond" information available for 4CRX)

Asymmetric Unit

No.	Residues
1	Phe A:64	-	Pro A:65
2	Phe B:64	-	Pro B:65

(no "SAP(SNP)/Variant" information available for 4CRX)

(no "PROSITE Motif" information available for 4CRX)

(no "Exon" information available for 4CRX)

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d4crxa1 A:20-129 Cre recombinase                                                                              d4crxa2 A:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 4crxA02 A:20-130  [code=1.10.150.130, no name defined]                                                         -4crxA01 A:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhh..hhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh....hhh.hhhhhhhhhhhhhhhh............hhhhhhhhhhh.....hhhhhhhhhhhhhhhh...hhhhhh..hhheee.....eeee.............eee..hhhhhhhhhhhhhh.hhh.........................hhhhhhhhhhhhhhhh................hhhhhhhhhhhhh...hhhhhhhh.....hhhhhhh...hhh..hhhhhh.. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 4crx A  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLKIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339

Chain B from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d4crxb1 B:20-129 Cre recombinase                                                                              d4crxb2 B:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 4crxB02 B:20-130  [code=1.10.150.130, no name defined]                                                         -4crxB01 B:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhh..hhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhh....hhh.hhhhhhhhhhhhhhhh............hhhhhhhhhhhhh...hhhhhhhhhhhhhhhh...hhhhhh..hhheee.....eeeee...........eeee..hhhhhhhhhhhhhh.hhh.........................hhhhhhhhhhhhhhhh................hhhhhhhhhhhhh...hhhhhhhh.....hhhhhhh...hhh..hhhhhh.. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 4crx B  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLKIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339

Chain C from PDB  Type:DNA  Length:35
                                                                   
                 4crx C   1 TATAACTTCGTATAGCATATGCTATACGAAGTTAT  35
                                    10        20        30

Chain D from PDB  Type:DNA  Length:35
                                                                   
                 4crx D   1 TATAACTTCGTATAGCATATGCTATACGAAGTTAT  35
                                    10        20        30

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Asymmetric Unit

Classes(

)

Architectures( (-)

)

Topologies( (-)

)

Homologous Superfamilies( (-)

)

Organisms( (-)

)

Class: Mainly Alpha (13335)

Architecture: Orthogonal Bundle (10391)

Topology: DNA polymerase; domain 1 (617)

Homologous Superfamily: [code=1.10.150.130, no name defined] (26)

[unclassified] (23)

1a	4crxA02	A:20-130
1b	4crxB02	B:20-130

Topology: hpI Integrase; Chain A (31)

Homologous Superfamily: Intergrase catalytic core (31)

[unclassified] (26)

2a	4crxA01	A:132-331
2b	4crxB01	B:132-331

(no "Pfam Domain" information available for 4CRX)

Asymmetric Unit(hide GO term definitions)

Chain A,B (RECR_BPP1 | P06956)

molecular function
	GO:0003677	DNA binding	Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
biological process
	GO:0015074	DNA integration	The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
	GO:0006310	DNA recombination	Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Intrachromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 4crx)

	Sites
		CAA	[ RasMol ]	+environment [ RasMol ]
		CAB	[ RasMol ]	+environment [ RasMol ]

	Cis Peptide Bonds
		Phe A:64 - Pro A:65	[ RasMol ]
		Phe B:64 - Pro B:65	[ RasMol ]

Biological Unit
	Complete Structure
		Biological Unit 1	[ Jena3D ]

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym. Unit PNG format \| Asym. Unit - sites PNG format \| Biol. Unit 1 PNG format \| Biol. Unit 1 - sites PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Access by PDB/NDB ID
	4crx
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	RECR_BPP1 \| P06956
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	RECR_BPP1 \| P06956
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)

(no "Related Entries Specified in the PDB File" available for 4CRX)

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (0, 0)

Sites (2, 2)

SS Bonds (0, 0)

Cis Peptide Bonds (2, 2)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (0, 0)

Exons (0, 0)

Sequences/Alignments

Classification and Annotation

SCOP Domains (2, 4)

CATH Domains (2, 4)

Pfam Domains (0, 0)

Gene Ontology (3, 3)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File