Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  STRUCTURE OF RESTRICTION ENDONUCLEASE FOKI BOUND TO DNA
 
Authors :  D. A. Aggarwal, J. A. Wah, L. F. Hirsch, I. Dorner, A. K. Schildkraut
Date :  18 Apr 97  (Deposition) - 03 Dec 97  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.80
Chains :  Asym./Biol. Unit :  A,B,C
Keywords :  Complex (Endonuclease/Dna), Type Iis, Restriction Endonuclease, Deoxyribonuclease, Dna Hydrolysis, Dna Cleavage, Hydrolase/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  D. A. Wah, J. A. Hirsch, L. F. Dorner, I. Schildkraut, A. K. Aggarwal
Structure Of The Multimodular Endonuclease Foki Bound To Dna.
Nature V. 388 97 1997
PubMed-ID: 9214510  |  Reference-DOI: 10.1038/40446
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - DNA (5'- D(*TP*CP*GP*GP*AP*TP*GP*AP*TP*AP*AP*CP*GP*CP*TP*AP*G P*TP*CP*A)-3')
    Atcc33414
    ChainsB
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    GeneFOKI
    Organism ScientificPLANOMICROBIUM OKEANOKOITES
    Organism Taxid244
    StrainIFO12536
    SynonymR.FOKI
 
Molecule 2 - DNA (5'- D(*AP*TP*GP*AP*CP*TP*AP*GP*CP*GP*TP*TP*AP*TP*CP*AP*T P*CP*CP*G)-3')
    ChainsC
    EngineeredYES
 
Molecule 3 - PROTEIN (FOKI RESTRICTION ENDONUCLEAS)
    ChainsA
    EngineeredYES
    Organism ScientificPLANOMICROBIUM OKEANOKOITES
    Organism Taxid244

 Structural Features

(-) Chains, Units

  123
Asymmetric/Biological Unit ABC

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1FOK)

(-) Sites  (0, 0)

(no "Site" information available for 1FOK)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1FOK)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1FOK)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1FOK)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1FOK)

(-) Exons   (0, 0)

(no "Exon" information available for 1FOK)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:568
 aligned with T2F1_PLAOK | P14870 from UniProtKB/Swiss-Prot  Length:583

    Alignment length:576
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257       267       277       287       297       307       317       327       337       347       357       367       377       387       397       407       417       427       437       447       457       467       477       487       497       507       517       527       537       547       557       567       577      
           T2F1_PLAOK     8 KIRTFGWVQNPGKFENLKRVVQVFDRNSKVHNEVKNIKIPTLVKESKIQKELVAIMNQHDLIYTYKELVGTGTSIRSEAPCDAIIQATIADQGNKKGYIDNWSSDGFLRWAHALGFIEYINKSDSFVITDVGLAYSKSADGSAIEKEILIEAISSYPPAIRILTLLEDGQHLTKFDLGKNLGFSGESGFTSLPEGILLDTLANAMPKDKGEIRNNWEGSSDKYARMIGGWLDKLGLVKQGKKEFIIPTLGKPDNKEFISHAFKITGEGLKVLRRAKGSTKFTRVPKRVYWEMLATNLTDKEYVRTRRALILEILIKAGSLKIEQIQDNLKKLGFDEVIETIENDIKGLINTGIFIEIKGRFYQLKDHILQFVIPNRGVTKQLVKSELEEKKSELRHKLKYVPHEYIELIEIARNSTQDRILEMKVMEFFMKVYGYRGKHLGGSRKPDGAIYTVGSPIDYGVIVDTKAYSGGYNLPIGQADEMQRYVEENQTRNKHINPNEWWKVYPSSVTEFKFLFVSGHFKGNYKAQLTRLNHITNCNGAVLSVEELLIGGEMIKAGTLTLEEVRRKFNNGEINF 583
               SCOP domains d1foka1 A:4-143 Restriction endonuclease FokI, N-terminal (recognition) domain                                                              d1foka2 A:144-281 Restriction endonuclease FokI, N-terminal (recognition) domain                                                               d1foka3 A:287-386 Restriction endonuclease FokI, N-terminal (recognition) domain                    d1foka4 A:387-579 Restriction endonuclease FokI, C-terminal (catalytic) domain                                                                                                                    SCOP domains
               CATH domains 1fokA01 A:4-292 Foki Restriction Endonuclease, Chain A, domain 1                                                                                                                                                                                                                                 ---------1fokA02 A:302-388 'winged helix' repressor DNA binding domain                          ------------1fokA03 A:401-578  [code=3.40.91.30, no name defined]                                                                                                                             - CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author .............hhhhhhhhhhh....hhhhhhhh.hhhhh...hhhhhhhhhhhh.......hhhhh......hhh.....hhhhh............hhhhhhhhhhhhh...eeee....eeee.hhhhhhhh.....hhhhhhhhhhhhh.hhhhhhhhhh.......hhhhhhh.............hhhhhhhhh........hhhh....hhhhhhhhhhhhhhh...eee..eeee...---...eeee...eee.hhhhhhhhhhh..-----......hhh.......hhhhhhhhhhhhhhhhh.....hhhhhhhhhhh.....hhhhhhhhhhhhh....eeee..eeee..............hhh....hhhhhhhhhhhh.....hhhhhhhhhhh.hhhhhhhhhhhhhhhhh....eeee........eeee.......eeeeeeee.........hhhhhhhhhhhhh............hhhh......eeeeeeee........hhhhhhhhhh...eeeeehhhhhhhhhhhhh................... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 1fok A   4 KIRTFGWVQNPGKFENLKRVVQVFDRNSKVHNEVKNIKIPTLVKESKIQKELVAIMNQHDLIYTYKELVGTGTSIRSEAPCDAIIQATIADQGNKKGYIDNWSSDGFLRWAHALGFIEYINKSDSFVITDVGLAYSKSADGSAIEKEILIEAISSYPPAIRILTLLEDGQHLTKFDLGKNLGFSGESGFTSLPEGILLDTLANAMPKDKGEIRNNWEGSSDKYARMIGGWLDKLGLVKQGKKEFIIPT---PDNKEFISHAFKITGEGLKVLRRAKGS-----VPKRVYWEMLATNLTDKEYVRTRRALILEILIKAGSLKIEQIQDNLKKLGFDEVIETIENDIKGLINTGIFIEIKGRFYQLKDHILQFVIPNRGVTKQLVKSELEEKKSELRHKLKYVPHEYIELIEIARNSTQDRILEMKVMEFFMKVYGYRGKHLGGSRKPDGAIYTVGSPIDYGVIVDTKAYSGGYNLPIGQADEMQRYVEENQTRNKHINPNEWWKVYPSSVTEFKFLFVSGHFKGNYKAQLTRLNHITNCNGAVLSVEELLIGGEMIKAGTLTLEEVRRKFNNGEINF 579
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153       163       173       183       193       203       213       223       233       243       | - |     263       273       | -   |   293       303       313       323       333       343       353       363       373       383       393       403       413       423       433       443       453       463       473       483       493       503       513       523       533       543       553       563       573      
                                                                                                                                                                                                                                                                                 251 255                       281   287                                                                                                                                                                                                                                                                                                    

Chain B from PDB  Type:DNA  Length:20
                                                    
                 1fok B 901 TCGGATGATAACGCTAGTCA 920
                                   910       920

Chain C from PDB  Type:DNA  Length:20
                                                    
                 1fok C 921 ATGACTAGCGTTATCATCCG 940
                                   930       940

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 4)

Asymmetric/Biological Unit

(-) CATH Domains  (3, 3)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1FOK)

(-) Gene Ontology  (8, 8)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (T2F1_PLAOK | P14870)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0009036    Type II site-specific deoxyribonuclease activity    Catalysis of the endonucleolytic cleavage of DNA to give specific double-stranded fragments with terminal 5'-phosphates and 3' hydroxyls. Cleavage is dependent on the presence in the DNA of a specific recognition site; cleavage occurs at or very near this recognition site.
    GO:0004536    deoxyribonuclease activity    Catalysis of the hydrolysis of ester linkages within deoxyribonucleic acid.
    GO:0004519    endonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by creating internal breaks.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0004518    nuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids.
biological process
    GO:0009307    DNA restriction-modification system    A defense process found in many bacteria and archaea that protects the organism from invading foreign DNA by cleaving it with a restriction endonuclease. The organism's own DNA is protected by methylation of a specific nucleotide, which occurs immediately following replication, in the same target site as the restriction enzyme.
    GO:0090305    nucleic acid phosphodiester bond hydrolysis    The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1fok)
 
  Sites
(no "Sites" information available for 1fok)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1fok)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1fok
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  T2F1_PLAOK | P14870
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  T2F1_PLAOK | P14870
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        T2F1_PLAOK | P148702fok

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1FOK)