Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asymmetric Unit
(-)Biological Unit 1
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)

(-) Description

Title :  HIGH RESOLUTION STRUCTURE OF THE HOLLIDAY JUNCTION INTERMEDIATE IN CRE-LOXP SITE-SPECIFIC RECOMBINATION
 
Authors :  K. Ghosh, C. K. Lau, F. Guo, A. M. Segall, G. D. Van Duyne
Date :  05 Oct 04  (Deposition) - 14 Dec 04  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.00
Chains :  Asym. Unit :  A,B,C,D
Biol. Unit 1:  A,B,C,D  (2x)
Keywords :  Cre Recombinase, Holliday Junction, Recombination, Complex (Recombinase/Dna), Hydrolase, Ligase/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  K. Ghosh, C. K. Lau, F. Guo, A. M. Segall, G. D. Van Duyne
Peptide Trapping Of The Holliday Junction Intermediate In Cre-Loxp Site-Specific Recombination.
J. Biol. Chem. V. 280 8290 2005
PubMed-ID: 15591069  |  Reference-DOI: 10.1074/JBC.M411668200
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - LOXP
    ChainsC
    EngineeredYES
    Other DetailsPART OF HOLLIDAY JUNCTION
    SyntheticYES
 
Molecule 2 - LOXP
    ChainsD
    EngineeredYES
    Other DetailsPART OF HOLLIDAY JUNCTION
    SyntheticYES
 
Molecule 3 - RECOMBINASE CRE
    ChainsA, B
    EngineeredYES
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System StrainBL21(DE3)
    Expression System Taxid469008
    GeneCRE
    MutationYES
    Organism ScientificENTEROBACTERIA PHAGE P1
    Organism Taxid10678

 Structural Features

(-) Chains, Units

  1234
Asymmetric Unit ABCD
Biological Unit 1 (2x)ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1XO0)

(-) Sites  (0, 0)

(no "Site" information available for 1XO0)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1XO0)

(-) Cis Peptide Bonds  (2, 2)

Asymmetric Unit
No.Residues
1Phe A:64 -Pro A:65
2Phe B:64 -Pro B:65

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1XO0)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1XO0)

(-) Exons   (0, 0)

(no "Exon" information available for 1XO0)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1xo0a1 A:20-129 Cre recombinase                                                                              d1xo0a2 A:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 1xo0A01 A:20-130  [code=1.10.150.130, no name defined]                                                         -1xo0A02 A:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.eeeee..eeeeee...........eeeeehhhhhhhhhhhhhhhhhhhh.......ee.....ee.......hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhh..hhhhhhhhhh.....hhhhhh..hhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1xo0 A  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLKIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  

Chain B from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1xo0b1 B:20-129 Cre recombinase                                                                              d1xo0b2 B:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 1xo0B01 B:20-130  [code=1.10.150.130, no name defined]                                                         -1xo0B02 B:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
           Pfam domains (1) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1xo0B01 B:138-331                                                                                                                                                                 ---------- Pfam domains (1)
           Pfam domains (2) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1xo0B02 B:138-331                                                                                                                                                                 ---------- Pfam domains (2)
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.eee.....eeeee...........eeee.hhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhh...hhhhhhhhhh..hhhhhhhhhhhh.....hhhhhh.. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1xo0 B  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLKIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  

Chain C from PDB  Type:DNA  Length:35
                                                                   
                 1xo0 C   1 TATAACTTCGTATAATGTATGCTATACGAAGTTAT  35
                                    10        20        30     

Chain D from PDB  Type:DNA  Length:35
                                                                   
                 1xo0 D   1 TATAACTTCGTATAGCATACATTATACGAAGTTAT  35
                                    10        20        30     

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 4)

Asymmetric Unit

(-) CATH Domains  (2, 4)

Asymmetric Unit

(-) Pfam Domains  (1, 2)

Asymmetric Unit
(-)
Clan: DNA-mend (28)

(-) Gene Ontology  (3, 3)

Asymmetric Unit(hide GO term definitions)
Chain A,B   (RECR_BPP1 | P06956)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
biological process
    GO:0015074    DNA integration    The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Intrachromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1xo0)
 
  Sites
(no "Sites" information available for 1xo0)
 
  Cis Peptide Bonds
    Phe A:64 - Pro A:65   [ RasMol ]  
    Phe B:64 - Pro B:65   [ RasMol ]  
 
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1xo0
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  RECR_BPP1 | P06956
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  RECR_BPP1 | P06956
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        RECR_BPP1 | P069561crx 1drg 1f44 1kbu 1ma7 1nzb 1ouq 1pvp 1pvq 1pvr 1q3u 1q3v 1xns 2crx 2hof 2hoi 3c28 3c29 3crx 3mgv 4crx 5crx

(-) Related Entries Specified in the PDB File

1xns 2crx 3crx