Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF UVRD-DNA-ADPNP TERNARY COMPLEX
 
Authors :  W. Yang, J. Y. Lee
Date :  16 Oct 06  (Deposition) - 09 Jan 07  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.60
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Dna Helicase, Hydrolase/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  J. Y. Lee, W. Yang
Uvrd Helicase Unwinds Dna One Base Pair At A Time By A Two-Part Power Stroke.
Cell(Cambridge, Mass. ) V. 127 1349 2006
PubMed-ID: 17190599  |  Reference-DOI: 10.1016/J.CELL.2006.10.049
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - 25-MER
    Chains: C, D
    Engineered: YES
    Synthetic: YES
 
Molecule 2 - DNA HELICASE II
    Chains: A, B
    EC Number: 3.6.1.-
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Gene: UVRD
    Mutation: YES
    Organism Scientific: ESCHERICHIA COLI
    Organism Taxid: 562

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 4)

Asymmetric/Biological Unit (2, 4)
No.NameCountTypeFull Name
1ANP2Ligand/IonPHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER
2MG2Ligand/IonMAGNESIUM ION

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
No.NameEvidenceResiduesDescription
1AC1SOFTWARETHR A:36 , GLU A:221 , ANP A:700 , HOH A:1002 , HOH A:1003 , HOH A:1004BINDING SITE FOR RESIDUE MG A 1001
2AC2SOFTWARETHR B:36 , GLU B:221 , ANP B:701 , HOH B:1003 , HOH B:1004 , HOH B:1005BINDING SITE FOR RESIDUE MG B 1002
3AC3SOFTWARESER A:9 , GLN A:14 , ALA A:31 , GLY A:32 , SER A:33 , GLY A:34 , LYS A:35 , THR A:36 , ARG A:37 , ARG A:73 , GLU A:221 , GLN A:251 , TYR A:283 , ARG A:284 , GLY A:564 , GLU A:566 , ARG A:605 , MG A:1001 , HOH A:1002 , HOH A:1003 , HOH A:1004 , HOH A:1063BINDING SITE FOR RESIDUE ANP A 700
4AC4SOFTWARESER B:9 , GLN B:14 , ALA B:31 , GLY B:32 , SER B:33 , GLY B:34 , LYS B:35 , THR B:36 , ARG B:37 , ARG B:73 , GLU B:221 , GLN B:251 , TYR B:283 , ARG B:284 , GLY B:564 , GLU B:566 , ARG B:605 , MG B:1002 , HOH B:1003 , HOH B:1004 , HOH B:1058BINDING SITE FOR RESIDUE ANP B 701

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 2IS4)

(-) Cis Peptide Bonds  (4, 4)

Asymmetric/Biological Unit
No.Residues
1Thr A:413 -Pro A:414
2Phe A:580 -Pro A:581
3Thr B:413 -Pro B:414
4Phe B:580 -Pro B:581

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 2IS4)

(-) PROSITE Motifs  (2, 4)

Asymmetric/Biological Unit (2, 4)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1UVRD_HELICASE_ATP_BINDPS51198 UvrD-like DNA helicase ATP-binding domain profile.UVRD_ECOLI8-286
 		  2A:8-286
B:8-286
2UVRD_HELICASE_CTERPS51217 UvrD-like DNA helicase C-terminal domain profile.UVRD_ECOLI287-564
 		  2A:287-564
B:287-564

(-) Exons   (0, 0)

(no "Exon" information available for 2IS4)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:646
 aligned with UVRD_ECOLI | P03018 from UniProtKB/Swiss-Prot  Length:720

    Alignment length:662
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660  
           UVRD_ECOLI     1 MDVSYLLDSLNDKQREAVAAPRSNLLVLAGAGSGKTRVLVHRIAWLMSVENCSPYSIMAVTFTNKAAAEMRHRIGQLMGTSQGGMWVGTFHGLAHRLLRAHHMDANLPQDFQILDSEDQLRLLKRLIKAMNLDEKQWPPRQAMWYINSQKDEGLRPHHIQSYGNPVEQTWQKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPHILQHYRERFTNILVDEFQDTNNIQYAWIRLLAGDTGKVMIVGDDDQSIYGWRGAQVENIQRFLNDFPGAETIRLEQNYRSTSNILSAANALIENNNGRLGKKLWTDGADGEPISLYCAFNELDEARFVVNRIKTWQDNGGALAECAILYRSNAQSRVLEEALLQASMPYRIYGGMRFFERQEIKDALSYLRLIANRNDDAAFERVVNTPTRGIGDRTLDVVRQTSRDRQLTLWQACRELLQEKALAGRAASALQRFMELIDALAQETADMPLHVQTDRVIKDSGLRTMYEQEKGEKGQTRIENLEELVTATRQFSYNEEDEDLMPLQAFLSHAALEAGEGQADTWQDAVQLMTLHSAKGLEFPQVFIVGMEEGMFPSQMSLDEGGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPEECVEEVRLRATVSRPVSHQRMGTP 662
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains 2is4A01 A:1-110,A:190-279 P-loop containing nucleotide triphosphate hydrolases                                2is4A02 A:111-189  [code=1.10.10.160, no name defi   ned]                      2is4A01 A:1-110,A:190-279 P-loop containing nucleotide triphosphate hydrolases            2is4A03 A:280-381,A:543-662 P-loop containing nucleotide triphosphate hydrolases                      2is4A04 A:382-542 PCRA; domain 4                                                                                                                                 2i    s4A03 A:280-381,A:543-662 P-loop containing nucleotide triphosphate hydrolases                                     CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhh.hhhhhhhhh.....eeee.....hhhhhhhhhhhhhhhh...hhh.eeeee.hhhhhhhhhhhhhhhh.......eeeehhhhhhhhhhhhhhhhh.....eeehhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhh........---hhhhhhhhhhhhhhhhhhhhhheeehhhhhhhhhhhhhhhhhhhhhhhhhh.eeee.hhhhhhhhhhhhhhhhhh...eeeeeehhhhh.hhhhh...hhhhhhhhhh...eeee.......hhhhhhhhhhhhh...................eeeeee.hhhhhhhhhhhhhhhhhh...hhh.eeeee.hhhhhhhhhhhhhhh...eee........hhhhhhhhhhhhhhh...hhhhhhhhhh......hhhhhhhhhhhhhh.....hhhhhhh......hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhh.hhhhhh......hhhhhhhhhhhhhhhhhh.---------hhhhhhhhhhhhhh..----.....eeeeehhhhh...eeeeee.........hhhhhhh.hhhhhhhhhhhhhhh.eeeeeeeeee..ee....ee....hhhhhhhhhh.eee................... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------UVRD_HELICASE_ATP_BIND  PDB: A:8-286 UniProt: 8-286                                                                                                                                                                                                                                    UVRD_HELICASE_CTER  PDB: A:287-564 UniProt: 287-564                                                                                                                                                                                                                                   -------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 2is4 A   1 MDVSYLLDSLNDKQREAVAAPRSNLLVLAGAGSGKTRVLVHRIAWLMSVENCSPYSIMAVTFTNKAAAEMRHRIGQLMGTSQGGMWVGTFHGLAHRLLRAHHMDANLPQDFQILDSEDQLRLLKRLIKAMNLDEKQWPPRQAMWYINSQKDEGLRPHHIQ---NPVEQTWQKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPHILQHYRERFTNILVDEFQDTNNIQYAWIRLLAGDTGKVMIVGDDDQSIYGWRGAQVENIQRFLNDFPGAETIRLEQNYRSTSNILSAANALIENNNGRLGKKLWTDGADGEPISLYCAFNELDEARFVVNRIKTWQDNGGALAECAILYRSNAQSRVLEEALLQASMPYRIYGGMRFFERQEIKDALSYLRLIVNRNDDAAFERVVNTPTRGIGDRTLDVVRQTSRDRQLTLWQACRELLQEKALAGRAASALQRFMELIDALAQETADMPLHVQTDRVIKDSGLRTMYEQEKGEKGQTRIENLEELVTATRQF---------MPLQAFLSHAALEAGE----TWQDAVQLMTLHSAKGLEFPQVFIVGMEEGMFPSQMSLDEGGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPEECVEEVRLRATVSRPVSHQRMGTP 662
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160   |   170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510        |-       530       540   |   550       560       570       580       590       600       610       620       630       640       650       660  
                                                                                                                                                                                         160 164                                                                                                                                                                                                                                                                                                                                                                519       529            544  549                                                                                                                 


Chain B from PDB  Type:PROTEIN  Length:632
 aligned with UVRD_ECOLI | P03018 from UniProtKB/Swiss-Prot  Length:720

    Alignment length:658
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650        
           UVRD_ECOLI     1 MDVSYLLDSLNDKQREAVAAPRSNLLVLAGAGSGKTRVLVHRIAWLMSVENCSPYSIMAVTFTNKAAAEMRHRIGQLMGTSQGGMWVGTFHGLAHRLLRAHHMDANLPQDFQILDSEDQLRLLKRLIKAMNLDEKQWPPRQAMWYINSQKDEGLRPHHIQSYGNPVEQTWQKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPHILQHYRERFTNILVDEFQDTNNIQYAWIRLLAGDTGKVMIVGDDDQSIYGWRGAQVENIQRFLNDFPGAETIRLEQNYRSTSNILSAANALIENNNGRLGKKLWTDGADGEPISLYCAFNELDEARFVVNRIKTWQDNGGALAECAILYRSNAQSRVLEEALLQASMPYRIYGGMRFFERQEIKDALSYLRLIANRNDDAAFERVVNTPTRGIGDRTLDVVRQTSRDRQLTLWQACRELLQEKALAGRAASALQRFMELIDALAQETADMPLHVQTDRVIKDSGLRTMYEQEKGEKGQTRIENLEELVTATRQFSYNEEDEDLMPLQAFLSHAALEAGEGQADTWQDAVQLMTLHSAKGLEFPQVFIVGMEEGMFPSQMSLDEGGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPEECVEEVRLRATVSRPVSHQR 658
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains 2is4B01 B:1-110,B:190-279 P-loop containing nucleotide triphosphate hydrolases                                2is4B02 B:111-189  [code=1.10.10.160, no name def   ined]                      2is4B01 B:1-110,B:190-279 P-loop containing nucleotide triphosphate hydrolases            2is4B03 B:280-381,B:548-658 P-loop containing nucleotide triphosphate hydrolases                      2is4B04 B:382-538 PCRA; domain 4                                                                                                                                      2is4B03 B:280-381,B:548-658 P-loop containing nucleotide triphosphate hydrolases                                CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhh..hhhhhhhhh.....eeee.....hhhhhhhhhhhhhhhh...hhh.eeeee.hhhhhhhhhhhhhhhhh......eeeehhhhhhhhhhh...........eeehhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhh.......---......hhhhhhhhhhhhhhhhheeehhhhhhhhhhhhhhhhhhhhhhhhhh.eeee.hhhhhhhhhhhhhhhhhh...eeeeeehhhhh.hhhhh...hhhhhhhhhh...eeee.......hhhhhhhhhhhhh...................eeeeeeeehhhhhhhhhhhhhhhhhh..hhh.eeeee.hhhhhhhhhhhhhh....eee....hhhhhhhhhhhhhhhhhhhh..hhhhhhhhh.......hhhhhhhhhhhhhhhh.hhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhh...---hhhhhhhhhhhhhhhh..-------.hhhhhhhh..---------......eeeeehhhhh...eeeeee.........hhhhhhh..hhhhhhhhhhhhhhheeeeeeeeeeeeee....ee....hhhhhh.hhh.eee....--.....--.. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------UVRD_HELICASE_ATP_BIND  PDB: B:8-286 UniProt: 8-286                                                                                                                                                                                                                                    UVRD_HELICASE_CTER  PDB: B:287-564 UniProt: 287-564                                                                                                                                                                                                                                   ---------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 2is4 B   1 MDVSYLLDSLNDKQREAVAAPRSNLLVLAGAGSGKTRVLVHRIAWLMSVENCSPYSIMAVTFTNKAAAEMRHRIGQLMGTSQGGMWVGTFHGLAHRLLRAHHMDANLPQDFQILDSEDQLRLLKRLIKAMNLDEKQWPPRQAMWYINSQKDEGLRPHHI---GNPVEQTWQKVYQAYQEACDRAGLVDFAELLLRAHELWLNKPHILQHYRERFTNILVDEFQDTNNIQYAWIRLLAGDTGKVMIVGDDDQSIYGWRGAQVENIQRFLNDFPGAETIRLEQNYRSTSNILSAANALIENNNGRLGKKLWTDGADGEPISLYCAFNELDEARFVVNRIKTWQDNGGALAECAILYRSNAQSRVLEEALLQASMPYRIYGGMRFFERQEIKDALSYLRLIVNRNDDAAFERVVNTPTRGIGDRTLDVVRQTSRDRQLTLWQACRELLQEKALAGRAASALQRFMELIDALAQETADMPLHVQTDRVIKDSGLRTMYEQEKG---QTRIENLEELVTATRQFS-------LMPLQAFLSHA---------DTWQDAVQLMTLHSAKGLEFPQVFIVGMEEGMFPSQMSLDEGGRLEEERRLAYVGVTRAMQKLTLTYAETRRLYGKEVYHRPSRFIGELPEECVEEVRLR--VSRPV--QR 658
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150        |-  |    170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490        |-  |    510       520       530       | -       550       560       570       580       590       600       610       620       630       640      |650   |  | 
                                                                                                                                                                                        159 163                                                                                                                                                                                                                                                                                                                                             499 503              520     528       538       548                                                                                                647  | 654  | 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   650    657 


Chain C from PDB  Type:DNA  Length:25
                                                         
                 2is4 C   1 TCGAGCACTGCAGTGCTCGTGTTTA  26
                                    10        20|    
                                              20|    
                                               22    


Chain D from PDB  Type:DNA  Length:25
                                                         
                 2is4 D   2 CGAGCACTGCAGTGCTCGTTGTTTA  26
                                    11        21
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 2IS4)

(-) CATH Domains  (3, 8)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)
(-)
Architecture: 3-Layer(aba) Sandwich (12045)
(-)
Topology: Rossmann fold (7312)
(-)
Homologous Superfamily: P-loop containing nucleotide triphosphate hydrolases (1378)
(-)
[unclassified] (24)
1a2is4A03A:280-381,A:543-662
1b2is4B03B:280-381,B:548-658
1c2is4A01A:1-110,A:190-279
1d2is4B01B:1-110,B:190-279
(-)
Class: Mainly Alpha (13335)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 2IS4)

(-) Gene Ontology  (23, 23)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (UVRD_ECOLI | P03018)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0004003    ATP-dependent DNA helicase activity    Catalysis of the reaction: ATP + H2O = ADP + phosphate; this reaction drives the unwinding of the DNA helix.
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003678    DNA helicase activity    Catalysis of the reaction: NTP + H2O = NDP + phosphate, to drive the unwinding of a DNA helix.
    GO:0015616    DNA translocase activity    Catalysis of the reaction: ATP + H2O = ADP + phosphate, to drive movement along a single- or double-stranded DNA molecule.
    GO:0004386    helicase activity    Catalysis of the reaction: NTP + H2O = NDP + phosphate, to drive the unwinding of a DNA or RNA helix.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0017116    single-stranded DNA-dependent ATP-dependent DNA helicase activity    Catalysis of the reaction: ATP + H2O = ADP + phosphate, in the presence of single-stranded DNA; drives the unwinding of a DNA helix.
biological process
    GO:0032508    DNA duplex unwinding    The process in which interchain hydrogen bonds between two strands of DNA are broken or 'melted', generating a region of unpaired single strands.
    GO:0006281    DNA repair    The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway.
    GO:0006260    DNA replication    The cellular metabolic process in which a cell duplicates one or more molecules of DNA. DNA replication begins when specific sequences, known as origins of replication, are recognized and bound by initiation proteins, and ends when the original DNA molecule has been completely duplicated and the copies topologically separated. The unit of replication usually corresponds to the genome of the cell, an organelle, or a virus. The template for replication can either be an existing DNA molecule or RNA.
    GO:0006268    DNA unwinding involved in DNA replication    The process in which interchain hydrogen bonds between two strands of DNA are broken or 'melted', generating unpaired template strands for DNA replication.
    GO:0009432    SOS response    An error-prone process for repairing damaged microbial DNA.
    GO:0006974    cellular response to DNA damage stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism.
    GO:0006298    mismatch repair    A system for the correction of errors in which an incorrect base, which cannot form hydrogen bonds with the corresponding base in the parent strand, is incorporated into the daughter strand. The mismatch repair system promotes genomic fidelity by repairing base-base mismatches, insertion-deletion loops and heterologies generated during DNA replication and recombination.
    GO:0006289    nucleotide-excision repair    A DNA repair process in which a small region of the strand surrounding the damage is removed from the DNA helix as an oligonucleotide. The small gap left in the DNA helix is filled in by the sequential action of DNA polymerase and DNA ligase. Nucleotide excision repair recognizes a wide range of substrates, including damage caused by UV irradiation (pyrimidine dimers and 6-4 photoproducts) and chemicals (intrastrand cross-links and bulky adducts).
    GO:0051260    protein homooligomerization    The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of identical component monomers. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer.
    GO:0031297    replication fork processing    The process in which a DNA replication fork that has stalled is restored to a functional state and replication is restarted. The stalling may be due to DNA damage, DNA secondary structure, bound proteins, dNTP shortage, or other causes.
    GO:0070581    rolling circle DNA replication    A DNA-dependent DNA replication process in which a single-stranded DNA molecule is synthesized from a circular duplex template. Replication typically does not cease when one circumference has been replicated, but continues around the circumference several more times, producing a long single strand comprising multimers of the replicon.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0005829    cytosol    The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ANP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Phe A:580 - Pro A:581   [ RasMol ]  
    Phe B:580 - Pro B:581   [ RasMol ]  
    Thr A:413 - Pro A:414   [ RasMol ]  
    Thr B:413 - Pro B:414   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  2is4
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  UVRD_ECOLI | P03018
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.6.1.-
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  UVRD_ECOLI | P03018
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        UVRD_ECOLI | P03018: 2is1 2is2 2is6 3lfu

(-) Related Entries Specified in the PDB File

2is1 2is2