Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  STRUCTURE OF THE E. COLI SIGNAL REGOGNITION PARTICLE
 
Authors :  C. Schaffitzel, M. Oswald, I. Berger, T. Ishikawa, J. P. Abrahams, H. K. R. I. Koning, N. Ban
Date :  12 Jul 06  (Deposition) - 02 Nov 06  (Release) - 15 Mar 17  (Revision)
Method :  ELECTRON MICROSCOPY
Resolution :  16.00
Chains :  Asym./Biol. Unit :  A,B,C
Keywords :  Rna-Binding, Rna-Binding Protein Complex, Signal Recognition Particle (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  C. Schaffitzel, M. Oswald, I. Berger, T. Ishikawa, J. P. Abrahams, H. K. Koerten, R. I. Koning, N. Ban
Structure Of The E. Coli Signal Recognition Particle Bound To A Translating Ribosome
Nature V. 444 503 2006
PubMed-ID: 17086205  |  Reference-DOI: 10.1038/NATURE05182

(-) Compounds

Molecule 1 - SIGNAL RECOGNITION PARTICLE PROTEIN,SIGNAL RECOGNITION PARTICLE 54 KDA PROTEIN
    Chains: A
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PET24A_FFH
    Expression System Strain: BL21(DE3)
    Expression System Taxid: 469008
    Gene: FFH, SRP54, SULA_1982, SULB_1983, SULC_1981
    Organism Scientific: THERMUS AQUATICUS, SULFOLOBUS SOLFATARICUS
    Organism Taxid: 271, 2287
    Synonym: FIFTY-FOUR HOMOLOG,SRP54
 
Molecule 2 - 4.5S RNA
    Chains: B
    Engineered: YES
    Organism Scientific: ESCHERICHIA COLI
    Organism Taxid: 562
    Synthetic: YES
 
Molecule 3 - SIGNAL SEQUENCE
    Chains: C
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  123
Asymmetric/Biological Unit : ABC

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 2IY3)

(-) Sites  (0, 0)

(no "Site" information available for 2IY3)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 2IY3)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 2IY3)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 2IY3)

(-) PROSITE Motifs  (1, 1)

Asymmetric/Biological Unit (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1SRP54PS00300 SRP54-type proteins GTP-binding domain signature.SRP54_THEAQ266-279  1A:266-279

(-) Exons   (0, 0)

(no "Exon" information available for 2IY3)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:432
 aligned with SRP54_THEAQ | O07347 from UniProtKB/Swiss-Prot  Length:430

    Alignment length:432
                                                                                                                                                                                                                                                                                                                                                                                                        352                                                                 
                                                                                                                                                                                                                                                                                                                                                               319                                   351  |                                                                 
                                                                                                                                                                                                                                                                                                                                          305    306         318 |                          348    349 |  |                                                                 
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300    |    - |     314   | | 323       333       343    |    - | |  |355       365       375       385       395       405       415  
          SRP54_THEAQ     1 MFQQLSARLQEAIGRLRGRGRITEEDLKATLREIRRALMDADVNLEVARDFVERVREEALGKQVLESLTPAEVILATVYEALKEALGGEARLPVLKDRNLWFLVGLQGSGKTTTAAKLALYYKGKGRRPLLVAADTQRPAAREQLRLLGEKVGVPVLEVMDGESPESIRRRVEEKARLEARDLILVDTAGRLQIDEPLMGELARLKEVLGPDEVLLVLDAMTGQEALSVARAFDEKVGVTGLVLTKLDGDARGGAALSARHVTGKPIYFAGVSEKPEGLEPFYPERLAGRILGMGDVASLAEKVR------AAGLEAEAPKSAK-ELSLEDFLKQMQNLKRLGPFSEILGLLPGV------PQG--LKVDEKAIKRLEAIVLSMTPEERKDPRILNGSRRKRIAKGSGTSVQEVNRFIKAFEEMKALMKSLE 417
               SCOP domains d2iy3a1 A:1-88 Signal sequence recognition protein Ffh                                  d2iy3a2 A:89-305 GTPase domain of the signal sequence recognition protein Ffh                                                                                                                                            ------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ................................................................................................................................................................................................................................................................................................................................................................................................................................................ Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------SRP54         --------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 2iy3 A   1 MFQQLSARLQEAIGRLRGRGRITEEDLKATLREIRRALMDADVNLEVARDFVERVREEALGKQVLESLTPAEVILATVYEALKEALGGEARLPVLKDRNLWFLVGLQGSGKTTTAAKLALYYKGKGRRPLLVAADTQRPAAREQLRLLGEKVGVPVLEVMDGESPESIRRRVEEKARLEARDLILVDTAGRLQIDEPLMGELARLKEVLGPDEVLLVLDAMTGQEALSVARAFDEKVGVTGLVLTKLDGDARGGAALSARHVTGKPIYFAGVSEKPEGLEPFYPERLAGRILGMGDIESILEKVKGLEEYDKIQKKMEDVMEGKGKLTLRDVYAQIIALRKMGPLSKVLQHIPGLGIMLPTPSEDQLKIGEEKIRRWLAALNSMTYKELENPNIIDKSRMRRIAEGSGLEVEEVRELLEWYNNMNRLLKMVK 432
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430  


Chain B from PDB  Type:RNA  Length:110
                                                                                                                                              
                 2iy3 B   1 GGGGGCUCUGUUGGUUCUCCCGCAACGCUACUCUGUUUACCAGGUCAGGUCCGAAAGGAAGCAGCCAAGGCAGAUGACGCGUGUGCCGGGAUGUAGCUGGCAGGGCCCCC 110
                                    10        20        30        40        50        60        70        80        90       100       110


Chain C from PDB  Type:PROTEIN  Length:17
                                                 
               SCOP domains ----------------- SCOP domains
               CATH domains ----------------- CATH domains
               Pfam domains ----------------- Pfam domains
         Sec.struct. author ................. Sec.struct. author
                 SAPs(SNPs) ----------------- SAPs(SNPs)
                    PROSITE ----------------- PROSITE
                 Transcript ----------------- Transcript
                 2iy3 C 450 AALALAAAAALALAAAG 466
                                   459
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 2)

Asymmetric/Biological Unit
(-)
Class: All alpha proteins (14657)
(-)
Class: Alpha and beta proteins (a/b) (23833)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 2IY3)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 2IY3)

(-) Gene Ontology  (11, 21)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (SRP54_THEAQ | O07347)
molecular function
    GO:0008312    7S RNA binding    Interacting selectively and non-covalently with 7S RNA, the RNA component of the signal recognition particle (SRP).
    GO:0005525    GTP binding    Interacting selectively and non-covalently with GTP, guanosine triphosphate.
    GO:0003924    GTPase activity    Catalysis of the reaction: GTP + H2O = GDP + phosphate.
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
biological process
    GO:0006614    SRP-dependent cotranslational protein targeting to membrane    The targeting of proteins to a membrane that occurs during translation and is dependent upon two key components, the signal-recognition particle (SRP) and the SRP receptor. SRP is a cytosolic particle that transiently binds to the endoplasmic reticulum (ER) signal sequence in a nascent protein, to the large ribosomal unit, and to the SRP receptor in the ER membrane.
    GO:0006612    protein targeting to membrane    The process of directing proteins towards a membrane, usually using signals contained within the protein.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0030529    intracellular ribonucleoprotein complex    An intracellular macromolecular complex containing both protein and RNA molecules.
    GO:0048500    signal recognition particle    A complex of protein and RNA which facilitates translocation of proteins across membranes.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 2iy3)
 
  Sites
(no "Sites" information available for 2iy3)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 2iy3)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  2iy3
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  SRP54_SULSO | Q97ZE7
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
  SRP54_THEAQ | O07347
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  SRP54_SULSO | Q97ZE7
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  SRP54_THEAQ | O07347
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        SRP54_SULSO | Q97ZE7: 1qzw 1qzx 3kl4 3zn8 5l3s 5l3v
        SRP54_THEAQ | O07347: 1ffh 1jpj 1jpn 1ls1 1ng1 1o87 1okk 1rj9 1ry1 2c03 2c04 2cnw 2ffh 2j45 2j46 2j7p 2ng1 2xkv 3ng1 3zn8

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 2IY3)