3E2E - JenaLib

Asym./Biol. Unit - manually (Jmol Viewer)

Asym./Biol. Unit (Jmol Viewer)

Title :   CRYSTAL STRUCTURE OF AN INTERMEDIATE COMPLEX OF T7 RNAP AND 7NT OF RNA

Authors :   K. J. Durniak, S. Bailey, T. A. Steitz

Date :   05 Aug 08 (Deposition) - 04 Nov 08 (Release) - 13 Jul 11 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   3.00

Chains :   Asym./Biol. Unit : A,N,R,T

Keywords :   T7 Rna Polymerase, Dna-Directed Rna Polymerase, Transcription, Nucleotidyltransferase, Transferase, Transferase-Rna-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   K. J. Durniak, S. Bailey, T. A. Steitz
The Structure Of A Transcribing T7 Rna Polymerase In Transition From Initiation To Elongation
Science V. 322 553 2008
PubMed-ID: 18948533 | Reference-DOI: 10.1126/SCIENCE.1163433

Molecule 1 - DNA-DIRECTED RNA POLYMERASE
	Chains	:	A
	EC Number	:	2.7.7.6
	Engineered	:	YES
	Expression System	:	ESCHERICHIA COLI
	Expression System Plasmid	:	PBH161
	Expression System Strain	:	BL21(DE3)
	Expression System Taxid	:	562
	Expression System Vector Type	:	PLASMID
	Gene	:	1
	Mutation	:	YES
	Organism Scientific	:	BACTERIOPHAGE T7

*Molecule 2 - RNA (5'-R(GPGPGPAPGPUPG)-3')**
	Chains	:	R
	Engineered	:	YES
	Synthetic	:	YES

Molecule 3 - DNA (31-MER)
	Chains	:	T
	Engineered	:	YES
	Other Details	:	TEMPLATE DNA
	Synthetic	:	YES

Molecule 4 - DNA (28-MER)
	Chains	:	N
	Engineered	:	YES
	Other Details	:	NON-TEMPLATE DNA
	Synthetic	:	YES

		1	2	3	4
Asymmetric/Biological Unit	:	A	N	R	T

Summary Information (see also Sequences/Alignments below)

(no "Ligand,Modified Residues,Ions" information available for 3E2E)

(no "Site" information available for 3E2E)

(no "SS Bond" information available for 3E2E)

Asymmetric/Biological Unit

No.	Residues
1	Ser A:43	-	Tyr A:44
2	Lys A:53	-	Met A:54
3	Asn A:131	-	Thr A:132
4	Asn A:165	-	Val A:166
5	Lys A:180	-	Ala A:181
6	Glu A:222	-	Ser A:223
7	Ser A:223	-	Thr A:224
8	Thr A:224	-	Gly A:225
9	Ile A:264	-	Ser A:265
10	Ala A:354	-	Ile A:355
11	Pro A:361	-	Met A:362
12	Thr A:375	-	Ala A:376
13	Ala A:376	-	Trp A:377
14	Pro A:451	-	Ile A:452
15	Glu A:553	-	Val A:554
16	Val A:554	-	Gly A:555
17	Gly A:556	-	Arg A:557
18	Ile A:605	-	Ser A:606
19	Ala A:850	-	Asp A:851
20	Pro A:862	-	Ala A:863
21	Ala A:863	-	Leu A:864

(no "SAP(SNP)/Variant" information available for 3E2E)

Asymmetric/Biological Unit (2, 2)

	PROSITE			UniProtKB		PDB
No.	ID	AC	Description	ID	Location	Count	Location
1	RNA_POL_PHAGE_1	PS00900	Bacteriophage-type RNA polymerase family active site signature 1.	RPOL_BPT7	533-544	1	A:533-544
2	RNA_POL_PHAGE_2	PS00489	Bacteriophage-type RNA polymerase family active site signature 2.	RPOL_BPT7	625-639	1	A:625-639

(no "Exon" information available for 3E2E)

Asymmetric/Biological Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:PROTEIN  Length:832
 aligned with RPOL_BPT7 | P00573 from UniProtKB/Swiss-Prot  Length:883

    Alignment length:876
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257       267       277       287       297       307       317       327       337       347       357       367       377       387       397       407       417       427       437       447       457       467       477       487       497       507       517       527       537       547       557       567       577       587       597       607       617       627       637       647       657       667       677       687       697       707       717       727       737       747       757       767       777       787       797       807       817       827       837       847       857       867       877      
            RPOL_BPT7     8 KNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAIATRAGALAGISPMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA 883
               SCOP domains d3e2ea_ A: T7 RNA polymerase                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 SCOP domains
               CATH domains 3e2eA01 A:8-325 T7 RNA polymerase, domain 1                                                                                                                                                                                                                                                                                   3e2eA02 A:326-411  [code=1.10.287.260,    no name defined]                            ---------3e2eA03                      3e2eA04 A:450-527  [code=1.10.287.280, no name defined]                       3e2eA03                   3e2eA05 A:554-784 5' to 3' exonuclease, C-ter      minal subdomain                                                                                                                                                                     3e2eA03 A:421-449,A:528-553,A:785-872  [code=3.30.70.370, no name defined]              ----------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....---------------hhhhhhhhhhhhhhhhhhhhhhh....hhhhhhh...hhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhhhhhhh......-----------.........hhhhh.............hhhhhhhhhhhhhhhhh.....eeeeee........eeeeeehhhhhh..---------.................................ee..hhhhhhh.....hhhhhhhhhhhhh..eeehhhhhhhhhhhh......................---..hhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.........eeee....eee........hhhhhhheee.......hhhhhhhhhhhhhhh.....hhhhhhhhhhhh.hhhhhhhhh.....hhhhh.hhhhhhhhhhhhhhhhhhh........eeee..hhhhhhhhhhh..................hhhhhhhhhhhhhhhhhhhh....ee....------....ee.hhhhhhhhhhh...hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhh................eeee.....eeee......eee..eeehhheee..eee.......hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh......ee...eeeehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....................hhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------RNA_POL_PHAG--------------------------------------------------------------------------------RNA_POL_PHAGE_2---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 3e2e A   8 KNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFER---------------LITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNV-----------YKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAI---------ISLMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKP---DMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVT------ISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA 883
                                    17        27        37        47        57         -     |  77        87        97       107       117       127       137       147       157        |-         -|      187       197       207       217       227       237       247      |  -      |267       277       287       297       307       317       327       337       347       357      |  -|      377       387       397       407       417       427       437       447       457       467       477       487       497       507       517       527       537       547       557       567       577       587       597|      607       617       627       637       647       657       667       677       687       697       707       717       727       737       747       757       767       777       787       797       807       817       827       837       847       857       867       877      
                                                                            57              73                                                                                          166         178                                                                         254       264                                                                                                 364 368                                                                                                                                                                                                                                   598    605

Chain N from PDB  Type:DNA  Length:28
                                                            
                 3e2e N 101 TAATACGACTCACTTCTGGCGCACGGCT 133
                                   110  ||   125        
                                      113|              
                                       119

Chain R from PDB  Type:RNA  Length:7
                                       
                 3e2e R   1 GGGAGUG   7

Chain T from PDB  Type:DNA  Length:31
                                                               
                 3e2e T   1 AGCCGTGCGCACTCCCTAGTGAGTCGTATTA  33
                                    10     || 22        32 
                                          16|              
                                           19

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Asymmetric/Biological Unit

Classes(

)

Folds(

)

Superfamilies( (-)

)

Families(

)

Protein Domains( (-)

)

Organisms( (-)

)

Class: Multi-domain proteins (alpha and beta) (2421)

Fold: DNA/RNA polymerases (850)

Superfamily: DNA/RNA polymerases (850)

Family: T7 RNA polymerase (12)

Protein domain: T7 RNA polymerase (11)

Bacteriophage T7 [TaxId: 10760] (11)

d3e2ea_

(no "Pfam Domain" information available for 3E2E)

Asymmetric/Biological Unit(hide GO term definitions)

Chain A (RPOL_BPT7 | P00573)

molecular function
	GO:0003677	DNA binding	Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
	GO:0003899	DNA-directed 5'-3' RNA polymerase activity	Catalysis of the reaction: nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1). Utilizes a DNA template, i.e. the catalysis of DNA-template-directed extension of the 3'-end of an RNA strand by one nucleotide at a time. Can initiate a chain 'de novo'.
	GO:0016779	nucleotidyltransferase activity	Catalysis of the transfer of a nucleotidyl group to a reactant.
	GO:0016740	transferase activity	Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
	GO:0039695	DNA-templated viral transcription	A transcription process that uses a viral DNA as a template.
	GO:0006351	transcription, DNA-templated	The cellular synthesis of RNA on a template of DNA.

Asymmetric/Biological Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 3e2e)

	Sites
(no "Sites" information available for 3e2e)

	Cis Peptide Bonds
		Ala A:354 - Ile A:355	[ RasMol ]
		Ala A:376 - Trp A:377	[ RasMol ]
		Ala A:850 - Asp A:851	[ RasMol ]
		Ala A:863 - Leu A:864	[ RasMol ]
		Asn A:131 - Thr A:132	[ RasMol ]
		Asn A:165 - Val A:166	[ RasMol ]
		Glu A:222 - Ser A:223	[ RasMol ]
		Glu A:553 - Val A:554	[ RasMol ]
		Gly A:556 - Arg A:557	[ RasMol ]
		Ile A:264 - Ser A:265	[ RasMol ]
		Ile A:605 - Ser A:606	[ RasMol ]
		Lys A:180 - Ala A:181	[ RasMol ]
		Lys A:53 - Met A:54	[ RasMol ]
		Pro A:361 - Met A:362	[ RasMol ]
		Pro A:451 - Ile A:452	[ RasMol ]
		Pro A:862 - Ala A:863	[ RasMol ]
		Ser A:223 - Thr A:224	[ RasMol ]
		Ser A:43 - Tyr A:44	[ RasMol ]
		Thr A:224 - Gly A:225	[ RasMol ]
		Thr A:375 - Ala A:376	[ RasMol ]
		Val A:554 - Gly A:555	[ RasMol ]

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym./Biol. Unit PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Access by PDB/NDB ID
	3e2e
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	RPOL_BPT7 \| P00573
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	2.7.7.6
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	RPOL_BPT7 \| P00573
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)

UniProtKB/Swiss-Prot
	RPOL_BPT7 \| P00573	:	1aro 1cez 1h38 1msw 1qln 1s0v 1s76 1s77 2pi4 2pi5 3e3j 4rnp

3e3j	CRYSTAL STRUCTURE OF AN INTERMEDIATE COMPLEX OF T7 RNAP AND 8NT OF RNA

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (0, 0)

Sites (0, 0)

SS Bonds (0, 0)

Cis Peptide Bonds (21, 21)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (2, 2)

Exons (0, 0)

Sequences/Alignments

Classification and Annotation

SCOP Domains (1, 1)

CATH Domains (5, 5)

Pfam Domains (0, 0)

Gene Ontology (6, 6)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File